Overview

Brief Summary

Aegolius acadicus

At just 8 inches in length, the Northern Saw-whet Owl is one of the smallest owl species in North America. Like most owls, this species possesses short legs, rounded wings, large yellow eyes, and a disk-shaped face. Apart from its small size, it may best be identified by its brown body spotted with white above and streaked below as well as on the face. The Northern Saw-whet Owl primarily breeds in Southern Canada and the northern tier of the United States. Breeding populations also exist at higher elevations in the western U.S.and in the Blue Ridge and Great Smoky Mountains in the southeast. During the winter, this species expands its range southward and into lower elevations, including the coastal southeast, the Great Plains, and the southwest. The Northern Saw-whet Owl inhabits forests across the northern part of the continent. In particular, this owl prefers forests that are composed either entirely of evergreen trees or of a mix of evergreen and deciduous tree species. In winter, individuals which have moved south are less tied to a particular habitat type, relocating as new sources of prey become available. Like most owls, the Northern Saw-whet Owl hunts small mammals, including mice, shrews, and voles. This owl uses its excellent hearing to locate prey on the ground in order to fly down and capture it with its talons. Also, like most owls, this species hunts almost exclusively at night, making it difficult to observe. Northern Saw-whet Owls are most visible roosting high in trees during the day or while producing toot-like calls at dusk.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Northern saw-whet owls are found only in North America. Their breeding range includes southern Alaska, southern Canada, most of the United States and some high elevation sites in central Mexico.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Bisbee, M. 1998. Meet Them at the Wildlife Park: The Saw-Whet Owl. The Gray News (online edition), Vol. 30, No. 1.
  • Long, K. 1998. Owls - A Wildlife Handbook. Boulder, Colorado: Johnson Books.
  • Cannings, R. 1993. Northern saw-whet owl (Aegolius acadicus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 42. Philadelphia, PA: The Academy of Natural Sciences and Washington DC: The American Ornithologists Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: BREEDS: southern Alaska to central Saskatchewan and northern New Brunswick, south to southern California, southern Arizona, southern Mexico, western Texas, Missouri, southern Michigan, Maryland; also in Great Smoky Mountains. WINTERS: generally throughout breeding range (some southward withdrawal), irregularly or casually south to southern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Geographic Range

Northern saw-whet owls are found only in North America. Their breeding range includes southern Alaska, southern Canada, most of the United States and some high elevation sites in central Mexico.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Bisbee, M. 1998. Meet Them at the Wildlife Park: The Saw-Whet Owl. The Gray News (online edition), Vol. 30, No. 1.
  • Long, K. 1998. Owls - A Wildlife Handbook. Boulder, Colorado: Johnson Books.
  • Cannings, R. 1993. Northern saw-whet owl (Aegolius acadicus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 42. Philadelphia, PA: The Academy of Natural Sciences and Washington DC: The American Ornithologists Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Northern saw-whet owls are the smallest owls in eastern North America. Males weigh only 75 g, which is about the same as an American robin. Females weigh a little more, about 100g. Males are 18 to 20 cm long and females are 20 to 21.5 cm long. Adults have a wingspan of 45 to 60 cm.

Northern saw-whet owls have a reddish-brown body with white streaks on the belly. They also have dark-colored bills, big yellow eyes, feathered legs and feet and a tail with three stripes. They have large, round reddish-brown heads and a flat grayish area around their eyes. Their neck is speckled with white. The speckles and stripes in the feathers of northern saw-whet owls helps to camouflage them when they are roosting and hunting.

Male and female saw-whet owls look similar, but are different in size. Females are slightly larger than males. Young saw-whet owls are chocolate-brown large white spots above their bills and over their eyes.

Range mass: 65 to 110 g.

Range length: 18 to 21.5 cm.

Range wingspan: 45 to 60 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Average basal metabolic rate: 0.654 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Physical Description

Northern saw-whet owls are the smallest owls in eastern North America. At approximately 75 g, males weigh about as much as an American robin. Females weigh slightly more, at about 100g. The body lengths of males and females are 18 to 20 cm and 20 to 21.5 cm respectively. The wingspan of an adult ranges from 45 to 60 cm Northern saw-whets have dark-colored bills, eyes with yellow-pigmented irises, heavily feathered legs and feet, a tail with three bars, and a wide, reddish-brown body with white streaks on the abdomen. Their large, round heads are reddish brown to brown, have a large, grayish facial disk in the center and are streaked with white on the top. The neck is speckled with white. Northern saw-whet owls depend on this plumage for camouflage while roosting and hunting. .

Male and female saw-whet owls are similar in appearance, though females are slightly larger than males. Juveniles are chocolate-brown with a pattern of large white spots above their bills that extend over their eyes.

There are two recognized subspecies of northern saw-whet owl (Aegolius acadicus). Aegolius acadicus brooksi is found only on Queen Charlotte Island in British Columbia. It is similar to Aegolius acadicus acadicus, which is found throughout the rest of the range, except that the underparts are buff instead of white. Other than this subspecies, there is little geographic variation in appearance.

Range mass: 65 to 110 g.

Range length: 18 to 21.5 cm.

Range wingspan: 45 to 60 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Average basal metabolic rate: 0.654 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Size

Length: 20 cm

Weight: 91 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Ecology

Habitat

Aegolius acadicus live in woodlands. They can be found in coniferous forests, deciduous forests and mixed forests. During migration and winter, saw-whet owls can be found in many different habitats. They can be found at low elevations and at high elevations. They may be found in rural or even suburban environments. They seem to be able to live in nearly any habitat as long as it has perches for hunting and dense vegetation for roosting.

Habitat Regions: temperate

Terrestrial Biomes: taiga ; forest

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Northern saw-whet owls inhabit woodlands of all types throughout their range. Though they seem to be most abundant in coniferous forests, they are also common in deciduous and mixed conifer-deciduous forests. During migration and winter, saw-whet owls inhabit a wide variety of habitats over a range of altitudes and latitudes. They may be found in rural or even suburban environments. The primary habitat requirements seem to be perches for hunting and dense vegetation for roosting.

Habitat Regions: temperate

Terrestrial Biomes: taiga ; forest

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Dense coniferous or mixed forest, cedar groves, alder thickets, swamps, and tamarack bogs; also, when not breeding, in dense second growth, brushy areas, arid scrub, and open buildings. Often roosts in dense evergreens in winter, at various heights and usually close to the trunk (Swengel and Swengel 1992a). Nests usually in old woodpecker hole, also in other tree cavity, or in nest box. Roosts during daylight in or near nest hole during breeding season (NGS 1983). Suitable holes have diameter of 7 cm or more.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Probably makes local elevational migrations in the mountains of the western U.S. and possibly the Appalachians; fairly extensive north-south movement in east and north. Apparently two main migration corridors exist in the east: Ohio River valley and Atlantic coastal lowlands (Johnsgard 1988). At Cape May Point, New Jersey, 90% of fall migration was completed between mid-October and mid-November (Duffy and Kerlinger 1992). See also Russell et al. (1991) for an account of fall migration at Cape May Point, New Jersey. At Whitefish Point, Michigan, begins arriving in early April; migration peaks in mid- to late April, with a secondary peak in late May (Wilson Bull. 105:356-359).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly small mammals (e.g., PEROMYSCUS, MICROTUS, shrews) (e.g., see Swengel and Swengel 1992b); sometimes birds and insects. In the Queen Charlotte Islands, British Columbia, nonbreeding owls may include marine intertidal invertebrates (amphipods) in the diet. Apparently obtains prey mainly by pouncing on it from above, after short flight from elevated perch. May hunt in areas with thick shrub cover.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Northern saw-whet owls hunt at night. They hunt from a low perch, where they watch and listen for prey. Saw-whet owls have excellent night vision, and excellent hearing. When they see or hear prey, the owl flies quickly to the prey, catching it with the large talons on their feet. Saw-whet owls tear their food apart with their beaks, and eat it in pieces. If they catch a large animal, they may store the leftovers to eat later.

Northern saw-whet owls mostly eat small mammals. Peromyscus are their most common food, but Microtus, Clethrionomys gapperi, shrews (g._Sorex, Blarina and Cryptotis), Neurotrichus gibbsi, Perognathus, Reithrodontomys, Synaptomys, Phenacomys, Arborimus longicaudus, Zapus and Mus musculus are also commonly eaten. Saw-whet owls sometimes catch larger mammals such as gThomomys, Tamis and squirrels. They also eat some small birds and some insects, including Coleoptera and Orthoptera.

Animal Foods: birds; mammals; insects

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Northern saw-whet owls hunt at night, from about 30 minutes after sunset to about 30 minutes before sunrise. They hunt from a low perch, detecting prey by sight and sound. Northern saw-whet owls have excellent hearing; their asymmetrical skull allows them to locate prey using sound alone. When a prey item is located, the owl drops out of the perch onto the prey, capturing it with the talons. The prey is torn apart and eaten in pieces. Larger prey may be partially eaten and stored on a branch to eat over the course of several hours.

The northern saw-whet owl diet consists primarily of small mammals, particularly deer mice. Voles, red-backed voles, shrews (g. Sorex, Blarina and Cryptotis), shrew-moles, pocket-mice, harvest-mice, bog lemmings, heather voles, red tree voles, jumping mice and house mice are also common prey items. Juveniles of larger mammals, including pocket-gophers, chipmunks and squirrels (Tamiasciurus and Glaucomys) are occasionally taken, as are insects, such as beetles and grasshoppers. Small birds are also occasionally taken, primarily during migration when they are active at night.

Animal Foods: birds; mammals; insects

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Northern saw-whet owls affect the populations of small mammals that they eat. They also provide habitat for at least nine species of external parasites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Large owls, such as Bubo virginianus, Asio otus and Strix varia are probably the most common predators of northern saw-whet owls.

When a northern saw-whet owl is approached by a predator or a human at night, they give a call that sounds like “ksew”. During the day, if a predator comes near, the saw-whet owls stand up very straight and hold their feathers flat against their body. If the predator comes closer, the owls bob their head and shifting from foot to foot. They may defecate or snap their bill at the predator, but they will eventually fly away.

Known Predators:

  • great horned owls (Bubo_virginianus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Northern saw-whet owls impact the populations of small mammals that they eat. They also host at least nine species of external parasites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Great horned owls are the only species that has been directly observed predating northern saw-whet owls. However, other large owls, such as long-eared owls and barred owls presumably also prey on northern saw-whet owls.

When approached by a predator or a human at night, northern saw-whet owls give a “ksew” call. During the day, they assume an erect posture and flatten their feathers against the body. If the predator continues to approach, they usually exhibit a “fright” reaction, bobbing the head, shifting from foot to foot, defecating, bill-snapping and finally flying away.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Studies of a few birds yielded seasonal home range estimates of about 75-150 ha. Two breeding males had home ranges of 142 and 159 hectares (Cannings 1987). Limited data on breeding density suggests maximum of a few pairs per sq km (Johnsgard 1988); singing males can be as close as about 250 meters apart (Swengel 1990). However, most breeding habitat probably supports a maximum of about 1 pair/square kilometer, often much less (Cannings 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Northern saw-whet owls communicate and perceive their environment using touch, sound and vision. They hunt using sight and sound. In fact, they have such good hearing that they can catch prey using just their ears to find it. Northern saw-whets use their eyes and ears to communicate. For example, males whose territories are next to each other may call back and forth to make sure that each stays in his own territory. During courtship, males call to females to attract them. Pairs use touch to strengthen the pair bond by allopreening (taking care of each others feathers).

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Northern saw-whet owls communicate and perceive their environment using touch, sound and vision. They detect prey by sight and sound. In fact, their hearing is so well developed that they can locate prey by hearing alone. Northern saw-whets use visual cues and vocalizations to communicate. For example, males with neighboring territories may exchange calls to establish territorial boundaries. During courtship, males vocalize to attract a mate, and pairs sometimes allopreen (preen each others feathers), using touch to strengthen or establish a pair bond.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Captive saw-whet owls have lived as long as 16 years. In the wild, the longest known lifespan of a northern saw-whet owl was 7 ears.

Range lifespan

Status: wild:
7 (high) years.

Range lifespan

Status: captivity:
16 (high) years.

Average lifespan

Status: wild:
124 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Captive saw-whet owls have lived as long as 16 years. In the wild, the longest known lifespan of a northern saw-whet owl was 7 ears.

Range lifespan

Status: wild:
7 (high) years.

Range lifespan

Status: captivity:
16 (high) years.

Average lifespan

Status: wild:
124 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.5 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nesting March-July (mainly April-May) in northeastern U.S. and southeastern Canada. Clutch size usually is about 5-6. Incubation, by female, lasts 26-28 days. Young first fly at 4-5 weeks (Johnsgard 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern saw-whet owls are usually monogamous. However, when a lot of food is available, they can be polygynous. Females may be able to raise two broods in a summer by leaving the male and the chicks of the first brood early and finding another male to mate with. Breeding pairs do not stay together for more than one summer.

Male northern saw-whet owls establish a territory and begin trying to attract females in late winter or early spring. Males advertise to females by calling at them. If the female is interested in the male, she may call back to him. The male and female of a pair sometimes preen each other’s feathers. This is called allopreening. It may help the pair to build a pair bond.

Mating System: monogamous

Northern saw-whet owls breed between March and July. Males begin calling in late winter and early spring to try to attract a female. Once a male and female for a pair, the female chooses a nest site. Northern saw-whet owls nest in tree cavities or abandoned woodpecker holes. These holes are usually 2 to 12 m above the ground.

The female lays 4 to 7 eggs (usually 5 or 6). She incubates the eggs for 26 to 28 days. The chicks are altricial at hatching. Their eyes stay closed for the first 7 to 10 days, and they must be brooded by the female for several weeks. The male brings food to the nest for the female and the chicks. The female feeds the food to the chicks by tearing it up into small pieces. After 18 days, the female leaves the nest, but the male keeps bringing food to the chicks.

Chicks leave the nest when they 4 to 5 weeks old. They are able to fly, but the male parent continues to feed them for at least a month. They become independent from their parents after 6 to 8 weeks. When they are one year old, northern saw-whet owls grow adult feathers. They may also begin breeding at one year old.

Breeding interval: Northern saw-whet owls breed once yearly.

Breeding season: Northern saw-whet owls breed between March and July.

Range eggs per season: 4 to 7.

Range time to hatching: 26 to 28 days.

Range fledging age: 4 to 5 weeks.

Range time to independence: 6 to 8 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Male and female northern saw-whet owls have very different jobs as parents. The female owl chooses the nest site, lays the eggs and incubates them for 26 to 28 days. When the chicks hatch, she broods them for at least 18 days and tears their food into smaller pieces before feeding it to them. The male brings all of the food to the female and the chicks, and protects the nest area.

When the chicks are 18 days old, the female may begin helping the male hunt for food for the chicks, or she may leave the area. Some females leave the male to find another mate and raise another brood of chicks. The male stays with the chicks and feeds them for at least a month.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Bisbee, M. 1998. Meet Them at the Wildlife Park: The Saw-Whet Owl. The Gray News (online edition), Vol. 30, No. 1.
  • Cannings, R. 1993. Northern saw-whet owl (Aegolius acadicus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 42. Philadelphia, PA: The Academy of Natural Sciences and Washington DC: The American Ornithologists Union.
  • Tufts, R. 1986. "Nova Scotia Museum of Natural History: Birds of Nova Scotia" (On-line). Accessed July 10, 2000 at http://museum.gov.ns.ca/mnh/nature/nsbirds/bns0219.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern saw-whet owls are typically monogamous, though polygyny can occur when prey are abundant. It is likely that females of this species are sequentially polyandrous, leaving the male and nestlings during to mate with another male and raise a second brood. Though this behavior most likely occurs, it has not been confirmed. There is no evidence that pairs remain together for more than one season.

Males establish a territory and begin advertising for a female in late winter and early spring. Males advertise by calling to a female who may call back if interested in the male. Pairs have been seen allopreening (tending to the feathers of one another), which may serve to build a pair bond.

Mating System: monogamous

Northern saw-whet owls breed between March and July. Males begin advertising for a mate by calling in late winter and early spring. Once a pair has formed, the female selects a nest site. The nests are 2 to 12 m high, usually in natural cavities or abandoned woodpecker holes, often ones made by Northern Flickers and Hairy Woodpeckers. The female lays 4 to 7 (usually 5 or 6) eggs at two-day intervals. She also incubates the eggs, beginning soon after the first egg is laid. Meanwhile, the male brings her food and defends the territory. The eggs hatch after 26 to 28 days of incubation. The chicks are altricial at hatching; their eyes remain closed for the first 7 to 10 days and they must be brooded by the female. The male provides food to the female, who tears it into pieces and feeds it to the chicks until they are about 18 days old. After this, the female leaves the nest to roost elsewhere, and the male, and sometimes the female, continues to provide food to the chicks. The chicks leave the nest when they 4 to 5 weeks old. They are able to fly reasonably well at this time, but continue to be fed by the male for at least a month afterward. The young become independent from the parents 6 to 8 weeks after fledging. Juveniles complete their first molt and grow adult plumage when they are one year old. They also become sexually mature and may begin breeding at one year old.

Breeding interval: Northern saw-whet owls breed once yearly.

Breeding season: Northern saw-whet owls breed between March and July.

Range eggs per season: 4 to 7.

Range time to hatching: 26 to 28 days.

Range fledging age: 4 to 5 weeks.

Range time to independence: 6 to 8 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

There is a clear division of parental responsibilities by northern saw-whet owls. The female selects the nest site, lays and incubates the eggs for 26 to 28 days and broods the chicks for at least 18 days. She also tears food up into smaller pieces and feeds it to the chicks. During this time, the male provides all of the food to the female and the chicks, and protects the nest area.

After 18 days, the female may join the male in providing food to the chicks, or she may leave the nest area completely, presumably to find another mate and raise a second brood. The male continues to feed the chicks for at least a month.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Bisbee, M. 1998. Meet Them at the Wildlife Park: The Saw-Whet Owl. The Gray News (online edition), Vol. 30, No. 1.
  • Cannings, R. 1993. Northern saw-whet owl (Aegolius acadicus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 42. Philadelphia, PA: The Academy of Natural Sciences and Washington DC: The American Ornithologists Union.
  • Tufts, R. 1986. "Nova Scotia Museum of Natural History: Birds of Nova Scotia" (On-line). Accessed July 10, 2000 at http://museum.gov.ns.ca/mnh/nature/nsbirds/bns0219.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Feathers aid prey detection: saw-whet owl
 

The flattened feathers around the eyes of a saw-whet owl aid the detection of prey because they funnel sound.

   
  "The eyes of a hunter: a saw whet owl. Placed right at the front of the head for accurate stereoscopic vision, these eyes are not the owl's means of locating prey. It relies also on its very sensitive hearing, and the rings of flattened feathers which accenuate its eyes are actually designed to funnel sound." (Foy and Oxford Scientific Films 1982:127)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aegolius acadicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTCATCTTCGGCGCATGAGCCGGCATAGTAGGAACAGCCCTCAGTCTACTCATCCGGGCTGAACTAGGTCAACCCGGCACACTCCTTGGAGACGACCAAATCTATAATGTAATTGTAACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATGCCTGTCATGATTGGAGGATTCGGTAACTGACTTGTACCCCTGATAATCGGAGCCCCGGACATGGCCTTTCCACGCATAAACAACATAAGTTTCTGACTGCTACCTCCCTCCTTTATACTCCTCCTAGCTTCCTCCACCGTAGAAGCCGGAGCAGGTACAGGATGAACAGTCTACCCCCCATTAGCCAGCAACCTAGCCCACGCTGGAGCCTCAGTAGACCTGGCTATTTTCTCCTTACACCTGGCCGGAGTCTCCTCTATCCTAGGAGCAATTAACTTTATCACAACCGCCATCAACATAAAACCTCCATCCCTGTCACAATATCAAACCCCACTATTCGTATGATCTGTACTCATCACTGCCATCCTCCTACTGCTATCTCTTCCAGTACTAGCTGCAGGAATCACCATACTCCTCACAGATCGCAACCTAAACACCACATTCTTTGACCCCGCTGGCGGCGGTGACCCAATCCTCTACCAACACCTTTTCTGATTCTTCGGGCACCCCGAAGTATACATCCTCATTTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aegolius acadicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are 200,000 to 600,000 northern saw-whet owls in the world. This number is probably getting smaller as the habitat that these birds need is being changed by logging. Nestling northern saw-whet owls that die usually die because they don’t have enough food, or because they have parasites. Adults are often killed when they are hit by vehicles.

Northern saw-whet owls are protected by the U.S. Migratory Bird Act and CITES Appendix II. They are not protected under the U.S. Endangered Species Act.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global population estimates for northern saw-whet owls range from 200,000 to 600,000 individuals. Though population trends have not been studied, populations of northern saw-whets are probably declining slowly due to habitat loss. Starvation and parasites are documented causes of nestling mortality. Adults are frequently killed by collision with vehicles.

Northern saw-whet owls are protected under the U.S. Migratory Bird Act and CITES Appendix II. They are ranked as a species of least concern by the IUCN, and are not protected under the U.S. Endangered Species Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of northern saw-whet owls on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern saw-whet owls help humans by killing rodents that many people consider to be pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse affects of northern saw-whet owls on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern saw-whet owls help humans by killing rodents that many people consider to be pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern saw-whet owl

The northern saw-whet owl (Aegolius acadicus) is a small owl native to North America.

Description[edit]

The scientific description of one of the sub-species of this owl is attributed to the Rev. John Henry Keen who was a missionary in Canada in 1896.[2] Adults are 17–22 cm (6.7–8.7 in) long with a 42–56.3 cm (16.5–22.2 in) wingspan.[3][4] They can weigh from 54 to 151 g (1.9 to 5.3 oz) with an average of around 80 g (2.8 oz),[5][6] making them one of the smallest owls in North America.[7] They are close to the size of an American robin. The northern saw-whet owl has a round, light, white face with brown and cream streaks; they also have a dark beak and yellow eyes. They resemble the short-eared owl, because they also lack ear tufts, but are much smaller. The underparts are pale with dark shaded areas; the upper parts are brown or reddish with white spots. They are quite common, but hard to spot.

Voice[edit]

The northern saw-whet owl makes a repeated tooting whistle sound. Some say they sound like a saw being sharpened on a whetstone.[8] They usually make these sounds to find a mate, so they can be heard more often April through June when they are looking for mates. Despite being more common in spring, they do vocalize year round.

Habitat[edit]

Their habitat is coniferous forests, sometimes mixed or deciduous woods, across North America. Most birds nest in coniferous type forests of the North but winter in mixed or deciduous woods. They also love riparian areas because of the abundance of prey there.[9] They live in tree cavities and old nests made by other small raptors. Some are permanent residents, while others may migrate south in winter or move down from higher elevations. Their range covers most of North America including southeastern Alaska, southern Canada, most of the United States and the central mountains in Mexico. The map shows where they breed and the areas where they can live throughout the year.

Some have begun to move more southeast in Indiana and neighboring states. Buidin et al. did a study of how far north the northern saw-whet owls breed and they found that they can breed northward to > 50º N, farther than ever recorded before.[10] Their range is quite extensive and they can even breed in the far north where most birds migrate from to breed. They are an adaptive species that can do well in the cold.

Nesting[edit]

Three juveniles in Oregon, USA

Northern saw-whet owls lay about 5–6 white colored eggs in natural tree cavities or woodpecker holes. The father does the hunting while the mother watches and sits on her eggs. Females can have more than one clutch of eggs each breeding season with different males. Once the offspring in the first nest have developed their feathers the mother will leave the father to care for them and go find another male to reproduce with.[9] This type of mating is sequential polyandry. They compete with boreal owls, starlings and squirrels for nest cavities and their nests may be destroyed or eaten by those creatures as well as nest predators such as martens and corvids. Saw-whet owls of all ages may be predated by any larger species of owl, of which there are at least a dozen that overlap in range. They are also predated by Accipiter hawks, which share with the saw-whet a preference for wooded habitats with dense thickets or brush.[11]

Feeding[edit]

These birds wait on a high perch at night and swoop down on prey. They mainly eat small organisms with a focus on small mammals in their diet. A test done by Swengel and Swengel found that the northern saw-whet owls most often eat deer mice, 67% and voles, 16% of the time in Wisconsin.[12] A similar test done by Holt and Leroux in Montana found that these owls ate more voles than other mammal species.[13] This shows that these owls can change their main prey depending on what is available. Also researched by Holt and Leroux was the eating habits of northern saw-whet owls and northern pygmy owls and found that they prey on different animals for their main food source, showing that they can adapt not only depending on the prey but also with the other predators in the areas where they live.

Other mammals preyed on occasionally include shrews, squirrels (largely chipmunks and red squirrels), various other mice species, flying squirrels, moles and bats. Also supplementing the diet are small birds, with passerines such as swallows, sparrows, kinglets and chickadees favored. However, larger birds, up to the size of rock pigeon (which are typically about 4 times as heavy as a saw-whet) can even be taken.[11] On the Pacific coast they may also eat crustaceans, frogs and aquatic insects. Like many owls, these birds have excellent hearing and exceptional vision in low light.

In popular culture[edit]

Martin from the "Guardians of Ga'Hoole" novel series is a northern saw-whet owl.

The song of the saw-whet owl is mentioned in the Grateful Dead song "Unbroken Chain" on their album Grateful Dead from the Mars Hotel.[14]

After an online "Critter Vote", the saw-whet owl became the new star of Telus' mobility campaign in the summer of 2011.

References[edit]

  1. ^ BirdLife International (2012). "Aegolius acadicus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Beolens et al, Bo (2009). The Eponym Dictionary of Mammals p.220. JHU Press. p. 574. 
  3. ^ [1] (2011).
  4. ^ [2] (2011).
  5. ^ Sibley, David (2003). The Sibley Field Guide To Birds of Eastern North America. New York: Alfred A. Knopf. p. 229. ISBN 0-679-45120-X. 
  6. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  7. ^ Vanner, Michael (2003). The Encyclopedia of North American Birds. New York: Barnes&Noble. p. 192. ISBN 0-7607-3460-7. 
  8. ^ Bull, John; Farrand, Jr., John (1994). National Audubon Society Field Guide to North American Birds. New York: Alfred A. Knopf. p. 555. ISBN 0-679-42852-6. 
  9. ^ a b DeLella Benedict, Audrey (2008). The Naturalist's Guide to the Southern Rockies: Colorado, Southern Wyoming, and Northern New Mexico. Golden, Colorado: Fulcrum Publishing. p. 568. ISBN 978-1-55591-535-3. 
  10. ^ Buidin, Christophe; Yann, Rochepault, Jean-Pierre L. Savard, Michel Savard (September 2006). "Breeding range extension of the Northern Saw-whet Owl in Quebec". The Wilson Journal of Ornithology 118 (3): 411. doi:10.1676/05-092.1. 
  11. ^ a b [3]
  12. ^ Swengel, Ann B.; Scott R. Swengel (August 1992). "Diet of Northern Saw-whet Owls in southern Wisconsin". The Condor 94 (3): 707. doi:10.2307/1369255. 
  13. ^ Holt, Denver W.; Leslie A. Leroux (March 1996). "Diets of Northern Pygmy Owls and Northern Saw-whet owls in West-Central Montana". Wilson Bulletin 108 (1): 123. 
  14. ^ Dodd, David. "The Annotated "Unbroken Chain"". "The Annotated Grateful Dead Lyrics". Retrieved 27 September 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Constitutes a superspecies with and may be conspecific with Middle American A. RIDGWAYI (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!