Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Global Range: Native to the central portion of South America. Introduced into the U.S. in the late 1960s; 1343 individuals were recorded in seven states (Connecticut, Delaware, Florida, Illinois, New York, Oregon, and Texas) on the 1992-1993 Christmas Bird Count (Hyman and Pruett-Jones 1995). Introduced and established also in Puerto Rico (most common in the San Juan area and the Luquillo Beach-Fajardo area; range is expanding). As of 1993, Stephen Pruett-Jones (Univ. of Chicago) was studying the distribution and abundance of this species in the U.S. (Ornithological Newsletter, August 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Monk parakeets, more commonly known as Quaker parrots, can be found near large water sources, and in the lowland areas of Paraguay, Bolivia, Argentina, and Brazil. They inhabit open savannas, scrub forests, and palm groves, especially where rainfall is low. They are also distributed in South American city parks, on farms, and in yards (Higdon 1998). In North America, escaped birds have established breeding colonies in Chicago and Miami and in the states of Alabama Connecticut, Delaware, Louisiana, New York, Oregon, Texas, and Virginia (South 1998).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

A Quaker Parrot is a medium-sized bird, about 11 to 13 inches long from head to the tip of the long, tapered tail. The basic colors of the bird are green and gray. Adults of the nominate race, Myiopsitta monachus, have a blue-gray forehead. The lores, cheeks, and throat are pale gray. Feathers on the throat and abdomen are edged in a lighter gray, giving them a scalloped, barred look. Feathers below the abdomen are olive green, becoming yellowish green on the lower abdomen, legs and under the tail. The beak is a light pinkish-brown color, and the legs are gray. The eyes are brown. Males and females are not sexually dimorphic (Greeson 1995).

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 81.7 g.

Average basal metabolic rate: 0.5189 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 29 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Myiopsitta monachus prefers open savannas, scrub forests, and palm groves (Higdon 1998). But because it is a highly adaptable species, the parrots readily take residence in eucalyptus trees. Quakers make their own nests by weaving sticks, twigs, small branches, and other materials into complex structures (Doane 1994).

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open woodland, savanna, arid scrubland, riverine forest, cultivated lands, and orchards, especially around human habitation (AOU 1983); palm groves. Lays eggs in large stick nest built in tree, on utility pole or antenna tower, under building eaves, or similar site (Terres 1980, Hyman and Pruett-Jones 1995), often at base of palm fronds in Puerto Rico (Raffaele 1983), in native trees and (more often) in introduced eucalyptus in Argentina (Navarro et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Myiopsitta monachus has been observed to eat a variety of seeds, fruits, blossoms, insects, leaf buds, thistles, grasses and parts of trees. They consume an assortment of sunflower seeds, both black and stiped; safflower seeds, pumpkin seeds, and other smaller seeds. Near populated areas, the birds have also been known to eat sweet potatoes, legumes, drying meat, cereal crops, such as maize and sorghum, as well as citrus crops (Higdon 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats seeds (including those provided at feeders), fruits, grains, buds, insects; travels considerable distances, often in large flocks, to food sources. Often destructive to crops (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In Illinois, flocks of up to 55 individuals were observed (Hyman and Pruett-Jones 1995). In Argentina, distance from natal nest to first breeding site was 300-2000 m (n=4) (Martin and Bucher, 1993, Auk 110:930-933).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
22.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.1 years (captivity) Observations: One specimen lived 22.1 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproduction of the Quaker parrot begins in late August and continues until Novemeber. Groups of wild Quakers live together, each pair with its own residence comprising of [at] least two chambers. Each compartment serves a different purpose, including one for egg incubation or a place to feed young chicks, another in which to feed older chicks, and a third from which parents can keep a watch for danger (Higdon 1998). Each clutch of eggs ranges from four to seven eggs. Incubation lasts approximately twenty days.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 31 days.

Average eggs per season: 7.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Argentina, egg laying began in October, with replacement clutches extending into January or February; few successful breeders attempted second clutches; breeding success was low (25%), though productivity was relatively high (compared to other psittacids) due to large clutch size; substantial number of adults did not breed every year; reproductive success was higher in early clutches than in later clutches (Navarro et al. 1992; see also Navarro et al. 1995, Wilson Bull. 107:742-746). Clutch size 1-11 (mean about 5-6, also reported as 2-5). In Illinois, nesting ocuurred in spring and summer; fledging began in late June and continued through mid-August (Hyman and Pruett-Jones 1995). Several pairs may share communal nest with separate chambers. Incubation about 31 days (also reported as 14-32 days). Nestling period about 35 days. Young may remain with parents until next breeding season. Some first breed when two years old.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myiopsitta monachus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATCTTCGGCGCATGAGCAGGCATAATCGGTACCGCCCTGAGCCTTCTTATCCGTGCAGAACTTGGCCAACCAGGAACTCTATTAGGAGATGACCAAATCTACAATGTAATCGTTACAGCACATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATAGTCGGAGGGTTTGGAAACTGATTAGTTCCCCTTATAATTGGTGCCCCTGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTTCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACAGTCTATCCCCCCCTAGCCGGAAACCTAGCCCATGCCGGAGCTTCAGTGGACTTAGCCATCTTCTCCCTCCACCTGGCAGGTGTCTCTTCTATTCTAGGAGCAATTAACTTTATCACTACAGCTATTAACATAAAACCCCCAACCCTATCACAATATCAAACCCCACTATTCGTTTGATCCGTCTTAATCACAGCCGTACTGCTCCTACTGGCATTACCAGTTCTAGCCGCCGGAATCACAATACTCCTTACAGATCGCAACCTAAACACCACATTCTTCGACCCCGCTGGGGGAGGAGACCCAATCCTGTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTATATTCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myiopsitta monachus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The Quaker parrot is not currently under threat of endangerment. They are well adapted in most environments including locations of cold weather and snow.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. 1996) and 'common to abundant' (del Hoyo et al. 1997).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species has been heavily traded: since 1981 when it was listed on CITES Appendix II, 710,686 wild-caught individuals have been recorded in international trade (UNEP-WCMC CITES Trade Database, January 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species is listed under CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: See Beissinger and Snyder (1991 or 1992) for information on agricultural damage control strategies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

According to a representative from the California Department of Agriculture, Quakers are considered a pest bird species. Quakers are illegal in California, under any circumstances, despite the lack of any documented evidence of crop destruction in the state by wild colonies of Quakers. Embassies, consulates and UN representatives of countries such as Argentina claim that the birds are pest species in their habitat, destroying as much as two-thirds of the grain crops planted each year (Higdon 1998).

They do not appear to cause significant problems in Chicago (South 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is a market for Quakers as pets. In captivity, mutations are prized. Unusual color mutations in pet quakers are highly valued and breeders strive to achieve them. In this way, breeders have been developed some parrot colors such as blue, yellow, cinnamon, pied, and albino. Such mutations are prized by many collectors, making them much more expensive than normal Quakers (Jordan 1997) .

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: May damage fruit and grain crops and power lines (see Navarro et al. 1992, Beissinger and Snyder 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Monk parakeet

The monk parakeet (Myiopsitta monachus), also known as the quaker parrot, is a species of parrot and, in most taxonomies, the only member of the genus Myiopsitta. It originates from the temperate to subtropical areas of Argentina and the surrounding countries in South America. Self-sustaining feral populations occur in many places, mainly in North America and Europe.

Description[edit]

Female pet monk parakeet

The nominate subspecies of this parakeet is 29 cm (11 in) long on average, with a 48 cm (19 in) wingspan, and weighs 100 g (3.5 oz). Females tend to be 10–20% smaller but can only be reliably sexed by DNA or feather testing. It has bright green upperparts. The forehead and breast are pale gray with darker scalloping and the rest of the underparts are very-light green to yellow. The remiges are dark blue, and the tail is long and tapering. The bill is orange. The call is a loud and throaty chape(-yee) or quak quaki quak-wi quarr, and screeches skveet.[2][3]

Domestic breeds in colors other than the natural plumage have been produced. These include birds with white, blue, and yellow in place of green. As such coloration provides less camouflage, feral birds are usually of wild-type coloration.

Systematics and taxonomy[edit]

Myiopsitta monachus is the only widely accepted member of the genus Myiopsitta. However, it seems that the cliff parakeet subspecies (see below) may eventually be recognized as a species again, as it has been on-again-off-again since it was first described in 1868.[2] It is now included with the monk parakeet because there is too little up-to-date research on which an authoritative taxonomic decision could be based. The American Ornithologists' Union for example has deferred recognizing the cliff parakeet as distinct "because of insufficient published data".[4]

Consequently, there are four subspecies recognized:[2][3]

The largest subspecies
Smaller than monachus, wings more prominently blue, gray of head darker.
Essentially identical to calida but reported as less yellow below and brighter overall.
Smaller, with clearer plumage pattern: no scalloping on breast, underparts brighter yellow, underwing lighter. Base of maxilla dark.

The first three subspecies' ranges meet in the general area of Paraguay, and there they are insufficiently delimited. The distinctness and delimitation of calita and cotorra especially requires further study. Regarding the cliff parakeet, it appears that its altitudinal range does not overlap calita/cotorra '​s and that it is thus entirely—but just barely—allopatric.[3]

Like the other Neotropical parrots, the monk parakeet is usually placed in the tribe Arini, which might warrant elevation to subfamily rank as Arinae. M. monachus belongs to the long-tailed clade of these – macaws and conures, essentially –, which would retain the name Arini/Arinae if this polyphyletic group is split.

Ecology and behaviour[edit]

Nests in Zaragoza, Spain.
Birds and their nest in Santiago, Chile

The monk parakeet is globally very common,[6] and even the rather localized cliff parakeet is generally common.[2] In Argentina, Brazil and Uruguay, monk parakeets are regarded as major agricultural pests (as noted by Charles Darwin among others). Their population explosion in South American rural areas seems to be associated with the expansion of eucalyptus forestry for paper pulp production, which offers the bird the opportunity to build protected nests in artificial forests where there is small ecological competition from other species. The cliff parakeet occasionally plunders maize fields but it is apparently not considered a major pest as there is no serious persecution.[2]

The monk parakeet is the only parrot that builds a stick nest, in a tree or on a man-made structure, rather than using a hole in a tree. This gregarious species often breeds colonially, building a single large nest with separate entrances for each pair. In the wild, the colonies can become quite large, with pairs occupying separate "apartments" in nests that can reach the size of a small automobile. These nests can attract many other tenants including birds of prey such as the spot-winged falconet (Spiziapteryx circumcincta), ducks such as the yellow-billed teal (Anas flavirostris), and even mammals. Their five to twelve white eggs hatch in about 24 days.

The cliff parakeet, as its name implies, nests in cliff crevices. This subspecies rarely builds communal nests, but individual pairs still prefer to nest in close association.[2]

Unusually for a parrot, monk parakeet pairs occasionally have helper individuals, often a grown offspring, which assist with feeding the young (see kin selection).

The lifespan of monk parakeets has been given as 15–20 years[7] or as much as 25–30 years;[8] the former might refer to average lifespans in captivity and/or in the wild, while the latter is in the range of maximum lifespans recorded for parakeets.

As pets[edit]

Baby monk parakeet perched in a Christmas tree
Pet with rope and parrot toys

Monk parakeets are highly intelligent, social birds. Those kept as pets routinely develop large vocabularies. They are able to learn scores of words and phrases.[9] Due to this early speaking ability, it is overtaking the cockatiel as the favorite bird to teach to talk. Another asset is that this bird has a much more reasonable life span and price than African grey parrots or the yellow-naped amazon.

As an introduced species[edit]

Monk parakeet in San Juan, Puerto Rico

Self-sustaining feral populations have been recorded in several U.S. states and various regions of Europe (namely Spain, Portugal, Azores, Madeira, Balearic Islands, Gibraltar, France, Corsica, Malta, Cyprus, Sardinia, Italy, Channel Islands, Great Britain, Ireland and Belgium), as well as in Brazil, Israel, Bermuda, Bahamas, Cayman Islands, Easter Island, Puerto Rico, South Korea and Japan. As it is an open woodlands species, it adapts readily to urban areas.

In areas where they have been introduced, some fear that they will harm crops and native species. Evidence of harm caused by feral colonies is disputed, and many people oppose killing this charismatic bird. However, there have been local bans and eradication programs in some areas of the U.S. Outside the U.S., introduced populations do not appear to raise similar controversy, presumably because of smaller numbers of birds, or because their settlement in urban areas does not pose a threat to agricultural production. The U.K. appears to have changed its view on its feral populations and the Department for the Environment, Food and Rural Affairs is planning to remove monk parakeets from the wild, as it believes that they threaten local wildlife and crops.[10]

It was found that feral populations are often descended from very small founder populations. Being as social and intelligent as they are, monk parakeets will develop some cultural traditions, namely vocal dialects that differ between groups. In populations descended from a large number of birds, a range of "dialects" will exist. If the founder population is small however, a process similar to genetic drift may occur if prominent founders vocalize in an unusual "dialect", with this particular way of vocalizing becoming established in the resulting feral colony. For example, no fewer than three different "dialects" occur among the feral monk parrots of the Milford, Connecticut, metropolitan area.[11]

Brazil[edit]

The species has in recent years expanded its range in Brazil, where there is now a self-sustaining population in the downtown area of Rio de Janeiro. Since this population occurs far from the bird's original range in Brazil – it was only found in the far south and southwest – it is most probably a consequence of escapees from the pet trade. In Rio de Janeiro, the bird can be easily seen at the Aterro do Flamengo gardens – where it nests on palm trees and feeds on their fruit; the Rio birds seem to favor nesting amid the leaves of coconut palm trees – as well as in the vicinity of the neighboring domestic flight terminal, the Santos Dumont Airport and in the gardens of Quinta da Boa Vista, where communal nests of roughly one meter in diameter have been seem.[12] In Santa Catarina State, probable escapees have been reported on occasion for quite some time, and a feral population seems to have established itself in Florianópolis early in the first decade of the 21st century when birds were observed feeding right next to the highway in the Rio Vermelho-Vargem Grande area.[5]

Mexico[edit]

The monk parakeet was first recorded in Mexico City in 1999.[13] There are also records for seven other locations, including the cities of Puebla, Morelia, Celaya, Oaxaca, Tuxtla Gutiérrez, Hermosillo, and the mouth of the Loreto River in Baja California Sur.

Nesting populations are known in Mexico City and Oaxaca. A small but growing population has also been established in the southern part of the city of Puebla, Puebla, in the surroundings of the city's aviary, which they are known to visit frequently, and where they can often be seen clinging to the outer side of its mesh walls. No studies have been made to assess the impact they might have on the relict populations of green parakeet that live in the same area and other well wooded zones of the city.

Following the ban on the trade of native parrot species, local traditional bird sellers have now switched to the monk parakeet as their staple parrot, and that might have increased the number of escapees. Sometimes the head and breast feathers of monk parakeets are dyed yellow to deceive uninformed buyers, mimicking the endangered yellow-headed amazon. The presence of this species in seven geographically distant and independent locations in Mexico indicates that the source of these individuals is most likely the pet trade.[13]

United States[edit]

Monk parakeets in Florida

Considerable numbers of monk parakeets were imported to the United States in the late 1960s as pets. Many escaped or were intentionally released, and populations were allowed to proliferate. By the early 1970s, M. monachus was established in seven states, and by 1995 it had spread to eight more. There are now thought to be approximately 100,000 in Florida alone.

As one of the few temperate-zone parrots, the monk parakeet is more able than most to survive cold climates, and colonies exist as far north as New York City, Chicago, Wisconsin, Cincinnati, Louisville, Edgewater, New Jersey, coastal Rhode Island, Massachusetts and Connecticut, and southwestern Washington. This hardiness makes this species second only to the rose-ringed parakeet amongst parrots as a successful introduced species.

In addition, they have also found a home in Brooklyn, New York, after an accidental release decades ago of what appears to have been black-market birds[14] within Green-Wood Cemetery. The grounds crew initially tried to destroy the unsightly nests at the entrance gate, but no longer do so because the presence of the parrots has reduced the number of pigeons nesting within it. The management's decision was based on a comparative chemical analysis of pigeon feces (which destroy brownstone structures) and monk parakeet feces (which have no ill effect). Oddly then, the monk parakeets are in effect preserving this historic structure. Brooklyn College has a monk parakeet as an "unofficial" mascot in reference to the colony of the species that lives in its campus grounds. It is featured on the masthead of the student magazine. They have also made their homes in the lamp posts in Pelham Bay Park in the Bronx. Most of these monk parakeet populations can be traced to shipments of captured birds from Argentina.[15]

In Chicago the origin of the monk parakeets is unknown but they may be escaped birds from O'Hare airport or unwanted pets.[16] The species first appeared in the 1960s and is continuing to thrive despite unusual bad winters that have recently occurred in the 1980s and in 2014.[16] The birds are welcomed in the city especially by bird watchers and were involved in a 2012 ornithological study.[16] The population is estimated to be at 1,000 animals with healthy colonies located in several of the city's parks.[16]

Because of quaker parrots' listing as an agricultural pest, California, Georgia, Kansas, Kentucky, Hawaii, New Jersey, New Hampshire,[17] Pennsylvania, Tennessee, and Wyoming outlaw sale and ownership of a monk parakeet. In Connecticut, one can own a quaker parrot, but cannot sell or breed them. In New York and Virginia, it is possible to own a quaker parrot with banding and registration. In Ohio, owning a quaker parrot is legal only if the bird's wings are clipped so that it cannot fly.[15][18]

Europe[edit]

Monk parakeets in Santa Ponsa, Majorca, Spain

Monk parakeets can be seen in Madrid, Barcelona, Cadiz,Torremolinos, Málaga, Valencia, Tarragona, Roquetas de Mar (Andalusia), Zaragoza, the Canary Islands and Majorca in Balearic Islands. They were first seen around 1985. In Madrid, where they have successfully breed after a couple was released on a golf course by an individual, they especially frequent the Ciudad Universitaria (Complutense university campus) and Casa de Campo park. They are a common sight in Barcelona parks, often as numerous as pigeons. They form substantial colonies in Parc de la Ciutadella, Parc de la Barceloneta, and in smaller city parks such as Jardins Josep Trueta in Poble Nou, with a colony as far north as Empuriabrava. They are more frequent in watered urban parks with grass areas and palm trees, near to a river or the sea. The monk parakeet, as an invasive species, has become a problem to local fauna such as pigeons and sparrows, but not yet so harmful to magpies. Parakeets have also caused trouble to agriculture near the cities. Barcelona has the greatest population of monk parakeets in Europe with 2500 parakeets as of February 2010.[19][20] As of 2013, the estimated population of monk parakeets in Madrid was of 1768.[21]

The United Kingdom population in 2011 is believed to be around 150, in the Home Counties region. The Department for the Environment, Food and Rural Affairs announced plans in 2011 to control them, countering the threat to infrastructure, crops and native British wildlife by trapping and re-homing, removing nests and shooting when necessary.[22]

Small groups of monk parakeets can be found in the Belgian capital city Brussels and its surrounding areas. They have been living in the wild at least since the 1970s.

References[edit]

  1. ^ BirdLife International (2012). "Myiopsitta monachus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g Collar, Nigel J. (1997). del Hoyo, Josep; Elliott, Andrew; Sargatal, Jordi, eds. Handbook of Birds of the World. Volume 4: Sandgrouse to Cuckoos. Barcelona.: Lynx Edicions. ISBN 84-87334-22-9. 
  3. ^ a b c d Juniper, Tony; Parr, Mike (1998). Parrots: A Guide to Parrots of the World. Helm Identification Guides. London: Christopher Helm. pp. 475–476, plate 62. ISBN 1-873403-40-2. 
  4. ^ South American Classification Committee (9 January 2008). "A classification of the bird species of South America (Part 3: Columbiformes to Caprimulgiformes)". Retrieved 12 January 2008. 
  5. ^ a b Amorim, James Faraco; Piacentini, Vítor de Queiroz (2006). "Novos registros de aves raras em Santa Catarina, Sul do Brasil, incluindo os primeiros registros documentados de algumas espécies para o Estado" [New records of rare birds, and first reports of some species, in the state of Santa Catarina, southern Brazil] (PDF). Revista Brasileira de Ornitologia (in Portuguese with English abstract) 14 (2): 145–149.  (electronic supplement, PDF)
  6. ^ BirdLife International (2004). "Myiopsitta monachus". IUCN Red List of Threatened Species. Version 2006. International Union for Conservation of Nature. Retrieved 11 May 2006. 
  7. ^ Fasbach, Laura (23 July 2001). "A squawk in the park". Edgewater Online. Retrieved 12 January 2008. 
  8. ^ Kamuda, Melinda L. (19 March 1998). "Quaker Parrots (a.k.a. Monk Parakeets) Care and Training". Retrieved 12 January 2008. 
  9. ^ "The Vocabulary of a Quaker Parrot". Archived from the original on 27 September 2007. Retrieved 12 January 2008. 
  10. ^ "Defra to remove problem monk parakeets from wild". BBC News. 24 April 2011. Retrieved 25 April 2011. 
  11. ^ Buhrmann-Deever, Susannah C.; Rappaport, Amy R.; Bradbury, Jack W. (2007). "Geographic Variation in Contact Calls of Feral North American Populations of the Monk Parakeet". Condor 109 (2): 389–398. doi:10.1650/0010-5422(2007)109[389:GVICCO]2.0.CO;2. 
  12. ^ Monteiro Pereira, José Felipe. Aves e Pássaros Comuns do Rio de Janeiro. Rio de Janeiro: Technical Books Editora. p. 66. ISBN 978-85-61368-00-5. 
  13. ^ a b "Pretty, but dangerous! Records of non-native Monk Parakeets (Myiopsitta monachus) in Mexico". Revista Mexicana de Biodiversidad 82: 1053–1056. 2011. 
  14. ^ Powell, Michael (28 December 2006). "Parrots Have Colonized the Wilds of Brooklyn". Washington Post. Retrieved 12 January 2008. 
  15. ^ a b "Why are Quaker Parrots Illegal in Some States". 
  16. ^ a b c d Kuykendall, Mark (2014). "Chicago’s subtropical parrots thrive in Chiberia". Retrieved 20 May 2014. 
  17. ^ http://www.bornfreeusa.org/b4a2_exotic_animals_state.php?s=nh
  18. ^ "Are Quakers Legal In My State?". Quaker Information Center. 31 December 2004. Retrieved 12 January 2008. 
  19. ^ Oliver, Miguel (14 June 2010). "Una plaga de cotorras dispara las alarmas". Diario ABC (in Spanish). Retrieved 15 April 2013. 
  20. ^ "La cotorra argentina amenaza con convertirse en una plaga en Barcelona". RTVE (in Spanish). 13 February 2010. Retrieved 15 April 2013. 
  21. ^ Oliver, Miguel (14 June 2010). "Las Colonas de la Casa de Campo". El Pais (in Spanish). Retrieved 15 April 2013. 
  22. ^ Gray, Louise (25 April 2011). "Wild parakeets living in Britain to be shot before they become a nuisance". The Daily Telegraph. Retrieved 5 May 2011. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Monk Parakeet

The Monk Parakeet, also known as the Quaker Parrot, (Myiopsitta monachus) is a species of parrot and, in most treatments, the only member of the genus Myiopsitta. It originates from the temperate to subtropical areas of Argentina and the surrounding countries in South America. Self-sustaining feral populations occur in many places, mainly in North America and Europe.

Description[edit]

Female pet Monk Parakeet

The nominate subspecies of this parakeet is 29 cm or 9 to 11 in long on average, with a 48 cm wingspan, and weighs 100 g. Females tend to be 10–20% smaller but can only be reliably sexed by DNA blood or feather testing. It has bright green upperparts. The forehead and breast are pale grey with darker scalloping and the rest of the underparts are very-light green to yellow. The remiges are dark blue, and the tail is long and tapering. The bill is orange. The call is a loud and throaty chape(-yee) or quak quaki quak-wi quarr, and screeches skveet.[2]

Domestic breeds in colors other than the natural plumage have been produced. These include birds with white, blue, and yellow in place of green. As such coloration provides less camouflage, feral birds are usually of wild-type coloration.

Systematics and taxonomy[edit]

Myiopsitta monachus is presently the only unequivocally accepted member of the genus Myiopsitta. However, it seems that the Cliff Parakeet (see below) will eventually be recognized as a species again, as it has been on-again-off-again since it was first described in 1868.[3] It is presently included with the Monk Parakeet because there is too little up-to-date research on which an authoritative taxonomic decision could be based. The AOU for example has deferred recognizing the Cliff Parakeet as distinct "because of insufficient published data".[4]

Consequently, there are four subspecies presently recognized:[2]

The largest subspecies
Smaller than monachus, wings more prominently blue, grey of head darker.
Essentially identical to calida but reported as less yellow below and brighter overall.
Smaller, with clearer plumage pattern: no scalloping on breast, underparts brighter yellow, underwing lighter. Base of maxilla dark.

The first three subspecies' ranges meet in the general area of Paraguay, and there they are insufficiently delimited. The distinctness and delimitation of calita and cotorra especially requires further study. Regarding the Cliff Parakeet, it appears that its altitudinal range does not overlap calita/cotorra's and that it is thus entirely—but just barely—allopatric.[6]

Like the other Neotropical parrots, the Monk Parakeet is usually placed in the tribe Arini, which might warrant elevation to subfamily rank as Arinae. M. monachus belongs to the long-tailed clade of these – macaws and conures, essentially –, which would retain the name Arini/Arinae if this polyphyletic group is split.

Ecology and behaviour[edit]

Nests in Zaragoza, Spain.
Birds and their nest in Santiago, Chile

The Monk Parakeet is globally very common,[7] and even the rather localized Cliff Parakeet is generally common.[3] In Argentina, Brazil and Uruguay, Monk Parakeets are regarded as major agricultural pests (as noted by Charles Darwin among others). Their population explosion in South American rural areas seems to be associated with the expansion of eucalyptus forestry for paper pulp production, which offers the bird the opportunity to build protected nests in artificial forests where there is small ecological competition from other species. The Cliff Parakeet occasionally plunders maize fields but it is apparently not considered a major pest as there is no serious persecution.[3]

The Monk Parakeet is the only parrot that builds a stick nest, in a tree or on a man-made structure, rather than using a hole in a tree. This gregarious species often breeds colonially, building a single large nest with separate entrances for each pair. In the wild, the colonies can become quite large, with pairs occupying separate "apartments" in nests that can reach the size of a small automobile. These nests can attract many other tenants including birds of prey such as the Spot-winged Falconet (Spiziapteryx circumcincta), ducks such as the Yellow-billed Teal (Anas flavirostris), and even mammals. Their 5-12 white eggs hatch in about 24 days.

The Cliff Parakeet, as its name implies, rather nests in cliff crevices. This taxon rarely builds communal nests, but individual pairs still prefer to nest in close association.[3]

Unusually for a parrot, Monk Parakeet pairs occasionally have helper individuals, often a grown offspring, which assists with feeding the young (see kin selection).

The lifespan of Monk Parakeets has been given as 15–20 years[8] or as much as 25–30 years;[9] the former might refer to average lifespans in captivity and/or in the wild, while the latter is in the range of maximum lifespans recorded for parakeets.

As pets[edit]

Baby Monk Parakeet perched in a Christmas tree
Pet with rope and parrot toys

Monk Parakeets are highly intelligent, social birds. Those kept as pets routinely develop large vocabularies. They are able to learn scores of words and phrases.[10] Due to this early speaking ability, the Quaker Parrot is overtaking the cockatiel as the favorite bird to teach to talk. Another asset is that this bird has a much more reasonable life span and price than the African Greys or the Yellow Naped Amazons.

As an introduced species[edit]

Monk Parakeet in San Juan, Puerto Rico

Self-sustaining feral populations have been recorded in several US states and various countries of Europe (namely Spain, Gibraltar, Italy, Great Britain and Belgium), as well as in Brazil, Israel, Bermuda, Bahamas, Cayman Islands, Puerto Rico and Japan. As it is an open woodlands species, it adapts readily to urban areas.

In areas where they have been introduced, some fear that they will harm crops and native species. Evidence of harm caused by feral colonies is disputed, and many people oppose killing this charismatic bird. However, there have been local bans and eradication programs in some areas of the USA. Outside the USA, introduced populations do not appear to raise similar controversy, presumably because of smaller numbers of birds, or because their settlement in urban areas does not pose a threat to agricultural production. The UK appears to have changed its view on its feral populations and the Department for the Environment, Food and Rural Affairs is planning to remove Monk Parakeets from the wild,[11] as it believes that they threaten local wildlife and crops.

It was found that feral populations are often descended from very small founder populations. Being as social and intelligent as they are, Monk Parakeets will develop some cultural traditions, namely vocal dialects that differ between groups. In populations descended from a large number of birds, a range of "dialects" will exist. If the founder population is small however, a process similar to genetic drift may occur if prominent founders vocalize in an unusual "dialect", with this particular way of vocalizing becoming established in the resulting feral colony. For example, no fewer than three different "dialects" occur among the feral Monk Parrots of the Milford, Connecticut, metropolitan area.[12]

Brazil[edit]

The species has in recent years expanded its range in Brazil, where there is now a self-sustaining population in the downtown area of Rio de Janeiro. Since this population occurs far from the bird's original range in Brazil - it was only found in the far south and southwest - it is most probably a consequence of escapees from the pet trade. In Rio de Janeiro, the bird can be easily seen at the Aterro do Flamengo gardens - where it nests on palm trees and feeds on their fruit; the Rio birds seem to favor nesting amid the leaves of coconut palm trees - as well as in the vicinity of the neighboring domestic flight terminal, the Santos Dumont Airport and in the gardens of Quinta da Boa Vista, where communal nests of roughly one meter in diameter have been seem.[13] In Santa Catarina State, probable escapees have been reported on occasion since quite some time, and a feral population seems to have established itself in Florianópolis in the early 2000s (decade) when birds were observed feeding right next to the highway in the Rio Vermelho-Vargem Grande area.[5]

United States of America[edit]

Monk Parakeets in Florida, USA.

Considerable numbers of Monk Parakeet were imported to the United States in the late 1960s as pets. Many escaped or were intentionally released, and populations were allowed to proliferate. By the early 1970s, M. monachus was established in seven states, and by 1995 it had spread to eight more. There are now thought to be approximately 100,000 in Florida alone.

As one of the few temperate-zone parrots, the Monk Parakeet is more able than most to survive cold climates, and colonies exist as far north as New York City, Chicago, Wisconsin, Cincinnati, Louisville, Edgewater, New Jersey, coastal Rhode Island, Massachusetts and Connecticut, and southwestern Washington. This hardiness makes this species second only to the Rose-ringed Parakeet amongst parrots as a successful introduced species.

In addition, they have also found a home in Brooklyn, New York, after an accidental release decades ago of what appears to have been black-market birds[14] within Green-Wood Cemetery. The grounds crew initially tried to destroy the unsightly nests at the entrance gate, but no longer do so because the presence of the parrots has reduced the number of pigeons nesting within it. The management's decision was based on a comparative chemical analysis of pigeon feces (which destroy brownstone structures) and Monk Parakeet feces (which have no ill effect). Oddly then, the Monk Parakeets are in effect preserving this historic structure. Brooklyn College has a Monk Parakeet as an "unofficial" mascot in reference to the colony of the species that lives in its campus grounds. It is featured on the masthead of the student magazine. They have also made their homes in the lamp posts in Pelham Bay Park in the Bronx. Most of these Quaker Parrot populations can be traced to shipments of captured Quaker Parrots from Argentina.[15]

Because of Quaker Parrots' listing as an agricultural pest, California, Georgia, Kansas, Kentucky, Hawaii, New Jersey, Pennsylvania, Tennessee, and Wyoming outlaw sale and ownership of a monk parakeet. In Connecticut, one can own a Quaker Parrot, but cannot sell or breed them. In New York and Virginia, it is possible to own a Quaker Parrot with banding and registration. In Ohio, owning a Quaker Parrot is legal as long as the bird's wings are clipped so that it cannot fly.[15]

Spain[edit]

Monk Parakeets in Santa Ponsa, Majorca, Spain.

Monk Parakeets can be seen only in human settlements in Madrid, Barcelona, Cadiz, Málaga, Valencia, Tarragona, Roquetas de Mar (Andalusia), Zaragoza, the Canary Islands and Majorca in Balearic Islands. They were first seen around 1985. In Madrid, they especially frequent the Ciudad Universitaria (Complutense university campus) and Casa de Campo park. They are a common sight in Barcelona parks, often as numerous as pigeons. They form substantial colonies in Parc de la Ciutadella, Parc de la Barceloneta, and in smaller city parks such as Jardins Josep Trueta in Poble Nou, with a colony as far north as Empuriabrava. They are more frequent in watered urban parks with grass areas and palm trees, near to a river or the sea. The monk parakeet, as an invasive species, has become a problem to local fauna such as pigeons and sparrows, but not yet so harmful to magpies. Parakeets have also caused trouble to agriculture near the cities. Barcelona has the greatest population of monk parakeets in Europe with 2500 parakeets as of February 2010.[16][17]

United Kingdom[edit]

The population in 2011 is believed to be around 150 in the Home Counties. The Department for the Environment, Food and Rural Affairs announced plans to control them to counter the threat to infrastructure, crops and native British wildlife by trapping and re-homing, removing nests and shooting when necessary.[18]

Belgium[edit]

Small groups of Monk parakeets can be found in the capital city Brussels and its surrounding areas. They have been living in the wild at least since the 1970s.

Mexico[edit]

The Monk Parakeet was first recorded in Mexico City in 1999.[19] There are also records for seven other locations, including the cities of Puebla, Morelia, Celaya, Oaxaca, Tuxtla Gutiérrez, Hermosillo, and the mouth of the Loreto River in Baja California Sur.

Nesting populations are known in Mexico City and Oaxaca. A small but growing population has also established in the southern part of the city of Puebla, Puebla, in the surroundings of the city's aviary, which they are known to visit frequently, and where they can often be seen clinging to the outer side of its mesh walls. No studies have been made to assess the impact they might have on the relict populations of Green Parakeet that live in the same area and other well wooded zones of the city.

Following the ban on the trade of native parrot species, local traditional bird sellers have now switched to the monk parakeet as their staple parrot, and that might have increased the number of escapees. Sometimes the head and breast feathers of Monk parakeets are dyed yellow to deceive uninformed buyers, mimicking the endangered Yellow-headed Amazon. The presence of this species in 7 geographically distant and independent locations in Mexico indicates that the source of these individuals is most likely the pet trade.[19]

Notes[edit]

  1. ^ BirdLife International (2012). "Myiopsitta monachus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Collar (1997a,b), Juniper & Parr (1998)
  3. ^ a b c d e Collar (1997b)
  4. ^ SACC (2008)
  5. ^ a b Amorim & Piacentini (2006)
  6. ^ a b Juniper & Parr (1998)
  7. ^ BLI (2007)
  8. ^ Fasbach (2001)
  9. ^ Kamuda (1998)
  10. ^ http://www.butnowyouknow.com/oatmeal.html The Vocabulary of a Quaker Parrot. Retrieved 2008-JAN-12.
  11. ^ [1]. Retrieved 2011-APR-25.
  12. ^ Buhrmann-Deever et al. (2007)
  13. ^ José FelipeMonteiro Pereira, Aves e Pássaros Comuns do Rio de Janeiro, Rio de Janeiro, Technical Books Editora, ISBN 978-85-61368-00-5, pg.66
  14. ^ Powell (2006)
  15. ^ a b "Why are Quaker Parrots Illegal in Some States". 
  16. ^ Oliver, Miguel (2010-06-14). "Una plaga de cotorras dispara las alarmas". Diario ABC (in Spanish). Retrieved April 15, 2013. 
  17. ^ "La cotorra argentina amenaza con convertirse en una plaga en Barcelona". RTVE (in Spanish). 2010-02-13. Retrieved April 15, 2013. 
  18. ^ Gray, Louise (25 April 2011). "Wild parakeets living in Britain to be shot before they become a nuisance". The Daily Telegraph. Retrieved 5 May 2011. 
  19. ^ a b http://www.ibiologia.unam.mx/barra/publicaciones/revista%2082_3/34-739.pdf

References[edit]

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!