Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Overview

Brief Summary

Biology

The dipper has evolved amazing methods of hunting: it swims underwater using its wings, can walk along the bottom with the wings held out to prevent it bobbing to the surface, and can swim on the surface, making dives into the water (5) (2). They feed on a wide range of aquatic invertebrates and fish (6). Dippers hunt by sight, and have a third white eye-lid known as a nictitating membrane, which protects the eye when they are submerged (5). Dippers breed early in the year, and will often have laid eggs before the end of February (6). The domed nest is constructed from straw and moss, and is typically built in a crevice below a bridge, behind a waterfall or in a stone wall (2). Four or five eggs are laid and incubated for around 16 days. The young will have fledged after 20-24 days, and the maximum lifespan of this bird is around 8 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The dipper is a dumpy aquatic bird with a short tail (3). Adults have dark sooty-black plumage with a prominent bright white bib, and the plumage below the bib and on the head is reddish-brown (2). Juveniles are greyish in colour (5). The common name 'dipper' refers to this bird's habit of 'curtseying' when perched (2). The call is a penetrating 'zits' and the song is a slow, soft warbling (5) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

White-throated dippers are found throughout the Palearctic. There are ten subspecies in the western Palearctic and three in the eastern Palearctic. They are relatively sedentary, and their lack of dispersal may contribute to the accumulation of local variation. White-throated dippers are always found near fast flowing rivers and streams, most often in mountains. Population estimates are from 330,000 to 660,000 individuals and the range is massive.

White-throated dippers are found in the following countries: Afghanistan, Albania, Algeria, Andorra, Armenia, Austria, Azerbaijan, Belarus, Belgium, Bhutan, Bosnia and Herzegovina, Bulgaria, China, Croatia, Czech Republic, Denmark, Estonia, Finland, France, Georgia, Germany, Greece, Hungary, India, Iran, Islamic Republic of Iraq, Ireland, Italy, Kazakhstan, Kyrgyzstan, Latvia, Lebanon, Liechtenstein, Lithuania, Luxembourg, Macedonia, the former Yugoslav Republic, Mongolia, Montenegro, Morocco, Myanmar, Nepal, Netherlands, Norway, Pakistan, Poland, Portugal, Romania, Russian Federation, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Tajikistan, Turkey, Turkmenistan, Ukraine, United Kingdom, Uzbekistan. White-throated dippers have been extirpated from Cyprus and vagrants have been seen in the Faroe Islands, Malta, and Tunisia.

Biogeographic Regions: palearctic (Native )

  • Hourlay, F., R. Libois, F. D'Amico, M. Sara, J. O'Halloran, J. Michaux. 2008. Evidence of a highly complex phylogeographic structure on a specialist river bird species, the dipper (Cinclus cinclus). Molecular Phylogenetics and Evolution, 49: 435-444.
  • BirdLife International, 2008. "2008 IUCN Red List of Threatened Species" (On-line). Cinclus cinclus. Accessed December 23, 2008 at http://www.iucnredlist.org/details/147141.
  • Robinson, R. 2005. "BirdFacts: species profiles of birds occurring in Britain and Ireland" (On-line). Dipper Cinclus cinclus. Accessed December 23, 2008 at http://blx1.bto.org/birdfacts/results/bob10500.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Cinclus cinclus is patchily distributed across Eurasia, occurring in the U.K., Norway, Sweden, Finland, Russia, France, Portugal, Spain, Italy, Belgium, Luxembourg, Switzerland, Germany, Liechtenstein, Austria, Slovenia, Croatia, Bosnia and Herzegovina, Serbia, Montenegro, Kosovo, Albania, The Former Yugoslav Republic of Macedonia, Bulgaria, Greece, Morocco, Algeria, Tunisia, Turkey, Armenia, Azerbaijan, Georgia, Iran, Iraq, Lebanon, Syria, Kazakhstan, Uzbekistan, Kyrgyzstan, Turkmenistan, Tajikistan, Afghanistan, Pakistan, China, Mongolia, India, Nepal and Bhutan (del Hoyo et al. 2005). The subspecies olympicus, formerly endemic to Cyprus, became extinct in 1945 (Flint and Stewart 1983).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The race that occurs in Britain, gularis, is found throughout most of Wales and northern Britain, but has a patchy distribution in south-west England (6). The Irish race, hibernicus is widespread in Ireland with the exception of central areas (6). Elsewhere, the dipper is found in much of Europe, extending east to Russia and the Urals and south to North Africa (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

White-throated dippers are small, round birds with short, pointed beaks and stubby, blunt tails. Most of the body is dark brown, almost black, and the feathers on their backs have pale edges, producing a scalloped effect. They have white bibs running from below the beak to the middle of the chest. The bibs have clear boundaries in adults, but in juveniles, the edges blur into the rest of the brown on the body. In adults, the feathers caudoventral to the bib often appear reddish, as do the feathers on their heads, but their heads are darker and browner. White-throated dippers have special white eyelids which they use to protect their eyes while foraging underwater. Their legs and feet are black and thin, with three toes forward and one backward, like most passerines. Females are smaller than males.

Basal metabolic rates were studied in correlation with dominance. It was found that more dominant animals have high BMRs. Males generally have BMRs between 49 and 57 J/g/h, and females have BMRs between 52 and 64 J/g/h.

Average mass: 64 g.

Average length: 18 cm.

Average wingspan: 28 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

White-throated dippers live near fast flowing rivers or streams in temperate and subarctic regions of Europe and Asia. They prefer cold climates and mountains, including rocky places like cliffs and peaks. They are also found near waterfalls and lakes.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: forest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds along fast-flowing streams and rivers, typically in upland areas where there are plenty of exposed stones on which they can perch (3) (2). They typically nest in crevices beneath bridges and in walls (5). In winter, dippers tend to stay in their breeding areas, but in very harsh conditions they may move to estuaries and coastal areas (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

White-throated dipper forage by walking underwater, rather than swimming like other water birds. They use their wings to stabilize themselves as water flows over them. Once they capture their prey, they surface and eat while their heads are out of the water. Occasionally they capture food outside of the water, but this appears to opportunistic rather than intentional foraging. White-throated dippers eat mostly larvae of aquatic insects, like mayflies (Ephemeroptera), caddisflies (Hydropsychidae), stoneflies (Plecoptera), and blackflies (Simuliidae). They also eat small fish, like sculpins (Cottidae), when the season is right. Their specific diet changes as they age. Nestlings have a preference for caddisfly larvae (Hydropsychidae). Juveniles begin foraging in shallow water, eating mostly blackfly larvae (Simuliidae). As they mature into adults, they become more adept at gripping the rocks and maneuvering in deeper water, so they begin diving and eating larger prey. Adults prefer mayflies (Ephemeroptera) and stoneflies (Plecoptera), and only rarely do they forage in shallow water and pick off blackfly larvae from the rocks found there. Adults also eat more prey that requires post-capture handling, like caddisfly larvae, while juveniles prefer food that is easier to eat.

Animal Foods: fish; insects

Primary Diet: carnivore (Insectivore )

  • Yoerg, S. 1994. Development of foraging behavior in the Eurasian dipper, Cinclus cinclus, from fledgling until dispersal. Animal Behavior, 47: 577-588.
  • Jenkins, R., S. Ormerod. 1996. The influence of a river bird, the dipper (Cinclus cinclus), on the behavior and drift of its invertebrate prey. Freshwater Biology, 35: 45-56.
  • Ormerod, S. 1985. The diet of breeding Dippers Cinclus cinclus and their nestlings in the catchment of the River Wye, mid-Wales: a preliminary study by faecal analysis. IBIS, 127: 316-331.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Cinclus cinclus is a valuable bio-indicator species in several countries. Its sedentary lifestyle allows it to indicate problems in specific areas, something a migratory species could not do as well. They also show high correlations between their presence/absence in a place and its level of pollution. In a study done in Italy, dippers were present in 93.3% of unpolluted streams and absent from 93.7% of the polluted ones. They are also useful because they are predators, so their absence or lack of health may indicate a cumulation of negative factors in an ecosystem. Coniferous foresting decreases the pH of streams, and overly acidic conditions can be detected by the breeding success of dipper pairs in a particular area. Many of their prey items have difficulty living under acidic conditions, so poor breeding and low foraging success by dippers can indicate too much foresting is occurring upstream.

  • Nybo, S., P. Fjeld, K. Jerstad, A. Nissen. 1996. Long-range air pollution and its impact on heavy metal accumulation in dippers Cinclus cinclus in Norway. Environmental Pollution, 94: 31-38.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White-throated dipper nests are vulnerable, so they are positioned in hard to reach places like rock faces, under cliffs or overhangs, and on bridge supports. Rats, jackdaws, crows, and mustelids all raid dipper nests. Unmated dippers may also kill young in order to gain access to a mate.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

White-throated dippers communicate with songs and calls. Physical contact, like pushing, is an effective way to establish dominance between two birds.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Many studies have shown that white-throated dippers are excellent bio-indicators, suggesting their lifespans can be affected by pollution. They typically live 3 years. The oldest bird recorded in the UK was 8 years, 4 months, though in Finland another bird reached the age of 10 years, 7 months. These ages were determined through bird banding.

Range lifespan

Status: wild:
88 (high) months.

Average lifespan

Status: wild:
3 years.

  • Sorace, A., P. Formichetti, A. Boano, P. Andreani, C. Gramegna, L. Mancini. 2002. The presence of a river bird, the dipper, in relation to water quality and biotic indices in central Italy. Environmental Pollution, 118: 89-96.
  • Logie, J. 1995. Effects of stream acidity on non-breeding Dippers Cinclus cinclus in the south-central highlands of Scotland. Aquatic Conservation: Marine and Freshwater Ecosystems, 5: 25-35.
  • Buckton, S., P. Brewin, A. Lewis, P. Stevens, S. Ormerod. 1998. The distribution of dippers, Cinclus cinclus (L.), in the acid-sensitive region of Wales, 1984-95. Freshwater Biology, 39: 387-396.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

White-throated dippers are usually monogamous, though a percentage (8 to 50%) of males are polygynous. Infanticide is known to occur; unmated birds will attack and kill the eggs or young of a pair in order to gain copulations with the opposite sex parent.

Mating System: monogamous ; polygynous

When white-throated dippers reach one year old they begin to reproduce. Males defend the pair's territory. Nests are built strategically to impair predator access, but otherwise females do not help with nest defense. Females generally lay eggs in April. Eggs are laid at a rate of one per day until the clutch reaches 4 to 5 eggs. Hatching occurs 15 to 16 days later. The young are tended through the summer. Eggs are about 26 mm long and 19 mm wide and weigh about 4.6 g, of which 5% is the shell. In highly productive breeding territories, second clutches may be laid up to 18% of the time. Territories with acidic water result in second clutch attempts in only 1.9% of nests (Vickery, 1992). Young are born in an altricial state and with some downy feathers. When they are ten days old, they weigh about 46 grams. Pairs usually raise about four chicks per year to an age of ten days.

Breeding interval: White-throated dipper pairs raise one or two clutches per season.

Breeding season: White-throated dippers lay their first clutches in early to mid March.

Average eggs per season: 4-5.

Range time to hatching: 15 to 16 days.

Range fledging age: 18 to 23 days.

Range time to independence: 9.5 to 15 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Soon after fledging, the young begin learning to forage. Adults continue to feed them while they are learning. Young begin foraging in shallow areas and catch larvae instead of the larger prey their parents retrieve while diving. The amount of food provided by parents was found to have little effect on age of independence. However, young which begged more spent less time learning to forage, which negatively impacted their ability to become independent. Because foraging ability plays such a large role in independence, birds raised along the same river and even within the same clutch can vary widely in time to independence. The fastest learners leave their parents after 9.5 days, birds that take more time learning to forage become independent after about 15 days.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Male); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Yoerg, S. 1998. Foraging behavior predicts age at independence in juvenile Eurasian dippers (Cinclus cinclus). Behavioral Ecology, 9: 471-477.
  • Wilson, J. 1991. A probable case of sexually selected infanticide by a male Dipper Cinclus cinclus. IBIS, 134: 188-190.
  • Vickery, J. 1992. The reproductive success of the dipper Cinclus cinclus in relation to the acidity of streams in south-west Scotland. Freshwater Biology, 28: 195-205.
  • Robinson, R. 2005. "BirdFacts: species profiles of birds occurring in Britain and Ireland" (On-line). Dipper Cinclus cinclus. Accessed December 23, 2008 at http://blx1.bto.org/birdfacts/results/bob10500.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cinclus cinclus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGAATGGTGGGTACTGCCCTAAGCCTACTCATTCGAGCAGAACTAGGCCAACCAGGATCCCTACTAGGCGACGACCAAGTATACAACGTAGTCGTCACAGCACATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATTGGAGGCTTCGGAAACTGACTGGTACCACTAATAATCGGAGCCCCAGACATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTACTCCCTCCATCATTCCTCCTCCTACTTGCTTCCTCCACCGTAGAGGCAGGAGTAGGCACAGGATGAACAGTATACCCTCCTCTAGCAGGCAACCTAGCCCACGCAGGAGCATCCGTAGACCTAGCCATCTTCTCTCTACACCTAGCAGGCATCTCATCAATCCTAGGAGCTATCAACTTCATCACAACAGCAATCAACATAAAACCACCCGCCCTATCACAGTATCAAACCCCATTATTTGTGTGATCAGTACTAATCACCGCAGTTCTACTACTACTTTCCCTACCCGTACTCGCTGCTGGAATTACAATACTACTTACCGACCGCAACCTAAACACCACATTCTTCGACCCTGCAGGAGGAGGAGACCCAGTCCTTTACCAACACCTGTTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCTTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cinclus cinclus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Population trends are difficult to determine for this species, but they appear to be relatively stable. They are listed as Least Concern by the IUCN red list.

US Migratory Bird Act: no special status

US Federal List: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed as a Species of Conservation Concern by the UK Biodiversity Action Plan, but not a priority species. Included in the Birds of Conservation Concern Green List (low conservation concern) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 170000-330000 breeding pairs, equating to 510000-990000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 1040000-3960000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This species is not threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of white-throated dippers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cinclus cinclus is a valuable bio-indicator species in several countries. The sedentary lifestyle of white-throated dippers makes them indicators of local habitat problems. There is a high correlation between their presence or absence in an aquatic system and the level of pollution present. In a study done in Italy, white-throated dippers were present in 93.3% of unpolluted streams and absent from 93.7% of the polluted ones. They are also useful because they are predators, so their absence or lack of health may indicate a cumulation of negative factors in an ecosystem. Coniferous forests decrease the pH of streams and overly acidic conditions can be detected through breeding success of dipper pairs in a particular area. Many of their prey items have difficulty living under acidic conditions, so poor breeding and low foraging success by dippers can indicate too much coniferous reforestation is occurring upstream.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-throated dipper

The white-throated dipper (Cinclus cinclus), also known as the European dipper or just dipper, is an aquatic passerine bird found in Europe, Middle East, Central Asia and the Indian Subcontinent. The species is divided into several subspecies, based primarily on colour differences, particularly of the pectoral band. The white-throated dipper is Norway's national bird.[3]

Taxonomy and systematics[edit]

The nominate black-bellied dipper, C. c. cinclus, has no chestnut on the lower breast. It breeds in northern Europe and wanders to milder regions in winter. It has been recorded from the United Kingdom on many occasions.

The dipper of Great Britain and Ireland, C. c. gularis and the central European race C. c. aquaticus are mainly resident.

The Cyprus population became extinct in the early 1950s. It has been described as a distinct subspecies, the Cyprus dipper (C. c. olympicus), but its validity is doubtful.

Description[edit]

The white-throated dipper is about 18 centimetres (7.1 in) long, rotund and short tailed. The head of the adult (gularis and aquaticus) is brown, the back slate-grey mottled with black, looking black from a distance, and the wings and tail are brown. The throat and upper breast are white, followed by a band of warm chestnut which merges into black on the belly and flanks. The bill is almost black, the legs and irides brown. C. c. cinclus has a black belly band.

The young are greyish brown and have no chestnut band.

Behaviour and ecology[edit]

At Brandon Creek, County Kerry, Ireland

The white-throated dipper is closely associated with swiftly running rivers and streams or the lakes into which these fall. It often perches bobbing spasmodically with its short tail uplifted on the rocks round which the water swirls and tumbles.

It acquired its name from these sudden dips, not from its diving habit, though it dives as well as walks into the water.

It flies rapidly and straight, its short wings whirring swiftly and without pauses or glides, calling a shrill zil, zil, zil. It will then either drop on the water and dive or plunge in with a small splash.

From a perch it will walk into the water and deliberately submerge, but there is no truth in the assertion that it can defy the laws of specific gravity and walk along the bottom. Undoubtedly when entering the water it grips with its strong feet, but the method of progression beneath the surface is by swimming, using the wings effectively for flying under water. It holds itself down by muscular exertion, with its head well down and its body oblique, its course beneath the surface often revealed by a line of rising bubbles.

In this way it secures its food, usually aquatic invertebrates including caddis worms and other aquatic insect larvae, beetles, Limnaea, Ancylus and other freshwater molluscs, and also fish and small amphibians. A favourite food is the small crustacean Gammarus, an amphipod shrimp. It also walks and runs on the banks and rocks seeking terrestrial invertebrates.

The winter habits of the dipper vary considerably and apparently individually. When the swift hill streams are frozen it is forced to descend to the lowlands and even visit the coasts, but some will remain if there is any open water.

Breeding[edit]

White-throated Dipper young one begging for food, at Sumdo, Ladakh, India

The nest is by the water. It is large, globular or oval, like a large wren's nest, built into a crack or hollow in the rock, in the masonry, or on the supports of a bridge, or, more rarely, in an overhanging branch. It is composed of moss, dead grass and leaves. This ball, however, is just a shelter. Usually hidden beneath a lip, is the entrance to the real nest within, a cup of grass or sedge, nearly as large as the nest of a blackbird, lined with leaves of oak, beech or other trees. Three to six white eggs are laid starting between March and May. One or two broods are reared, usually in the same nest.

When disturbed, the young that hardly feathered will at once drop into the water and dive.

Voice[edit]

The male has a sweet wren-like song. During courtship the male sings whilst he runs and postures, exhibiting his snowy breast, and when displaying he will take long and high flights, like those of the common kingfisher, accompanied by sharp metallic calls clink, clink, different from the normal zil.

References[edit]

  1. ^ BirdLife International (2012). "Cinclus cinclus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Brewer, David (2001). Wrens, Dippers and Thrashers. Pica Press. ISBN 978-1-873403-95-2. 
  3. ^ "Norges nasjonalfugl fossekallen" (in Norwegian). Norsk Rikskringkasting AS. Retrieved 19 January 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!