Overview

Brief Summary

Introduction

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

E Colombia to s Venezuela, Guianas, n Bolivia, Amaz. and e Brazil.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lipaugus vociferans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACTTTCATTAATCGATGACTATTCTCCACAAACCACAAAGATATCGGCACTCTCTACCTAATCTTTGGTGCTTGAGCTGGTATAGCTGGTACCGCCCTAAGCTTACTCATTCGAGCAGAACTTGGACAACCTGGAACTCTCTTAGGAGATGACCAAATTTACAACGTAATTGTCACCGCCCATGCCTTCGTGATAATTTTTTTCATAGTAATGCCCATCATAATTGGAGGATTTGGCAACTGACTAGTCCCTCTAATAATTGGAGCCCCCGACATAGCGTTCCCCCGTATAAACAACATAAGCTTCTGATTACTCCCACCGTCCTTTTTACTCCTCTTAGCCTCCTCTACAGTAGAAGCTGGAGCGGGTACAGGATGAACCGTATACCCTCCACTAGCTAGCAACCTAGCCCACGCCGGAGCCTCTGTAGATCTAGCCATCTTTTCTCTTCACCTAGCAGGTGTCTCATCAATCCTAGGGGCTATCAACTTTATCACCACTGCAATCAACATAAAACCTCCTGCCCTCTCACAGTACCAAACACCCTTGTTTGTTTGATCCGTCTTAATCACTGCCATCCTCCTCCTCCTTTCTCTCCCAGTCTTAGCTGCTGGCATCACCATACTCCTAACTGACCGCAACTTAAACACCACATTTTTTGACCCAGCAGGGGGAGGAGACCCCGTTCTATACCAACATCTATTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lipaugus vociferans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Screaming Piha

The screaming piha (Lipaugus vociferans) is a species of bird in the Cotingidae family. It is found in humid forests in the Amazon and tropical parts of the Mata Atlântica in South America. As it is widespread and generally fairly common, it is considered to be of least concern by BirdLife International.

While the plumage of both sexes is dull grey (wings and tail often somewhat browner), its voice is extraordinary, exceptionally loud and among the most commonly heard sounds in the Amazon. The sound is frequently used in movies, and also can be heard in the background of the popular game Angry Birds Rio.

The Cofan people of Ecuador call it the Pwe-pwe Yoh, which is a reference to its voice. Similarly, among the Ecuadorian Secoyas, the bird is known as the Kwow-kwee-yo. Males often gather in loose leks, where they sing to attract females.

Gallery[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!