Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Seasonality

Colombian Andes (Antioquia) February

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocampo, David

Source: Colaboraciones Americanas Sobre Aves

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Saltator maximus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTACCCGATGACTATTTTCCACCAACCACAAAGATATTGGGACCCTGTACCTAATCTTCGGCGCATGAGCCGGGATAGTAGGCACAGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGACAACCCGGAGCTCTCCTAGGGGACGACCAAGTATACAACGTAGTCGTCACAGCTCATGCCTTCGTGATAATCTTCTTCATAGTTATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATGATTGGAGCCCCCGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTCCTCCCACCTTCTTTCCTTCTCCTCCTAGCCTCCTCTACAGTTGAAGCGGGCGCCGGCACAGGCTGAACAGTCTACCCACCCTTAGCCGGTAATCTAGCCCACGCCGGAGCTTCTGTCGACCTGGCAATCTTCTCCCTACACTTAGCCGGCATCTCATCAATCCTAGGGGCAATCAACTTCATCACAACAGCAATCAATATAAAACCTCCTGCCCTGTCACAATACCAAACCCCCCTGTTCGTCTGATCAGTCTTAATCACCGCAGTCCTACTACTTCTCTCTCTCCCAGTCCTAGCCGCAGGAATTACAATACTCCTCACAGACCGAAACCTTAACACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCTGTCCTATACCAGCACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATTCTCCCAGGCTTCGGAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Saltator maximus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Buff-throated Saltator

The Buff-throated Saltator (Saltator maximus) is a seedeating bird. Traditionally placed in the cardinal family (Cardinalidae), it actually seems to be closer to the tanagers (Thraupidae).[2] It breeds from southeastern Mexico to western Ecuador and northeastern Brazil.

This is the type species of Saltator. Consequently, it and its closest allies would retain the genus name when this apparently polyphyletic group[2] is eventually split up.

The Buff-throated Saltator is on average 20 cm long and weighs 42-52 g. The adult has a slate-grey head with a white supercilium and a greenish crown. The upperparts are olive green, the underparts are grey becoming buff on the lower belly, and the throat is buff, edged with black. The thick convex bill and legs are black. Young birds are duller, and have a white-mottled blackish throat and breast, and brown markings on the lower underparts.

The common call is a high seeeer. Males duet melodiously with a warbled cheery cheery answered by cheery to you.

This is a species of dense vegetation. The Buff-throated Saltator feeds on fruit,[3] buds, nectar and slow-moving insects. It forages at low and mid levels, sometimes with mixed species flocks.

The two pale blue eggs per clutch measure some 22–32 mm long by about 16.5-21.5 mm wide and weigh about 4.8-6.1 grams each.[4] They are laid in a bulky cup nest up to 2 m high in a tree or bush.

Footnotes

  1. ^ BirdLife International (2012). "Saltator maximus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106009633. Retrieved 16 July 2012.
  2. ^ a b See the genus article for details
  3. ^ E.g. of Cymbopetalum mayanum (Annonaceae), Trophis racemosa (Moraceae), and Gumbo-limbo (Bursera simaruba): Forster (2007).
  4. ^ I.e. large among Saltator eggs (Echeverry-Galvis & Córdoba-Córdoba 2006).

References

  • Echeverry-Galvis, María Ángela & Córdoba-Córdoba, Sergio (2006): Descripción del huevo del saltátor collarejo (Saltator cinctus) y comentarios preliminares sobre huevos del género Saltator. ["Description of the egg of the Masked Saltator (S. cinctus) and preliminary comments on the eggs of the genus Saltator"]. Boletín de la Sociedad Antioqueña de Ornitología 16(1): 76-84. [Spanish with English abstract] PDF fulltext
  • Foster, Mercedes S. (2007): The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico. Bird Conservation International 17(1): 45-61. doi:10.1017/S0959270906000554 PDF fulltext
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!