Articles on this page are available in 2 other languages: Chinese (Simplified) (7), Dutch (1) (learn more)

Overview

Brief Summary

Long-eared owls are active at night. They blend in well with their surroundings, making it very difficult to spot them during the day. The best way to find them is to look for droppings and pellets on the ground. If you happen to see one, it is easy to identify by its ear tufts, which are only decorative. Their real ears are flaps directly next to their eyes that open and close. These owl uses old nests from magpies, crows and various hawks. They will also nest in man-made nesting boxes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asio otus

The long tufts of feathers on its forehead give the Long-eared Owl its name. Like all birds, however, the Long-eared Owl’s real ears are small openings hidden underneath the feathers on the sides of its head. This species possesses the short legs, rounded wings, large yellow eyes, and disk-shaped face characteristic of owls. Aside from its long ‘ears,’ this medium-sized (15 inches) owl may also be identified by its streaked body and buff-colored face. Males are generally slightly paler than females. The Long-eared Owl is widely distributed across the Northern Hemisphere. In North America, this species breeds primarily across southern Canada and the northern tier of the United States. Smaller populations occur in the Rocky Mountains, along the coast of California, and at high elevations in the Appalachian Mountains. The Long-eared Owl occurs year-round in its breeding range, but individuals may disperse long distances during winter in search of food, wandering as far as the southern United States and central Mexico. In the Old World, this species breeds from Northern Europe across to Japan, wintering south to North Africa and South Asia. Other non-migratory populations occur in highland climates in Africa and on islands south of this species’ main range. The Long-eared Owl breeds in open evergreen or deciduous forests. Individuals remaining on breeding grounds during winter utilize the same habitats as in summer; individuals wandering south utilize forest habitats in those areas. Typical for an owl, the Long-eared Owl eats small mammals, such as mice, voles, and shrews, and may be found in greater numbers where prey is plentiful. The Long-eared Owl uses its excellent hearing to locate prey on the ground in order to fly down and capture it with its talons. Also, like most owls, this species hunts almost exclusively at night, making it difficult to observe. Long-eared Owls are most visible roosting high in trees during the day, especially in winter, when this species may form large communal roosts.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur : environ 36 cm, envergure : 95 cm, poids : 220 à 280 g pour les mâles et entre 250 et 370 g voire plus pour les femelles selon la saison.

Le Hibou moyen-duc est caractérisé par ses deux aigrettes érectiles et ses yeux orangés. Le dessus est brun jaunâtre marbré de sombre et le dessous est jaune roussâtre fortement rayé et finement vermiculé de sombre. En général, les mâles ont le dessous plus clair que les femelles. Le disque facial blanc jaunâtre est cerné de noir et interrompu par le front en pointe et les sourcils blanchâtres en « V ». Le Hibou moyen-duc est un petit peu plus petit et surtout plus fin que la Chouette hulotte ; en vol par contre ses ailes et sa queue ont l’air plus longues. Le Hibou moyen-duc se distingue du Hibou des marais par des ailes plus longues, en général plus claires et avec des extrémités noires. Il semble que les oiseaux français, jeunes comme adultes, soient sédentaires ou du moins se déplacent peu. Cependant des déplacements de plusieurs centaines de kilomètres sont connus et il existe également des mouvements en montagne des cols vers les vallées. Enfin, des oiseaux viennent hiverner en France depuis la Belgique à l’ex-Yougoslavie. En hiver, les Hiboux moyens-ducs se rassemblent pour constituer des dortoirs diurnes comptant en général plusieurs dizaines d’oiseaux et pouvant se situer en ville (cimetières boisés, parcs, ...).

Les Hiboux moyen-ducs sont des solitaires qui témoignent d’une sociabilité saisonnière. Ils ne présentent pratiquement pas de comportement territorial et sont monogames. La femelle pond 4 à 6 œufs entre fin-février et mi-avril puis les couve pendant 27 à 28 jours. Ils quittent le nid à l’âge de 3 semaines sans savoir voler. Au bout d’une semaine, ils commencent à s’exercer à la chasse, puis ils s’émancipent. Les jeunes souvent nichent non loin de leur lieu de naissance (environ 10 km) même si une partie s’installe dans un rayon de 50 à 100 km voire pour certains à plusieurs centaines de kilomètres.

Le Hibou moyen-duc peut chasser en vol comme à l’affut. Sauf exception, les campagnols et les Muridés constituent l’essentiel des proies des Moyens-ducs en Europe. Son régime est assez peu éclectique. Ses pelotes de réjection mesurent en moyenne 46 mm de long et 21 mm de diamètre ; elles ont une forme de cylindre gris clair assez mince.

Le Hibou moyen-duc fréquente les paysages agricoles semi-ouverts comme les bocages. L’espèce s’installe en effet sur les lisières ou près des grandes clairières des forêts et il chasse dans les milieux ouverts. L’habitat préférentiel est constitué d’une forte proportion de prairies naturelles à végétation courte, de champs cultivés entrecoupés de bois, de boqueteaux, de haies hautes et d’arbres isolés. Le Hibou moyen-duc est très flexible dans le choix de son nid qui peut être un ancien nid de corneille, de rapace diurne ou un nid artificiel et il peut même nicher au sol. Un territoire de chasse s’étend sur 2 à 3 km² mais varie en fonction des ressources alimentaires.

Manifestation vocale : Timbre de voix grave et sourd. Chant territorial du mâle monotone composé de houh sourds émis à intervalles de 2 à 5 sec.

Pour en savoir plus : MEBS T. & SCHERZINGER W. (2006). Rapaces nocturnes de France et d’Europe. Les encyclopédies du naturaliste. Éditions Delachaux & Niestlé. 398 pages.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) BREEDS: southern and eastern British Columbia to northern Saskatchewan and Prince Edward Island, south to northwestern Baja California, southern New Mexico, northern Mexico, Arkansas, and Virginia. WINTERS: southern Canada to northern Baja California, central Mexico, and Gulf Coast. Also in Old World.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Long-eared owls are found throughout the northern hemisphere. Their range extends throughout temperate North America, through Europe and the former Soviet Union as far east as Japan. Isolated populations are also found North and East Africa, the Azores, and the Canary Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); ethiopian (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Long-eared owls are found throughout the northern hemisphere. Their range extends throughout temperate North America, through Europe and the former Soviet Union as far east as Japan. Isolated populations are also found North and East Africa, the Azores, and the Canary Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); ethiopian (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Long-eared owls are medium-sized owls. They have long, rounded wings and a long tail. The wings are so long that they cross each other in the back when the bird is perched. The wingspan of adults ranges from 90 to 100 cm. Long-eared owls are brownish gray, with vertical streaks. They have pale patches on their face that look like eyebrows, and a white patch below the bill. They have a black bill, orange or yellow eyes, and their legs and toes are covered with feathers. Long-eared owls have long blackish tufts that look like ears, but are really just feathers.

Female long-eared owls are usually much larger than males. Females weigh 260 to 435 g and are 27 to 40 cm long. Males weigh 220 to 305 g and are 35 to 37.5 cm long. Females are also darker than males. Young long-eared owls look like adults, but have softer, looser feathers.

Long-eared owls are the slimmest of all North American owls. This shape helps them hide from predators. When they are perched, long-eared owls stretch out their body flatten their feathers to make themselves look like a tree limb.

Range mass: 220 to 435 g.

Range length: 35 to 40 cm.

Range wingspan: 90 to 100 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Average basal metabolic rate: 0.954 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Long-eared owls are medium-sized owls. Females are generally much larger than males, (260 to 435 g and 27 to 40 cm in length versus 220-305 g and 35 to 37.5 cm in length for males). Long-eared owls are the most slender of all North American owls, an attribute that they use as a defense against predators. When perched, long-eared owls elongate their body and ear tufts, and compresses its feathers, making them resembles a tree limb. Long-eared owls have long, rounded wings and a long tail. The wings are so long that they cross each other in the back when the bird is perched. The wingspan of adults ranges from 90 to 100 cm. The head of long-eared owls is large and round, topped with long blackish ear tufts that are close together and are not visible in flight.

Long-eared owls are brownish gray, with vertical streaks that distinguishing them from great horned owls, which have horizontal streaks. Long-eared owls have pale patches on the face that give the appearance of white eyebrows, and a white patch below the bill. They have a black bill, orange or yellow eyes, and their legs and toes are completely feathered.

Females are generally darker and more richly colored than males. Juveniles look similar to adults, but have softer, looser feathers.

Range mass: 220 to 435 g.

Range length: 35 to 40 cm.

Range wingspan: 90 to 100 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Average basal metabolic rate: 0.954 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 38 cm

Weight: 279 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Deciduous and evergreen forests, orchards, wooded parks, farm woodlots, river woods, desert oases. Wooded areas with dense vegetation needed for roosting and nesting, open areas for hunting. Often associated with conifers in eastern North America, also with deciduous woods near water in West.

Nests in tree usually in old nest of crow, squirrel, hawk, magpie, or heron; sometimes in tree cavity; rarely on ground (e.g., Maples et al. 1995, Wilson Bull. 107:563-565). In northeastern Oregon, nested in dwarf-mistletoe brooms in Douglas-fir in extensive conifer (grand fir) forest (Bull et al. 1989). Apparently commonly nests in same site in successive years. In Idaho, 4 males nested 0.5-1.5 km from natal site.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-eared owls live in forests and shrub lands that are near to open areas, such as grasslands. They can be found from sea level up to 2000 m elevation. They are common in tree belts along streams in dry habitats. They can also be found in shelterbelts, small tree groves, thickets surrounded by wetlands, grasslands, marshes and farmlands.

Range elevation: 0 to 2000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-eared owls inhabit dense vegetation close to grasslands, as well as open forests shrub lands from sea level up to 2000 m elevation. They are common in tree belts along streams of plains and even desert oases. They can also be found in shelterbelts, small tree groves, thickets surrounded by wetlands, grasslands, marshes and farmlands.

Range elevation: 0 to 2000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migratory in most of Canada and north-central U.S. At Cape May Point, New Jersey, 90% of fall migration was completed between mid-October and late November (Duffy and Kerlinger 1992). See also Russell et al. (1991) for an account of fall migration at Cape May Point, New Jersey.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic; feeds on available small mammals (usually <50 g) (Marks 1984). Typical primary prey in North America includes MICROTUS, PEROMYSCUS, and PEROGNATHUS; varies with locality (e.g., THOMOMYS in Oregon; Bull et al. 1989). Typically forages in open grassy area, e.g., marsh, old field, but may forage in forest in some areas (e.g., northeastern Oregon, Bull et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Long-eared owls hunt at night in open habitats. They have excellent eyesight and hearing that they use to catch prey.

Long-eared owls eat small mammals, including Microtus, Peromyscus, Perognathus, Dipodomys, Thomomys talpoides, shrews (genera Glarina, Cryptotis and .Sorex), juvenile rabbits (genera Sylvilagus and Lepus) and juvenile Rattus. They also eat some small Aves, small Serpentes, and Insecta. After they catch prey, long-eared owls kill it by biting the back of the skull and then they swallow it whole. They store extra food in the nest during incubation and while chicks are in the nest. We do not know how long-eared owls drink water.

Animal Foods: birds; mammals; reptiles; insects

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Long-eared owls hunt almost exclusively at night and in open habitats. During brood-rearing, they may begin hunting before sunset. Long-eared owls are active search-hunters. They most likely capture prey using their excellent low-light eyesight and their superb hearing. Most prey are captured on the ground or from low vegetation.

Long-eared owls probably prey opportunistically on small mammals under 100 g. Their principal prey are voles and deer mice. Other small mammals taken include pocket mice, kangaroo rats, pocket gophers, shrews (genera Glarina, Cryptotis and Sorex), juvenile rabbits (genera Sylvilagus and Lepus) and juvenile rats. Long-eared owls also occasionally eat small birds, small snakes, and insects. After capturing prey, long-eared owls kill it by biting the back of the skull and then swallow it whole. Excess prey is stored at the nest during incubation and during the nestling stage.

There is no information available regarding how long-eared owls drink or obtain sufficient water.

Animal Foods: birds; mammals; reptiles; insects

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Long-eared owls affect the populations of animals they eat. They also provide habitat for many external and internal parasites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult long-eared owls are preyed upon by many other raptors. Raptors that have been observed taking long-eared owls include Bubo virginianus, Strix varia, Aquila chrysaetos, Buteo jamaicensis, Buteo lineatus, Accipiter gentiles, Bubo bubo, Buteo buteo, and Falco peregrinus. Incubating female long-eared owls have been killed by Procyon lotor.

Long-eared owl nestlings are vulnerable to predation by Erethizon dorsatum, Pituophis melanoleucus, Corvus brachyrhynchos, Pica pica, and several hawk species.

Roosting adults are difficult to see because their coloration, slender body and ear tufts help them to look like a branch of the tree that they are roosting in. When a predator approaches a nest, adult long-eared owls defend the eggs or young by circling the nest and snapping their bill at the predator, or dive-bombing the predator while making alarm calls. They may also pretend to be injured in order to draw the predator away from the nest. In some cases, adults from several nearby nests may all perform defense displays when a single nest is threatened.

Known Predators:

  • barred owls (Strix_varia)
  • golden eagles (Aquila_chrysaetos)
  • red-tailed hawks (Buteo_jamaicensis)
  • red-shouldered hawks (Buteo_lineatus)
  • northern goshawks (Accipiter_gentilis)
  • eagle owls (Bubo_bubo)
  • common buzzards (Buteo_buteo)
  • peregrine falcons (Falco_peregrinus)
  • raccoons (Procyon_lotor)
  • porcupines (Erethizon_dorsatum)
  • gopher snakes (Pituophis_melanoleucus)
  • American crows (Corvus_brachyrhynchos)
  • black-billed magpies (Pica_pica)
  • great horned owls (Bubo_virginianus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Long-eared owls impact the local populations of their prey. They also host several external and internal parasites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult long-eared owls are preyed upon by many other raptors. Raptors that have been observed taking long-eared owls include great-horned owls, barred owls, golden eagles, red-tailed hawks, red-shouldered hawks, northern goshawks, eagle owls, common buzzards, and peregrine falcons. Incubating female long-eared owls have been killed by raccoons.

Long-eared owl nestlings are vulnerable to predation by porcupines, bull snakes, American crows, black-billed magpies, and several hawk species.

Roosting adults are difficult to see because their coloration, slender body and ear tufts help them to look like a branch of the tree that they are roosting in. When a predator approaches a nest, adult long-eared owls defend the eggs or young by circling the nest and snapping their bill at the predator, or dive-bombing the predator while making alarm calls. They may also pretend to be injured in order to draw the predator away from the nest. In some cases, adults from several nearby nests may all perform defense displays when a single nest is threatened.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Asio otus preys on:
Geomyidae
Sylvilagus
Reithrodontomys
Aves
Peromyscus maniculatus
Orthoptera
Microtus longicaudus
Plecotus auritus

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Guesstimated number of breeding pairs in Canada in the early 1990s was 10,000-20,000 (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding density generally not more than 1-2 pairs per sq km, often much less. Home ranges in Wyoming riparian habitat varied from 34-106 hectares (mean 51 hectares; Craighead and Craighead 1956). Gregarious in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Long-eared owls use calls and displays to communicate. They have many calls that they use during the breeding season. During the rest of the year, they are mostly silent. The most common calls are soft musical hoots and single quavering hoots. When excited, long-eared owls may also shriek or whistle. When chicks are threatened, parents use calls to scare away the predator. They may also pretend to be crippled to distract the predator from the nest. Long-eared owls use threat displays when disturbed by humans or predators. They don’t usually threaten each other.

Long-eared owls have excellent hearing and vision. These senses help them to be excellent hunters.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Long-eared owls use a wide repertoire of calls to communicate primarily during the breeding season. They are mostly silent at other times of the year. The most common vocalizations are soft musical hoots and single quavering hoots. When excited, long-eared owls may also shriek or whistle. Alarm calls are demonstrated by both sexes. Parents strongly defend their young, with vocalizations as well as a "crippled wing act" used as a lure. Threat displays are also used, generally directed at human intruders or predators rather than toward one another.

Long-eared owls have excellent hearing and vision that aids them in perceiving their environment and in catching prey.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Basically nocturnal, though diurnal foraging may occur at high latitudes or when feeding young.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest wild long-eared owl lived 27 years and 9 months.

Range lifespan

Status: wild:
27.8 (high) years.

Average lifespan

Status: wild:
133 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known wild long-eared owl lived 27 years and 9 months. Adult annual survivorship in Germany and Switzerland was estimated to be 69%.

Range lifespan

Status: wild:
27.8 (high) years.

Average lifespan

Status: wild:
133 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nests mainly mid-March to mid-May in many areas. Clutch size averages 4-5 in North America, highest in north and west. Incubation lasts 25-30 days, normally by female only. Young leave nest at 20-26 days, fly at 30-40 days, independent at about 2 months. Sexually mature in 1 year. High rodent numbers are essential for nesting success.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-eared owls are monogamous. Pairs begin to form in winter, and they breed between February and mid-July. Males attract a female by singing songs and showing off their flying skills.

Mating System: monogamous

Long-eared owls breed between February and July. They raise one brood per season. Long-eared owls nest in trees in nests built by other species. Once they choose a nest, the female lays 2 to 10 (usually 5 to 6) eggs. She lays one egg every other day. The eggs are white, smooth and glossy. The female incubates the eggs for 25 to 30 (usually 26-28) days. She never leaves the eggs uncovered during the day, but she takes short breaks at night. The chicks are semi-altricial. The female broods them for at least 2 weeks. The young leave the nest when they are about 21 days old, but they cannot fly yet. They leave the nest by walking, and live on branches near the nest. They begin flying when they are about 35 days old. The male brings food for the female and chicks until the chicks become independent. This happens when they are 10 to 11 weeks old. Long-eared owls usually begin breeding at 1 year.

Breeding interval: Long-eared owls breed once yearly.

Breeding season: Long-eared owls breed between February and July.

Range eggs per season: 2 to 10.

Average eggs per season: 5-6.

Range time to hatching: 25 to 30 days.

Average time to hatching: 26-28 days.

Average fledging age: 21 days.

Average time to independence: 8-9 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Female long-eared owls incubate the eggs and brood the semi-altricial chicks for at least two weeks. During incubation and brood rearing, the male provides food for the female and chicks. The male continues to feed the chicks until they become independent at 10 to 11 weeks old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Female); pre-independence (Provisioning: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-eared owls are monogamous, though polygyny is occasionally observed in this species. Pairs begin to form in winter, and breeding takes place from February to mid-July. Males advertise for a mate using songs and aerial displays, such as zig-zag flights through trees in the breeding habitat.

Mating System: monogamous

Long-eared owls breed between February and July, and raise one brood per season. Males begin advertising for a mate as early as January. They use songs and aerial displays to attract a female.

Long-eared owls nest in trees, usually in stick nests built by other species. They may occasionally build a nest of their own, or use a nest located in an old tree stump or on the ground, but this is uncommon. Once a nest is selected, the female lays 2 to 10 (usually 5 to 6) eggs at 2-day intervals. The eggs are white, smooth and glossy. The female incubates the eggs for 25 to 30 (usually 26-28) days. She never leaves the eggs uncovered during the day, though she takes short breaks at night. The chicks are semi-altricial, and are brooded by the female for at least 2 weeks. The young leave the nest at about 21 days, though they are still flightless (called branching), and reside in nearby vegetation. They begin making short flights at about 35 days old and become independent at 10 to 11 weeks old. The male provides food for the female and owlets throughout incubation and brood-rearing. Long-eared owls usually begin breeding at 1 year.

Long-eared owls breed between February and July. They raise one brood per season. Long-eared owls nest in trees in nests built by other species. Once they choose a nest, the female lays 2 to 10 (usually 5 to 6) eggs. She lays one egg every other day. The eggs are white, smooth and glossy. The female incubates the eggs for 25 to 30 (usually 26-28) days. She never leaves the eggs uncovered during the day, but she takes short breaks at night. The chicks are semi-altricial. The female broods them for at least 2 weeks. The young leave the nest when they are about 21 days old, but they cannot fly yet. They leave the nest by walking, and live on branches near the nest. They begin flying when they are about 35 days old. The male brings food for the female and chicks until the chicks become independent. This happens when they are 10 to 11 weeks old. Long-eared owls usually begin breeding at 1 year.

Breeding interval: Long-eared owls breed once yearly.

Breeding season: Long-eared owls breed between February and July.

Range eggs per season: 2 to 10.

Average eggs per season: 5-6.

Range time to hatching: 25 to 30 days.

Average time to hatching: 26-28 days.

Average fledging age: 21 days.

Average time to independence: 8-9 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Female long-eared owls incubate the eggs and brood the semi-altricial chicks for at least two weeks. During incubation and brood rearing, the male provides food for the female and chicks. The male continues to feed the chicks until they become independent at 10 to 11 weeks old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Female); pre-independence (Provisioning: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Ears map sounds: long-eared owl
 

The ears of the long-eared owl can map sounds three-dimensionally because of their asymmetric placement.

     
  "The 'ears' of this long-eared owl are not ears at all, but merely decorative feathers. The owl relies mainly on its hearing when hunting. Its ears are placed asymmetrically on either side of its head, and the sounds received by them are interpreted to give a very accurate three-dimensional sound map of its surroundings." (Foy and Oxford Scientific Films 1982:165)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Asio otus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Asio otus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAAAGACATTGGCACCTTATACCTAATCTTCGGTGCATGAGCCGGCATGGTTGGTACTGCCCTCAGCCTACTCATCCGGGCTGAGCTAGGTCAACCCGGAACACTTCTAGGGGATGACCAGATCTATAATGTAGTAGTTACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATACCTATCATGATTGGCGGGTTCGGAAATTGATTAGTCCCATTAATAATTGGAGCCCCAGACATAGCCTTCCCACGTATAAACAACATAAGCTTCTGACTTCTTCCCCCCTCATTCCTACTTCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTCTACCCCCCACTAGCCAGCAACCTAGCCCATGCAGGAGCCTCAGTAGACCTAGCAATTTTCTCCCTACATCTGGCTGGGGTATCCTCTATCCTAGGTGCAATCAACTTCATCACCACCGCCATCAACATAAAACCCCCAACCCTATCACAGTACCAAACCCCCCTATTTGTATGGTCGGTCCTTATCACCGCCATCCTACTACTACTATCACTCCCAGTCCTCGCCGCAGGCATCACCATGCTATTAACCGACCGCAACCTAAATACCACATTCTTCGACCCAGCTGGCGGAGGTGACCCTATCCTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAGGTCTACATCCTCATTCTTCCAGGATTTGGAATTATCTCCCACGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Secure due primarily to extensive range; population trends are poorly known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-eared owl populations in the United States are healthy. Most long-eared owl deaths are probably caused by starvation or predation. Adult long-eared owls are sometimes killed by cars or shot by hunters in the U.S., but this is not common.

Long-eared owls are protected under CITES Appendix II and the U.S. Migratory Bird Act. They are not federally endangered or threatened in the United States, but they are considered threatened in the state of Michigan.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of long-eared owls are difficult to track. However, within the U.S., populations appear to be largely stable, with declines locally in some states, including New Jersey, Minnesota and California. Most deaths are probably due to starvation or predation, though destruction of vegetation and alteration of habitat are also potential causes of population declines. Adults are occasionally killed by cars or shot by hunters in the U.S., but this is not common.

Long-eared owls are protected under CITES Appendix II and the U.S. Migratory Bird Act. They are not federally endangered or threatened in the United States, but they are considered threatened in the state of Michigan.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Rich et al. (2004) estimated the global population to number 120,000 individuals. In Europe, the breeding population is estimated to number 380,000-810,000 breeding pairs, equating to 1,140,000-2,430,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a revised estimate of the global population size is 1,500,000-5,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Long-eared owls have no known negative effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Long-eared owls help to control populations of rodents that are considered to be agricultural pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Long-eared owls have no known negative effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Long-eared owls help to control populations of rodents that are considered to be agricultural pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Long-eared owl

The long-eared owl (Asio otus, previously Strix otus) is a species of owl which breeds in Europe, Asia, and North America. This species is a part of the larger grouping of owls known as typical owls, family Strigidae, which contains most species of owl. The other grouping of owls are the barn owls, family Tytonidae.

Description[edit]

The long-eared owl is a medium sized owl, 31–40 cm (12–16 in) in length with an 86–100 cm (34–39 in) wingspan and a body mass of 178–435 g (6.3–15.3 oz).[2][3] It has erect blackish ear-tufts, which are positioned in the center of the head. The ear-tufts are used to make the owl appear larger to other owls while perched. The female is larger in size and darker in coloration than the male. The long-eared owl's brownish feathers are vertically streaked. Tarsus and toes are entirely feathered. Eye disks are also characteristic in this species. However, the eye disks of A. otus are darker in color or rusty-orange. This nocturnal species is perhaps most easily seen perched in a tree in its daytime roost, sometimes in small groups during the winter months.

Separation from short-eared owl[edit]

Over much of its range, long-eared owls occur with the similar-looking short-eared owl. At rest, the ear-tufts of the long-eared owl serve to easily distinguish the two (although long-eared owls can sometimes hold their ear-tufts flat). The iris-colour differs: yellow in short-eared, and orange in long-eared, and the black surrounding the eyes is vertical on long-eared, and horizontal on short-eared. Overall, the short-eared owl tends to be a paler, sandier bird than the long-eared. There are a number of other ways in which the two species differ which are best seen when they are flying:

  • short-eared owls often have a broad white band along the rear edge of the wing, which is not shown by long-eared owls;
  • on the upperwing, the short-eared owl's primary-patches are usually paler and more obvious;
  • the band on the upper side of the short-eared owl's tail are usually bolder than those of the long-eared;
  • the short-eared's innermost secondaries are often dark-marked, contrasting with the rest of the underwing;
  • the long-eared owl has streaking throughout its underparts whereas on the short-eared the streaking ends at the breast;
  • the dark markings on the underside of the tips of the longest primaries are bolder on short-eared owls;
  • the upperparts of short-eared owls are coarsely blotched, whereas on the long-eared they are more finely marked;
  • the short-eared Owl also differs structurally from the long-eared, having longer, slimmer wings: long-eared owls have wings shaped more like those of a tawny owl.[4]

Behavior[edit]

The long-eared owl's breeding season is from February to July. This bird is partially migratory, moving south in winter from the northern parts of its temperate range. Its habitat is forest close to open country. Overall, these owls are secretive, and are rarely seen.

It nests in trees, often coniferous, using the old stick nests of other birds such as crows, ravens and magpies and various hawks. The average clutch size is 4–6 eggs, and the incubation time averages from 25–30 days. It will readily use artificial nesting baskets. An unusual characteristic of this species is its communal roosting in thickets during the winter months. The young have a characteristic call, likened to a rusty hinge.

The long-eared owl hunts over open country by night. It is very long winged, like the similar short-eared owl, and glides slowly on stiff wings when hunting. Its food is mainly rodents, small mammals, and birds. In Europe it faces competition from the tawny owl and is most numerous in localities where the tawny is absent, notably in Ireland, where it is the dominant owl.

Subspecies[edit]

Four subspecies are recognized:[5][6]

References[edit]

  1. ^ BirdLife International (2012). "Asio otus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  3. ^ "Long-eared Owl". All About Birds. Cornell Lab of Ornithology. 
  4. ^ Harris, Alan, Laurel Tucker and Keith Vinicombe (1989) The MacMillan Field Guide to Bird Identification pages 147-149 (reference covers whole paragraph)
  5. ^ "Long-eared Owl". owlpages.com. Retrieved 2014-05-01. 
  6. ^ "Long-eared Owl". ARKive. Wildscreen. Retrieved 2013-04-23. 

Bibliography[edit]

  • Davis, A. H. and R. J. Prytherch (1976) Field identification of Long-eared and Short-eared Owls British Birds 69: 281-7
  • Kemp, J. B. (1982) Field identification of Long-eared and Short-eared Owls British Birds 75(5): 227
  • Robertson, Iain S. (1982) Field identification of Long-eared and Short-eared Owls British Birds 75(5): 227-9
  • Kemp, J. B. (1982) Tail-lengths of Long-eared and Short-eared Owls British Birds 75(5): 230

Migration[edit]

  • Erritzoe, J. & Fuller, R.A. (1999) Sex differences in winter distribution of Long-eared Owls (Asio otus) in Denmark and neighbouring countries. Vogelwarte 40: 80-87.

In Art[edit]

John James Audubon illustrates the "Long-eared Owl - Strix otus" as Plate 383 in Birds of America, published London, 1827-38. The print was engraved by Robert Havell in 1837. The original watercolor was purchased from Audubon's destitute widow by The New York History Society where it remains to this day.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The genetic distance (based on allozyme data) between A. otus and A. flammeus is unusually large for congeneric bird species (Randi et al., 1991); further study of their phylogenetic relationships is warranted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!