Overview

Distribution

Range

E Colombia to s Venezuela, the Guianas, n Argentina and Brazil.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Porphyrio flavirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATCTTATTTTTGGGGCATGAGCTGGCATAATCGGCACTGCCCTAAGCCTGCTTATCCGAGCAGAACTTGGACAACCCGGCAGCCTACTAGGAGATGACCAAATCTACAACGTTATCGTCACCGCACATGCTTTCGTAATAATCTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGCAACTGACTAGTACCATTAATAATCGGAGCCCCAGACATAGCATTCCCACGCATAAACAATATAAGCTTCTGACTCCTACCACCCTCCTTCCTACTACTATTAGCATCCTCCACAGTAGAAGCAGGAGCAGGTACAGGCTGAACAGTTTATCCCCCACTAGCTGGCAATCTAGCACACGCAGGAGCCTCAGTAGACCTGGCCATCTTTTCCCTACACCTAGCAGGCATCTCATCCATCCTTGGCGCAATCAACTTCATCACAACCGCAATCAACATAAAACCACCCGCACTATCCCAATATCAAACCCCCTTATTCGTATGATCTGTACTAATCACAGCCGTCCTACTACTACTATCACTACCAGTATTAGCCGCAGGGATCACCATATTACTAACTGACCGAAACCTAAATACCACATTCTTCGACCCTGCCGGAGGGGGAGATCCAATCCTATACCAACACCTTTTCTGATTTTTCGGACACCCAGAAGTATACATCCTAATCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Porphyrio flavirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Azure Gallinule

The Azure Gallinule (Porphyrio flavirostris) is a species of bird in the Rallidae family. It is found in Argentina, Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Suriname, Trinidad and Tobago, the United States, and Venezuela.

The bill and frontal shield is a pale greenish-yellow.The wing coverts are greenish-blue while the back and tail are browner. The throat and underparts are white while the legs are yellow.

It is found in freshwater marshes where there is floating vegetation and this includes marshy edges of rivers and lakes. Nest is an open cup of leaves concealed in dense marsh vegetation. Clutch size is 4-5 eggs, incubated by both parents.

Diet consists of invertebrates, insects and seeds taken from water and vegetation. Climbs in reed stems to bend them over water to pick up food.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!