Overview

Distribution

Range

Mountains of sw US to Mexico and Guatemala.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Selasphorus platycercus is a migratory species with some resident populations in Mexico. Migratory populations breed in Colorado and Wyoming, while tropical resident populations breed in central Mexico. Their winter range expands from northern Guatemala to northern Mexico. Information on non-migratory populations is lacking (Calder and Calder, 1992).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Breeding range includes the mountains from north-central Idaho, northern Utah, and northern Wyoming south to southeastern California, northeastern Sonora, central Mexico, and western Texas, as well as eastern Chiapas and Guatamala. Winter range extends from the highlands of northern Mexico to southern Mexico and Guatamala.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Broad-tailed hummingbirds are sexually dimorphic. Males have a metallic iridescent-rose colored gorget, green colored sides and back with some rufous color in the tail. The females are less colorful, lacking a complete gorget, and exhibiting buffy colored sides and a green back. Females are larger than males but body mass can vary during the course of a day based on nectar intake. Juvenile males look like adult females and are difficult to distinguish. (Kaufman, 2000).

Range mass: 3 to 4 g.

Range length: 83 to 97 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 10 cm

Weight: 4 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The breeding habitat of broad-tailed hummingbirds includes willows around wet or dry stream beds, pinion, juniper, spruce and oak woodlands. They are known to nest as high as 3,230 m. In their winter range, which overlaps with the breeding range of resident populations in Mexico, broad-tailed hummingbirds use thorn and oak forests at lower elevations, and mixed oak-pine and cypress as well as fir forests at higher elevations. Because of the year-round availability of hummingbird feeders in some areas, some individuals have taken up residence in urban and suburban areas of southwestern United States (Calder and Calder, 1992).

Range elevation: 1,000 to 4,000 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitat includes open woodland, especially pinyon-juniper, pine-oak, and conifer-aspen associations; also brushy hillsides and montane scrub and thickets. In migration and winter this hummingbird also inhabits open situations in lowlands with flowering shrubs. It may move to higher elevations after breeding. Nests usually are on low horizontal branches of willows, alders, cottonwoods, pines, firs, spruces, or aspens, generally 3-13 feet (1-4 meters) above ground, sometimes in tall sycamores or pines at 20-30 feet (6-9 meters). Nests often are above water (Johnsgard 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in the United States and northern Mexico move south for winter. They have departed from the northern part of the range usually by the end of September and from the southern United States by the end of October. Northward migration through the southern United States occurs from late February to April. Migrants arrive in northern breeding areas around mid-May.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Broad-tailed hummingbirds feed on floral nectar and small insects. They usually visit flowers with red tubular corollas like the Scarlet Gilia (Ipomopsis aggregata). In the wintering grounds Broad-tailed Hummingbirds are not the dominant species and may have to forage on less preferred flowers. A study done with Ruby Throated, Rufous and Broad-tailed Hummingbirds suggested that there may be an element of observational learning involved in learning to forage on novel food resources. Insects are caught in air as well as by gleaning from foliage. There is a daily steady gain in body mass of individuals from foraging over the course of a day, with a total gain of 30 to 34% of their body mass just before flying to their roosting sites. This large foraging bout before roosting is probably needed to store energy for overnight thermoregulation.

Nectar used by hummingbirds contains large amounts of water that a hummingbird has to pass through its body either by absorbing it into the intestinal tract to be processed by the kidneys or just letting it pass through the tract without absorption. Water intoxication would be a major problem for most vertebrate species under these conditions but hummingbirds are able to excrete large amounts of dilute urine and handle large amounts of water being processed by the kidneys. They do however vary the amount of nectar taken in based on the sugar concentration of that nectar.

Nectar is taken from the following plants: Ipomopsis aggregata, Aquilegia elegantula, A. triternata, Penstemon spp., Castilleja spp., Salvia spp.,  Echinocereus grandiflorum, Mertensia oblongiforumDelphinuim nelsoni, Ribes ciliatum, Cestrum terminale, Buddleia dara and Senecio angulifolius.

(Calder and Calder, 1992; Calder, 1994; McWhorter and Martinez del Rio, 1999; Altshuler and Nunn, 2001)

Animal Foods: insects

Plant Foods: nectar

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet includes nectar (primary sources vary with location) and small insects and spiders obtained from flowers, foliage, or by hawking. See Johnsgard (1983) for review of nectar sources in different areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Broad-tailed hummingbirds are important pollinators of the plant species they forage on. (Calder and Calder, 1992).

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Selasphorus platycercus preys on:
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Arizona, males defended breeding territory that averaged about 2040 sq m; in Colorado, males observed displaying close to one another in apparent lek (see Johnsgard 1983). May compete with rufus hummingbird for same food resources in some areas.

In their mountain breeding areas, where nectar may be limited and night rather cold, broad-tailed hummingbirds regularly exhibit greatly lowered body temperatures at night in response to inadequate energy intake or the need to conserve energy for flight the next day.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Life expectancy is 1.6 years based on the 50% mark on a survivorship curve in males and 1.9 years in females. The highest recorded age for wild females is 12 years and 8 years in males. (Calder and Calder, 1992)

Range lifespan

Status: wild:
12 (high) years.

Typical lifespan

Status: wild:
8 to 12 years.

Average lifespan

Status: wild:
1.75 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Broad-tailed hummingbirds have a promiscuous mating system in which male and female only interact for copulation. Males may mate with as many as six females in a season. (Calder and Calder, 1992)

Males court females by doing a series of diving displays. A lek display of three males has been observed, but it could have been a misinterpreted territorial stand. After the copulation, the female may stay and preen for a few minutes before flying away. Nests are built by the female alone. Nests take a hemisphere shape with a depression on top. Their inner diameter is 1.9 cm. Eggs are laid in clutches of two. (Calder and Calder, 1992)

Breeding season: May through August

Average eggs per season: 2.

Range time to hatching: 16 to 19 days.

Average fledging age: 25 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 2.

Female broad-tailed hummingbirds make the nest and raise the young on their own. Ten to twelve days after hatching, females start to roost away from the nest, where there is almost not enough space for the young to huddle together. Females feed young mostly small insects through their development, and then they abandon them to start their south-bound migration (Calder and Calder, 1992).

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Arizona, Utah, and Colorado egg laying occurs primarily in June-July. Clutch size is 2. Incubation, by the female, lasts 16-17 days. Young are tended by the female, fledge in 21-26 days (18 days also reported). Individual females occasionally attempt 2 broods in a single season, but one is the norm. Females may nest close together.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Selasphorus platycercus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTTGGAGCATGGGCTGGAATAGTTGGAACCTCCCTAAGCCTGCTAATCCGAGCAGAACTCGGCCAACCAGGCACCCTGCTAGGAGACGATCAAATTTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATCATAATCGGAGGCTTTGGAAACTGATTAATTCCCCTCATAATTGGGGCCCCCGATATAGCATTCCCACGTATAAATAACATAAGCTTCTGACTCCTACCACCGTCATTCCTCTTACTCCTTGCCTCCTCTACCGTAGAGGCAGGCGCAGGTACAGGATGAACCGTATACCCTCCTCTGGCCGGCAATCTAGCCCACGCAGGAGCATCAGTAGACCTAGCCATCTTCTCCTTACACCTGTCAGGTATCTCATCAATCCTGGGAGCAATTAACTTCATTACCACCGCGATCAATATAAAACCACCCGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTTATTACTGCCGTCCTACTTCTTCTCTCACTCCCAGTACTTGCCGCTGGAATCACCATACTACTCACAGACCGAAACCTAAACACCACATTTTTCGACCCCGCTGGAGGAGGAGACCCCATCCTTTACCAACACTTATTTTGATTCTTCGGCCACCCTGAAGTGTACATTCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Selasphorus platycercus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Increased use of feeders help to sustain populations in times of resource scarcity (Calder and Calder, 1992).

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Hummingbirds, especially in areas where feeders are present, can be popular attractions for tourists to want to visit. Broad-tailed hummingbirds can be incorporated into ecotourism in areas where they are prevalent.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Broad-tailed Hummingbird

The Broad-tailed hummingbird (Selasphorus platycercus) is a medium-sized hummingbird, nearly 4 in (10 cm) in length.

Female at nest

Male and female both have iridescent green backs and crowns and a white breast. The male has a gorget (throat patch) that shines with a brilliant red iridescence. The female is much duller with rust-colored, mottled flanks and underside; her tail feathers are tipped with a band of white. In flight the male's wings produce a distinct trilling sound diagnostic for this species.[2]

The summer range of the Broad-tailed Hummingbird extends across mountain forests and meadows throughout the Western United States, specifically the Great Basin region and southwards; the resident birds range from the cordilleran mountain areas of northern Mexico as far south as Guatemala. At summer's end the northerly birds migrate and overwinter in the southern part of their range. This species is somewhat vagrant, especially wintering birds, and is regularly seen in El Salvador where it does not breed. They occur at altitudes ranging from 700–900 m (2,300–3,000 ft) up to 3,350 m (10,990 ft) ASL in the tropical parts of their range.[3]

Aside from the typical hummingbird diet of nectar and insects found at flower blossoms,[4] the Broad-tailed Hummingbird will also actively hunt insects, both in flight and on foliage. This species is not considered endangered; it appears to be able to adapt quite well to human-modified habitat and frequents shade coffee plantations.[3]

Female landing at artificial feeder

Nests are small cup of plant fibers woven together and bound to a branch with collected spider webs. The female lays two plain white eggs, that she alone will incubate for 16 days. Young Broad-tailed Hummingbirds fledge about 23 days after hatching. This species is known to hybridize with Costa's Hummingbird, but apparently only very rarely.[5]

Male feeding at artificial feeder

Footnotes

  1. ^ BirdLife International (2012). "Selasphorus platycercus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ "Broad-tailed hummingbird Selasphorus platycercus". Patuxent Bird Identification InfoCenter. United States Geological Survey (USGS). Retrieved 2008-09-03. 
  3. ^ a b Herrera et al. (2006)
  4. ^ E.g. Ice-cream-bean (Inga edulis): Herrera et al. (2006)
  5. ^ Huey (1944)

References

  • Herrera, Néstor; Rivera, Roberto; Ibarra Portillo, Ricardo & Rodríguez, Wilfredo (2006): Nuevos registros para la avifauna de El Salvador. ["New records for the avifauna of El Salvador"]. Boletín de la Sociedad Antioqueña de Ornitología 16(2): 1-19. [Spanish with English abstract] PDF fulltext
  • Huey, Laurence M. (1944): A hybrid Costa's × Broad-tailed hummingbird. Auk 61(4): 636-637. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!