Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

Rooks are omnivorous; they eat a very broad range of food, including earthworms and other invertebrates (2), seeds and waste root crops in winter (4). They feed on the ground, often inserting the beak into the soil, and may bury food for consumption at a later time (5). This bird is very sociable, and nests communally in groups of trees known as 'rookeries' (5). Communal roosts form in winter, consisting of birds from a number of breeding rookeries (4). These roosts can be huge; one in northwest Scotland contained 65,000 rooks (4). By February, the rooks return to their own rookery in order to start breeding (4); pairs defend a small area around their nests. During courtship, the male struts around, bowing, posturing and cawing; he may then empty the contents of his food pouch into the female's mouth before mating takes place (5). The nest is constructed of twigs, and 3-5 blue or grey-green eggs are laid towards the end of March. These are incubated by the female for up to 18 days; whilst the female incubates the eggs and broods the chicks she is fed by the male (5). After 40 days, the chicks are fully grown, but they remain dependent on their parents for food until they reach 60 days of age, and only become truly independent after around 5 months (5). Like many members of the crow family, the rook figures heavily in folklore. The sudden desertion of a rookery was said to be a bad omen for the landowner. Rooks are believed to indicate rain by certain behaviour (6), and are also believed to be able to smell approaching death (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The rook is the same size as carrion and hooded crows (Corvus corone, and C. cornix respectively). It has black plumage with a red-lilac gloss (2). Adults have a bare area of whitish-grey skin at the base of the bill, and a slightly 'peaked' crown (2). Immature rooks look very similar to carrion crows, especially as they have facial feathers and nasal bristles (5), however they can be identified by their straighter, more pointed bill (2). Vocalisations are hoarse and 'grinding' and a tremendous cacophony can be produced from large rookeries (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Corvus frugilegus is found in the Palearctic region, across much of Europe and Asia. Two subspecies of rooks are recognized: C. f. frugilegus and C. f. pastinator. The geographic range of C. f. frugilegus extends from Ireland eastward across Europe into Russia, with southern boundaries as far as Turkey and Iran. Sporadic, localized populations can be found as far north as southern Sweden, Norway, and Denmark. Populations have also been introduced in New Zealand, where they flourish. During breeding and migration, C. f. frugilegus can be found in northern Russia and the Mediterranean area, respectively. The geographic range of C. f. pastinator, commonly known as the Oriental rook, extends from eastern Asia west into northern Mongolia. The two subspecies are generally geographically separated by the Altai Mountains.

Biogeographic Regions: palearctic (Native ); oceanic islands (Introduced )

  • Madge, S., H. Burn. 1994. Crows and Jays. Princeton, NJ: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The range of the rook extends throughout Europe and Asia; in Britain it is very widespread (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Corvus frugilegus is similar in appearance to C. corone (carrion crow), another species of corvid. Though both species are covered in glossy black feathers with a metallic sheen, rooks are distinguishable from carrion crows by their slightly smaller size, distinct wedge-shape tail, light colored bill, and prominently-fingered wingtips. Rooks average 47 cm long and weigh 337 to 531 g, but are considered large when compared to most other corvid species. Rooks show weak sexual dimorphism, with males slightly larger than females. In rooks, wing length ranges from 290 to 330 mm and tarsus length ranges from 52 to 58 mm. For their size, rooks have a relatively large bill (53 to 57 mm long) that tapers to a sharp point. This long, sharp bill aids in food retrieval and eating insects.

Corvus frugilegus frugilegus tends to have a longer, thicker beak than that of C. f. pastinator, as well as a larger area of bare skin covering the forehead, lores (skin between eye and bill on side of head), and gular area (skin that joins lower mandible to neck). Corvus frugilegus frugilegus also has a violet sheen to its black feathers, whereas C. f. pastinator has a greenish sheen. Juveniles of both subspecies are easily recognizable by their brown-toned feathers and fully-feathered face, which does not become bare until their first spring.

Range mass: 337 to 531 g.

Average length: 47 cm.

Range wingspan: 290 to 330 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.408 - 11.396
  Nitrate (umol/L): 1.335 - 8.636
  Salinity (PPS): 6.428 - 34.665
  Oxygen (ml/l): 6.315 - 7.967
  Phosphate (umol/l): 0.273 - 0.574
  Silicate (umol/l): 3.347 - 9.916

Graphical representation

Temperature range (°C): 9.408 - 11.396

Nitrate (umol/L): 1.335 - 8.636

Salinity (PPS): 6.428 - 34.665

Oxygen (ml/l): 6.315 - 7.967

Phosphate (umol/l): 0.273 - 0.574

Silicate (umol/l): 3.347 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rooks are widely distributed across Europe and western Asia, preferring arable land, river plains, and steppe regions where soil is generally soft and fertile. In agricultural landscapes, rooks tend to avoid areas where winter cereal grains such as rye and wheat are grown, instead preferring areas in which softer and more easily-accessible spring cereals such as barley are grown. Spring cereals are an ideal food source for C. frugilegus due to easy foraging that results from their small height. River plains and steppe regions also serve as excellent habitats for rooks because their rich soil is usually teeming with insects, and soft ground makes foraging possible. Rooks can also be found in areas bordering cities and towns as long as large trees are available for cover and food is available for scavenging. Given their wide occupation of much of Europe and Asia, rooks are able to tolerate a large elevation range, from sea level to approximately 4000 m.

Range elevation: 0 to 4000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: suburban ; agricultural ; riparian

  • Feare, C. 1974. Ecological studies of the rook (Corvus frugilegus) in north-east Scotland: Damage and its control. Journal of Applied Ecology, 11/3: 897-914.
  • Griffin, L., C. Thomas. 2000. The spatial distribution and size of rook (Corvus frugilegus) breeding colonies is affected by both the distribution of foraging habitat and by intercolony competition. Proceedings of the Royal Society of London, Series B, 267: 1463-1467.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.408 - 11.396
  Nitrate (umol/L): 1.335 - 8.636
  Salinity (PPS): 6.428 - 34.665
  Oxygen (ml/l): 6.315 - 7.967
  Phosphate (umol/l): 0.273 - 0.574
  Silicate (umol/l): 3.347 - 9.916

Graphical representation

Temperature range (°C): 9.408 - 11.396

Nitrate (umol/L): 1.335 - 8.636

Salinity (PPS): 6.428 - 34.665

Oxygen (ml/l): 6.315 - 7.967

Phosphate (umol/l): 0.273 - 0.574

Silicate (umol/l): 3.347 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occupies agricultural land below 300m, and seems to prefer farms with both pasture and arable areas (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Rooks are opportunistic feeders. As omnivores, they eat any edible food item. Due to the strength and size of the bill, rooks are often found probing the ground in search of earthworms or other insects. Rooks also ingest small acorns, small fruits, and cereal grains. When the opportunity arises, rooks prey on small mammals, small birds, carrion, and eggs of the same species. They also have been known to act as “nest predators”, attacking the nests of other species of birds in order to eat the hatchlings and eggs.

Rook feeding habits often vary due to the location of their nest. Unlike those occurring in natural areas as above, those that live near urban sites also act as scavengers and take advantage of trashcans as well as abandoned food. Most rooks spend much of their time foraging at dawn and dusk. Primarily searching at dawn, rooks will pick through garbage bags to obtain food. However, they have been seen foraging during the day. Like all corvids, rooks store their food.

Animal Foods: birds; mammals; eggs; carrion ; insects; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates, Eats eggs, Insectivore , Eats non-insect arthropods, Vermivore, Scavenger ); herbivore (Frugivore , Granivore ); omnivore

  • Baughman, M. 2003. Reference ATLAS to the Birds of North America. Washington, D.C: National Geographic Society.
  • Bird, C., N. Emery. 2008. Using video playback to investigate the social preferences of rooks, Corvus frugilegus. Animal Behavior, 76/3: 679-687.
  • Feare, C., G. Dunnet, I. Patterson. 1974. Ecological studies of the rook (Corvus frugilegus) in north-east Scotland: Food intake and feeding behavior. Journal of Applied Ecology, 11/3: 867-896.
  • Harrison, J. 1978. Bird Families of the World. S.A., Lausanne: Elsevier Publishing Projects.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Rooks have numerous roles in the ecosystem. They serve as hosts for numerous protozoan organisms such as trypanosomes and leucocytozoans. Such organisms are generally not pathogenic and merely occupy rooks as vectors. While rook hosting of these organisms does not directly cause it any harm, it makes infection of other species possible. In this way, rooks sustain the lifecycle of these organisms.

Rooks also serve as hosts for oribatid mites, among other types of mites. Oribatid mites are soil mites, and feed on dead plant and fungal material. These mites live in the feathers of rooks, where it is believed they consume fungi. Such a relationship does not harm rooks, it is actually beneficial, though its results are not readily noticeable.

Lastly, rooks play a key role in seed dispersal as they crack open and consume cereal grains such as barley. Without birds and small animals to crack open seeds and remove them from the plant, seed dispersal for cereal grains could be problematic or less efficient.

Ecosystem Impact: disperses seeds; soil aeration

Mutualist Species:

  • oribatid mites (Oribatidae)

Commensal/Parasitic Species:

  • trypanosomes (Trypanosoma)
  • leucocytozoans (Leucocytozoon)

  • Baker, J. 1974. Protozoan parasites of the blood of British wild birds and mammals. Journal of Zoology: Proceedings of the Zoological Society of London, 172: 169-190.
  • Krivolutsky, D., N. Lebedeva. 2004. Oribatid mites (oribatei) in bird feathers: Passeriformes. Acta Zoologica Lituanica, 14/2: 19-38.
  • Lockie, J. 1956. The food and feeding behaviour of the jackdaw, rook and carrion crow. Journal of Animal Ecology, 25/2: 421-428.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about predators of rooks. However, they appear to have similar predators to Corvus corax or Corvus brachyrhynchos, both similar and closely related species in the Family Corvidae. Owls, such as Bubo virginianus, hawks, or even intruding species of Corvidae tend to be the primary predators of rooks. Raptorial bird species prey on fledglings from nests more often than attacking adults. Humans may also pose as a threat to some species due to increasing tolerance of human presence. Humans are a threat due to shootings and habitat destruction of rooks.

Known Predators:

  • great horned owls (Bubo virginianus)
  • hawks (Accipitriformes)
  • rooks (Corvus frugilegus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Corvus frugilegus preys on:
Crangon crangon
Hydrobia ulvae
Littorina littorea
Macoma balthica
Gallinula chloropus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Rooks have a distinct call that has been described as sounding like a “caw." When rooks are defending or establishing a territory, multiple “caws” are used. Rooks also have a snarling call, as well as a gull call, which are used when an intruder comes within a short distance of their nest. In order to remain in contact with other rooks, a single loud “caw” is used during both foraging and migration. However, it is believed that rooks mainly vocalize with their mate, rather than in other social interactions. Like other birds, rooks perform singing duets (usually with a mate) that are believed to create a stronger mating bond. Female rooks use frequent vocalizations, by means of a begging call, in order to establish a submissive state with their mate, as well as to show dependency towards the male. Rooks also rely heavily on vocal communication with their young during the first few days of hatching.

Auditory communication is vital to the rook. They have a sense of hearing which helps them distinguish amongst other populations and species. The rook is able to recognize the call of a mate or its young. In addition to vocalizations, rooks also rely on visual communication, which becomes increasingly more important once young are able to open their eyes. Pecking is another form of communication, when an intruder rook comes too close to a territory; pecking attacks can occur usually resulting in the retreat of the intruder.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; polarized light ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tool use

Recent studies suggest that under experimental conditions, rooks will drop stones in pitchers of water much as they do in Aesop's fable. Researchers placed a worm in a narrow tube, out of reach of the bird. Four different individuals solved the problem independently, and three learned quickly to use larger rather than smaller stones.

http://www.cell.com/current-biology/abstract/S0960-9822(09)01455-9

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Not much is recorded on the lifespan of C. frugilegus, but like most Corvidae species, the rook is expected to live 15 to 20 years in the wild. According to the EURING European Longevity Records, the oldest rook found in the wild lived to be 22 years old. As is the trend, rooks in captivity may live for much longer. In a similar species, Corvus corax, the longest lifespan was recorded at 69 years for life in captivity.

Average lifespan

Status: wild:
22 years.

Typical lifespan

Status: wild:
15 to 20 years.

  • Flower, M. 1938. The duration of life in animals. IV. Birds. Proceedings of the Zoological Society of London, A108/2: 195-235.
  • Fransson, T., T. Kolehmainen, C. Kroon, L. Jansson, T. Wenninger. 2010. "EURING list of longevity records for European birds" (On-line). Accessed December 05, 2011 at http://www.euring.org/data_and_codes/longevity.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Despite their highly social nature, rooks form pair bonds that lasts from several years to life. Rooks generally take mates when they are two years old. During the fall mating season, pair bonds nest together in communal roosts called rookeries until they return to individual nests to lay eggs. Despite hundreds of birds in a single rookery, rooks maintain their pair bonds through extensive communication. Though rooks are known for being monogamous, like other corvid species such as Corvus corax (common ravens) and C. corone (carrion crows), there have been reported instances of bigamy and occupation of a nest by multiple females.

Mating System: monogamous ; cooperative breeder

Breeding and egg-laying usually begins around late February in Britain, but may be as late as April and May in central Europe and Russia where cold weather persists for a longer period of time. Rooks generally build nests in tall deciduous trees, though nests on the ground and in bushes are not uncommon. Nests consist of sticks and branches with a deep leaf, grass, and moss-lined cup. Rooks (Corvus frugilegus) lay two to seven (average four) blue-green eggs that are covered with brown and grey mottling. Rook eggs are very similar in appearance to those of ravens (C. corax), though slightly smaller, on average 40 mm long. After 16 to 18 days of incubation mainly by the female, the young hatch blind and helpless.

Breeding interval: Rooks breed once yearly.

Breeding season: Breeding occurs in February through May, depending on length of winter.

Range eggs per season: 2 to 7.

Average eggs per season: 4.

Range time to hatching: 16 to 18 days.

Range fledging age: 32 to 33 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

For the 16 to 18 day incubation period the female rook covers the eggs unless she has to briefly leave the nest, in which case the male takes over this duty. After hatching, the female tends to the young exclusively while the male delivers food. This continues for approximately the first ten days until the young become more self-sufficient, at which point the female joins the male in food gathering. At around 32 to 33 days old the young rooks fledge and leave the nest, but roost in nearby trees to remain close to the parents. The young continue their relationship with the parents for several weeks until they become fully independent. Even after reaching full maturity and independence, rooks generally remain members of their original rookery.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); extended period of juvenile learning

  • Green, P. 1982. Bigamy in the rook Corvus frugilegus. The British Ornithologists’ Union, 82: 193-196.
  • Kasprzykowski, Z. 2007. Reproduction of the rook, Corvus frugilegus in relation to the colony size and foraging habitats. Folia Zool, 56/2: 186–193.
  • Madge, S., H. Burn. 1994. Crows and Jays. Princeton, NJ: Princeton University Press.
  • Roskaft, E., Y. Espmark. 1982. Vocal communication by the rook Corvus frugilegus during the breeding season. Ornis Scandinavica, 13/1: 38-46.
  • Røskaft, E. 1983. Male promiscuity and female adultery by the rook Corvus frugilegus. Ornis Scandinavica, 14/3: 175-179.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corvus frugilegus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCAACTAACCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCAGGTGCTCTGCTAGGAGAC---GACCAAATCTACAATGTAATCGTTACAGCCCATGCTTTCGTCATAATTTTCTTTATAGTAATGCCAATCATAATCGGAGGATTTGGAAACTGACTAGTTCCTCTAATAATTGGTGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCCTCATTCCTCCTCCTTCTAGCTTCTTCAACAGTAGAGGCAGGAGCAGGAACAGGATGAACTGTGTACCCACCACTAGCTGGTAACCTAGCTCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCACTTCACCTAGCAGGTATTTCCTCCATCCTAGGGGCAATTAACTTCATTACCACAGCAATCAACATGAAACCTCCAGCCCTATCACAATACCAAACCCCTCTGTTCGTATGATCCGTACTAATTACCGCAGTACTACTCCTTCTCTCTCTACCCGTACTTGCTGCAGGAATCACTATGCTCCTAACAGACCGAAACCTCAATACCACATTCTTTGATCCAGCCGGAGGAGGAGATCCAGTACTATACCAACATCTATTCTGATTCTTCGGACACCCAGAAGTTTATATCCTAATCCTACCAGGATTCGGCATCATCTCTCATGTAGTAGCATACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGAATAGTATGAGCTATGCTATCCATTGGGTTCCTAGGTTTCATCGTTTGAGCACACCACATGTTTACAGTCGGAATGGACGTAGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corvus frugilegus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5