Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

Rooks are omnivorous; they eat a very broad range of food, including earthworms and other invertebrates (2), seeds and waste root crops in winter (4). They feed on the ground, often inserting the beak into the soil, and may bury food for consumption at a later time (5). This bird is very sociable, and nests communally in groups of trees known as 'rookeries' (5). Communal roosts form in winter, consisting of birds from a number of breeding rookeries (4). These roosts can be huge; one in northwest Scotland contained 65,000 rooks (4). By February, the rooks return to their own rookery in order to start breeding (4); pairs defend a small area around their nests. During courtship, the male struts around, bowing, posturing and cawing; he may then empty the contents of his food pouch into the female's mouth before mating takes place (5). The nest is constructed of twigs, and 3-5 blue or grey-green eggs are laid towards the end of March. These are incubated by the female for up to 18 days; whilst the female incubates the eggs and broods the chicks she is fed by the male (5). After 40 days, the chicks are fully grown, but they remain dependent on their parents for food until they reach 60 days of age, and only become truly independent after around 5 months (5). Like many members of the crow family, the rook figures heavily in folklore. The sudden desertion of a rookery was said to be a bad omen for the landowner. Rooks are believed to indicate rain by certain behaviour (6), and are also believed to be able to smell approaching death (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The rook is the same size as carrion and hooded crows (Corvus corone, and C. cornix respectively). It has black plumage with a red-lilac gloss (2). Adults have a bare area of whitish-grey skin at the base of the bill, and a slightly 'peaked' crown (2). Immature rooks look very similar to carrion crows, especially as they have facial feathers and nasal bristles (5), however they can be identified by their straighter, more pointed bill (2). Vocalisations are hoarse and 'grinding' and a tremendous cacophony can be produced from large rookeries (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The range of the rook extends throughout Europe and Asia; in Britain it is very widespread (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.408 - 11.396
  Nitrate (umol/L): 1.335 - 8.636
  Salinity (PPS): 6.428 - 34.665
  Oxygen (ml/l): 6.315 - 7.967
  Phosphate (umol/l): 0.273 - 0.574
  Silicate (umol/l): 3.347 - 9.916

Graphical representation

Temperature range (°C): 9.408 - 11.396

Nitrate (umol/L): 1.335 - 8.636

Salinity (PPS): 6.428 - 34.665

Oxygen (ml/l): 6.315 - 7.967

Phosphate (umol/l): 0.273 - 0.574

Silicate (umol/l): 3.347 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occupies agricultural land below 300m, and seems to prefer farms with both pasture and arable areas (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Corvus frugilegus preys on:
Crangon crangon
Hydrobia ulvae
Littorina littorea
Macoma balthica
Gallinula chloropus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Tool use

Recent studies suggest that under experimental conditions, rooks will drop stones in pitchers of water much as they do in Aesop's fable. Researchers placed a worm in a narrow tube, out of reach of the bird. Four different individuals solved the problem independently, and three learned quickly to use larger rather than smaller stones.

http://www.cell.com/current-biology/abstract/S0960-9822(09)01455-9

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Corvus frugilegus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Corvus frugilegus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCAACTAACCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCAGGTGCTCTGCTAGGAGAC---GACCAAATCTACAATGTAATCGTTACAGCCCATGCTTTCGTCATAATTTTCTTTATAGTAATGCCAATCATAATCGGAGGATTTGGAAACTGACTAGTTCCTCTAATAATTGGTGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCCTCATTCCTCCTCCTTCTAGCTTCTTCAACAGTAGAGGCAGGAGCAGGAACAGGATGAACTGTGTACCCACCACTAGCTGGTAACCTAGCTCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCACTTCACCTAGCAGGTATTTCCTCCATCCTAGGGGCAATTAACTTCATTACCACAGCAATCAACATGAAACCTCCAGCCCTATCACAATACCAAACCCCTCTGTTCGTATGATCCGTACTAATTACCGCAGTACTACTCCTTCTCTCTCTACCCGTACTTGCTGCAGGAATCACTATGCTCCTAACAGACCGAAACCTCAATACCACATTCTTTGATCCAGCCGGAGGAGGAGATCCAGTACTATACCAACATCTATTCTGATTCTTCGGACACCCAGAAGTTTATATCCTAATCCTACCAGGATTCGGCATCATCTCTCATGTAGTAGCATACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGAATAGTATGAGCTATGCTATCCATTGGGTTCCTAGGTTTCATCGTTTGAGCACACCACATGTTTACAGTCGGAATGGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981 (3). Included in the Birds of Conservation Concern Green List (low conservation concern) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 10,000,000-18,000,000 breeding pairs, equating to 30,000,000-54,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 61,200,000-216,000,000 individuals, although further validation of this estimate is needed. National population sizes have been estimated at c.100-10,000 breeding pairs and c.50-1,000 wintering individuals in China and c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This is one of the most common agricultural birds, yet, like many of its relatives, it has suffered persecution at the hands of farmers, gamekeepers and landowners for many hundreds of years, as it is perceived as a pest. Organochloride chemicals are also known to affect this species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

No specific conservation action is targeted at this species, but it should benefit from work for farmland birds in general, such as agri-environment schemes (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rook (bird)

For other uses, see Rook.

The rook (Corvus frugilegus) is a member of the Corvidae family in the passerine order of birds. Named by Carl Linnaeus in 1758,[2] the species name frugilegus is Latin for "food-gathering".

Description[edit]

Rook at the Cafe, Marwell Zoo

This species is similar in size (45–47 cm in length) to or slightly smaller than the carrion crow with black feathers often showing a blue or bluish-purple sheen in bright sunlight. The feathers on the head, neck and shoulders are particularly dense and silky. The legs and feet are generally black and the bill grey-black.

Rooks are distinguished from similar members of the crow family by the bare grey-white skin around the base of the adult's bill in front of the eyes. The feathering around the legs also looks shaggier and laxer than the congeneric carrion crow. The juvenile is superficially more similar to the crow because it lacks the bare patch at the base of the bill, but it has a thinner bill and loses the facial feathers after about six months. Collective nouns for rooks include building, parliament, clamour and storytelling.[3][4] Their communal nesting behaviour gave rise to the term rookery.

Distribution and habitat[edit]

Rooks are resident in Great Britain, Ireland and much of north and central Europe but vagrant to Iceland and parts of Scandinavia, where they typically live south of the 60th latitude and in habitats that ravens dislike, such as open agricultural areas. It also occurs as an eastern race in Asia where it differs in being slightly smaller on average, and having a somewhat more fully feathered face. In the north of its range the species has a tendency to move south during autumn though more southern populations are apt to range sporadically also. The species has been introduced to New Zealand, with several hundred birds being released there from 1862 to 1874, though today their range is very localised.[5] There the species is an agricultural pest and it is being eradicated.

Behaviour and ecology[edit]

A rook skull

Diet[edit]

Food is predominantly earthworms and insect larvae, which the bird finds by probing the ground with its strong bill. It also eats cultivated cereal grain, smaller amounts of fruit, small mammals, acorns, small birds, their eggs and young and carrion. In urban sites, human food scraps are taken from rubbish dumps and streets, usually in the early hours when it is relatively quiet. It can also be seen along the seashore, feeding on insects, crustaceans and suitable food flotsam.

Nesting[edit]

The distribution of rook colony sizes in Normandy.[6] Most colonies are small, a few are large (smoothed).

Nesting in a rookery is always colonial, usually in the very tops of the trees. Branches and twigs are broken off trees (very rarely picked up off the ground), though as many are likely to be stolen from nearby nests as are collected from trees. Eggs are usually 3–5 in number, can appear by the end of February or early March and are incubated for 16–18 days. Both adults feed the young, which are fledged by the 32nd or 33rd day.

In autumn, the young birds of the summer collect into large flocks together with unpaired birds of previous seasons, often in company with jackdaws. It is during the autumn that spectacular aerial displays can be seen by adult birds that seem to delight in the autumn gales.

Voice[edit]

The call is usually described as kaah – it is similar to that of the carrion crow, but usually rather flatter in tone. It is given both in flight and while perched, when the bird fans its tail and bows on each caw. Calls in flight are usually given singly, in contrast to the carrion crow's which are in groups of three or four. Solitary birds often "sing" apparently to themselves, uttering strange clicks, wheezes and almost human-like notes.

In The Rooks Have Returned (1871) by Alexei Savrasov, the arrival of the rooks is an early portent of the coming spring.

Intelligence[edit]

In captivity, when confronted with problems, rooks have been documented as one of several species of birds capable of using tools to achieve a goal. Rooks learned that if they push a stone off a ledge into a tube, they will get food. The rooks then discovered they could find and bring a stone and carry it to the tube if no stone was there already. They also used sticks and wire, and figured out how to bend a wire into a hook to reach an item.[7] Rooks are as clever at making and using simple tools with their beaks as chimpanzees are with their hands.[8]

In an experiment, a rook was placed near a tube of water, with a worm floating on top of the water, and some rocks next to the tube. The water level was too low for the rook to reach the worm, so it placed rocks into the tube until the level was high enough.[9]

References[edit]

  1. ^ BirdLife International (2012). "Corvus frugilegus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Linnaeus, C. (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. (in Latin). Holmiae: Laurentii Salvii. p. 824. 
  3. ^ "Collective Nouns for Birds". Palomar Audubon Society. Retrieved August 11, 2010. 
  4. ^ "Collective Nouns for Birds". New Zealand Birds. Retrieved August 11, 2010. 
  5. ^ Barrie Heather & Hugh Robertson (2005). The Field Guide to the Birds of New Zealand. Penguin Group. ISBN 978-0-14-302040-0. 
  6. ^ G. Debout (2003). "Le corbeau freux (Corvus frugilegus) nicheur en Normandie: recensement 1999 & 2000". Cormoran (in French) 13: 115–121. 
  7. ^ Rebecca Morelle (May 26, 2009). "Rooks reveal remarkable tool-use". BBC News. Retrieved May 22, 2010. 
  8. ^ "Study finds rooks as clever as chimpanzees". United Press International. May 26, 2009. 
  9. ^ Sarah Bloch (August 7, 2009). "Video: Aesop's Fable - or fact? Meet the world's cleverest bird". Times Online. 
  • Handbook of the Birds of Europe, the Middle East, and North Africa: The Birds of the Western Palearctic Volume VIII: Crows to Finches Chief Editor: the late Stanley Cramp, Edited by C. M. Perrins ISBN 0-19-854679-3
  • Crows and Jays by Madge and Burn, ISBN 0-7136-3999-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!