Articles on this page are available in 2 other languages: Chinese (Simplified) (11), Dutch (1) (learn more)

Overview

Brief Summary

European shore larks brood in Scandinavia and in northern Russia. They come to the Netherlands while migrating south. A small amount spends the winter in the Netherlands. The birds are usually observed in small groups on the beach and in the salt marshes. Because they eat seeds, you can also find them on fields. However, they aren't easy to spot while they potter around on the ground. When frightened, they take flight and make bird calls very similar to sky larks.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eremophila alpestris

A striking bird somewhat larger than a sparrow (7-8 inches), the Horned Lark is most easily identified by its black face patches and breast stripe, yellow throat and forehead, and black “horn-shaped” feather tufts on its head. Other field marks include a brown body, pale breast, and black underside to the tail. Male and female Horned Larks are similar to one another in all seasons, although females have slightly duller plumage. The Horned Lark inhabits a large portion of Eurasia (where it is known as the Shore Lark) and North America. In the New World, the Horned Lark breeds from Alaska and arctic Canada south to central Mexico, although this species is conspicuously absent from interior portions of Canada, the Pacific Northwest, and some coastal areas of the eastern United States. During winter, Horned Larks withdraw from northern portions of their breeding range, wintering further south in Canada and the U.S.An isolated population exists in the Andes Mountains of Columbia. In the Old World, this species breeds in northern Scandinavia and Russia as well as at higher elevations in Central Europe and West and Central Asia. Northern populations migrate south to mid-latitudes in Eurasia, whereas southern populations are non-migratory. An isolated population exists in Morocco. Horned Larks breed in open, sparsely vegetated habitats, including agricultural fields, prairie, grassland, desert, and tundra. Similar habitats are occupied on migration and in winter. This species primarily eats seeds, but may eat insects when they are available, particularly in the warmer months and during migration. Due to this species’ preference for open habitat, Horned Larks may be most easily seen foraging for food on bare or sparsely-vegetated ground. During the winter, this species may form large flocks that wander widely in search of food. Horned Larks are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: northernmost North America south to southern Baja California, southern Mexico, Louisiana, northern Alabama, and North Carolina, and in South America in eastern Andes of Colombia (Cundinamarca and Boyaca). NORTHERN WINTER: southern Canada south through breeding range, and, locally and irregularly to Gulf Coast and Florida. Also occurs in Old World (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eremophila alpestris spans across North America, and also inhabits Asia and northern Europe. It lives throughout the western, central, and eastern United States, including Alaska, and throughout northern and southern Canada. While some individuals migrate to the Gulf Coast for several months during the winter, many inhabit one area year-round.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eremophila alpestris spans across North America, and also inhabits Asia and northern Europe. It lives throughout the western, central, and eastern United States, including Alaska, and throughout northern and southern Canada. While some individuals migrate to the Gulf Coast for several months during the winter, many inhabit one area year-round.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most distinguishing physical characteristic of horned larks is the pair of black feather tufts on the top of their head. The tufts look like little horns. The face is usually white or pale yellow with a black stripe that starts at the bill, runs through the eye and down each side of the head. The breast is white with a black patch, and the body is brown. The tail is black. Horned larks are 18 to 20 cm long with a wingspan of 31.12 to 35.56 cm. On the hind toe, there is a long, straight claw. The claw or 'larkspur' is a common characteristic of members of the lark family (Connecticut Department of Environmental Protection, 2000). Females generally have the same patterns as males, but are smaller, have a duller appearance, and have gray coloring instead of black in some areas. Males weigh 32 g on average, females 30.6 g.

Average mass: 31 g.

Range length: 18 to 20 cm.

Range wingspan: 31.12 to 35.56 cm.

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Average mass: 26 g.

Average basal metabolic rate: 0.3133 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The most distinguishing physical characteristic of horned larks is the pair of black feather tufts on the top of their head. The tufts look like little horns. The face is usually white or pale yellow with a black stripe that starts at the bill, runs through the eye and down each side of the head. The breast is white with a black patch, and the body is brown. The tail is black. Horned larks are 18 to 20 cm long with a wingspan of 31.12 to 35.56 cm. On the hind toe, there is a long, straight claw. The claw or 'larkspur' is a common characteristic of members of the lark family (Connecticut Department of Environmental Protection, 2000). Females generally have the same patterns as males, but are smaller, have a duller appearance, and have gray coloring instead of black in some areas. Males weigh 32 g on average, females 30.6 g.

Average mass: 31 g.

Range length: 18 to 20 cm.

Range wingspan: 31.12 to 35.56 cm.

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Average mass: 26 g.

Average basal metabolic rate: 0.3133 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Weight: 32 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Grassland, tundra, sandy regions, areas with scattered low shrubs, desert playas, grazed pastures, stubble fields, open cultivated areas, and rarely open areas in forest (AOU 1983). Nests in hollow on ground often next to grass tuft or clod of earth or manure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eremophila alpestris is a temperate species that prefers large open land devoid of large obstacles such as trees. It can generally be found in fields, prairies, and dry tundra. Horned larks are also known to inhabit places with widespread lawns, such as airports. They are most often found on the ground.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; savanna or grassland

Other Habitat Features: agricultural

  • Alsop, F. 2001. Birds of North America Western Region. London: DK Publishing.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eremophila alpestris is a temperate species that prefers large open land devoid of large obstacles such as trees. It can generally be found in fields, prairies, and dry tundra. Horned larks are also known to inhabit places with widespread lawns, such as airports. They are most often found on the ground.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; savanna or grassland

Other Habitat Features: agricultural

  • Alsop, F. 2001. Birds of North America Western Region. London: DK Publishing.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Populations from breeding areas north of southern Canada are migratory. Migratory populations generally leave nonbreeding range by end of April (Terres 1980). Arrives in northernmost breeding areas in May, remains into September.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly seeds and, in warm season, insects; food obtained mainly from ground surface.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Eremophila_alpestris forages for food around the open spaces in which it lives. It does not scan for food by flight, but rather searches by covering the ground on foot. Unless it is nesting, it will usually search for food with others from its flock. Horned larks are omnivorous. They feed on insects and other arthropods including: spiders, ants, grasshoppers and wasps. They also eat snails, as well as the fruits, berries and seeds of some plants.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Eremophila alpestris forages for food around the open spaces in which it lives. It does not scan for food by flight, but rather searches by covering the ground on foot. Unless it is nesting, it will usually search for food with others from its flock. Horned larks are omnivorous. They feed on insects and other arthropods including: spiders, ants, grasshoppers and wasps. They also eat snails, as well as the fruits, berries and seeds of some plants.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Eremophila alpestris occasionally acts as a host for parasitic cowbirds. Eremophila alpestris young suffer from cowbird parasitism because the parents neglect them to take care of the cowbird young. Cowbirds lay eggs in the nests of Eremophila alpestris, and when they hatch, the horned lark parents care for them, which takes away from the care of their own eggs. As a result, the cowbird chicks thrive and the Eremophila alpestris chicks suffer. Cowbird chicks are much larger than horned lark chicks which enables them to devour all the food the parents bring before the lark chicks get the chance.

Horned larks also have an impact on the insects and plants they consume.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The brownish coloring of the body helps E._alpestris hide in the dry grasses of its environment. The coloration of the nestlings' down also acts as camouflage. The young leave the nest before they can fly, so when threatened, they freeze and depend on their cryptic coloring to keep them hidden.

Common predators include: raccoons (Procyon_lotor), domestic cats (Felis_silvestris) and skunks (subfamily Mephitinae).

Known Predators:

  • raccoons (Procyon_lotor)
  • domestic cats (Felis_silvestris)
  • skunks (Mephitinae)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Eremophila alpestris occasionally acts as a host for parasitic cowbirds. Eremophila alpestris young suffer from cowbird parasitism because the parents neglect them to take care of the cowbird young. Cowbirds lay eggs in the nests of Eremophila alpestris, and when they hatch, the horned lark parents care for them, which takes away from the care of their own eggs. As a result, the cowbird chicks thrive and the Eremophila alpestris chicks suffer. Cowbird chicks are much larger than horned lark chicks which enables them to devour all the food the parents bring before the lark chicks get the chance.

Horned larks also have an impact on the insects and plants they consume.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The brownish coloring of the body helps E. alpestris hide in the dry grasses of its environment. The coloration of the nestlings' down also acts as camouflage. The young leave the nest before they can fly, so when threatened, they freeze and depend on their cryptic coloring to keep them hidden.

Common predators include: raccoons (Procyon lotor), domestic cats (Felis silvestris) and skunks (subfamily Mephitinae).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Eremophila alpestris is prey of:
Falco mexicanus
Buteo regalis
Buteo swainsoni
Procyon lotor
Felis silvestris
Mephitinae

Based on studies in:
USA: Montana (Tundra)
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Eremophila alpestris preys on:
Insecta
Hemiptera
Diptera
Elateridae
Noctuidae
Coleoptera
Hymenoptera
Sphaeralcea coccinea

Avena sativa
Polygonum cuspidatum
Achnatherum hymenoides
Amaranthus albus
Chenopodium leptophyllum
Papilionoidea
Orthoptera
Arthropoda
non-insect arthropods
Mollusca

Based on studies in:
Canada: Manitoba (Grassland)
USA: Montana (Tundra)
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding density 1.3-1.5 individuals/ha in shadscale habitat in eastern Nevada (Medin 1990). Territory size varies with habitat and population density; ranges from means of 3.5 ha in higher latitude heath (Cannings and Threlfall 1981) and 1.6 ha in the agricultural Midwest (Beason and Franks 1974), to a range of 0.3-14 ha in Colorado shorgrass prairie (Boyd 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The song of E._alpestris is irregular and high-pitched. It has a tinkling, rapid warble that sounds like a "tsip, tsip, tsee, didididi" (Cornell Laboratory of Ornithology, 2001). They use song to defend territories, attract mates, and for general communication with others in the flock.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

The song of E. alpestris is irregular and high-pitched. It has a tinkling, rapid warble that sounds like a "tsip, tsip, tsee, didididi" (Cornell Laboratory of Ornithology, 2001). They use song to defend territories, attract mates, and for general communication with others in the flock.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

No information could be found except to say that this bird follows the general bird development stages of starting in an egg, hatching, and then maturing in the nest with its parents (Nova Scotia Museum of Natural History, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

No information could be found except to say that this bird follows the general bird development stages of starting in an egg, hatching, and then maturing in the nest with its parents (Nova Scotia Museum of Natural History, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

We do not have information on lifespan/longevity for this species at this time.

Average lifespan

Status: wild:
95 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

We do not have information on lifespan/longevity for this species at this time.

Average lifespan

Status: wild:
95 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg laying occurs early to mid-June at northern end of range. Clutch size 2-7 (commonly 4). One brood annually at higher latitudes and elevations, 2 or possibly 3 at lower ones. Incubation 10-14 days, by female. Young tended by both parents, leave nest at 9-12 days. No accurate estimates of longevity/generation time; mean time between banding and recovery for birds banded as first-year birds is 2.6 years (Beason 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

To attract a female and mark his reproductive territory, the male horned lark will engage in a "song flight" (Cornell Laboratory of Ornithology, 2001). He flies quickly up to eight hundred feet above the ground, and circles for several minutes. While circling, he sings. After hovering, he dives straight toward the ground with his wings closed. Just before reaching the ground, he opens his wings, catches air and lands softly in his territory. These birds are monogamous.

Mating System: monogamous

Breeding often occurs very early in the spring, but most E._alpestris begin breeding in June. The nests begin as shallow depressions in the ground and the female adds dry grass, plant down, and plant stems. The female builds her nests near stones or under small plants in open, sandy and/or barren areas. Small pebbles that act as a doorstep surround one side of the nest. The female lays 3 to 4 glossy eggs that range from gray to greenish white in color with light brown spots. Incubation lasts 10 to 14 days and the chicks fledge in 9 to 12 days. In warmer climates, successful parents can have two or three broods per year.

Breeding interval: Eremophila_alpestris breed yearly and can have up to three clutches in one season

Breeding season: Spring and Summer

Range eggs per season: 3 to 4.

Range time to hatching: 10 to 14 days.

Range fledging age: 9 to 12 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 4.

Both parents aid in caring for the altricial (helpless) young. The female usually lays three to four eggs and incubates them for ten to fourteen days; both the male and female feed the chicks after they hatch. The chicks are sometimes brooded. Young generally leave the nest within nine to twelve days of hatching, several days before they are able to fly. They continue to be fed by the parents for some time after fledging.

Parental Investment: no parental involvement; altricial ; pre-fertilization; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting); pre-independence (Provisioning: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

To attract a female and mark his reproductive territory, the male horned lark will engage in a "song flight" (Cornell Laboratory of Ornithology, 2001). He flies quickly up to eight hundred feet above the ground, and circles for several minutes. While circling, he sings. After hovering, he dives straight toward the ground with his wings closed. Just before reaching the ground, he opens his wings, catches air and lands softly in his territory. These birds are monogamous.

Mating System: monogamous

Breeding often occurs very early in the spring, but most E. alpestris begin breeding in June. The nests begin as shallow depressions in the ground and the female adds dry grass, plant down, and plant stems. The female builds her nests near stones or under small plants in open, sandy and/or barren areas. Small pebbles that act as a doorstep surround one side of the nest. The female lays 3 to 4 glossy eggs that range from gray to greenish white in color with light brown spots. Incubation lasts 10 to 14 days and the chicks fledge in 9 to 12 days. In warmer climates, successful parents can have two or three broods per year.

Breeding interval: Eremophila alpestris breed yearly and can have up to three clutches in one season

Breeding season: Spring and Summer

Range eggs per season: 3 to 4.

Range time to hatching: 10 to 14 days.

Range fledging age: 9 to 12 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 4.

Both parents aid in caring for the altricial (helpless) young. The female usually lays three to four eggs and incubates them for ten to fourteen days; both the male and female feed the chicks after they hatch. The chicks are sometimes brooded. Young generally leave the nest within nine to twelve days of hatching, several days before they are able to fly. They continue to be fed by the parents for some time after fledging.

Parental Investment: no parental involvement; altricial ; pre-fertilization; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting); pre-independence (Provisioning: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Eremophila alpestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eremophila alpestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACACTTTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGTACAGCCCTAAGCCTTCTCATCCGAGCAGAACTAGGCCAACCCGGCGCCCTGCTAGGAGACGACCAAATCTACAACGTAATCGTCACAGCCCACGCCTTCGTAATAATCTTTTTTATAGTTATACCAATTATAATCGGAGGTTTCGGTAACTGACTAGTACCTCTAATAATCGGGGCCCCAGATATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTACCCCCATCCTTCCTCCTCCTTCTAGCCTCCTCCACAGTCGAAACAGGCGCAGGAACAGGTTGAACCGTGTACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGCGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACCTGGCAGGTATCTCATCAATCCTAGGGGCCATCAACTTCATCACCACAGCCATCAACATAAAACCCCCAGCCCTATCCCAATATCAAACCCCTCTATTCGTTTGATCAGTCCTAATCACCGCCGTACTTCTACTTCTTTCCCTCCCCGTACTAGCTGCCGGCATCACCATGCTACTTACCGACCGCAACCTCAATACTACCTTCTTCGACCCCGCAGGCGGAGGAGACCCAATCCTCTACCAACATCTATTCTGATTTTTCGGCCACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Due to increases in the development of clear prairies and grasslands, populations of E._alpestris are declining. Humans play both a positive and negative role in the conservation of this species: they develop unused land, which eliminates habitat space, and they create large fields for grazing animals and crops, which the birds thrive in. Many times, after natural disasters such as fires, forests grow where open grassland used to be, this forces the birds to find new areas to inhabit. The conservation of open land is vital to the survival and successful breeding of this bird. There was no record of this species on the U.S. ESA Threatened and Endangered Species list or CITES. Horned larks are protected by the US Migratory Bird Treaty Act.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Due to increases in the development of clear prairies and grasslands, populations of E. alpestris are declining. Humans play both a positive and negative role in the conservation of this species: they develop unused land, which eliminates habitat space, and they create large fields for grazing animals and crops, which the birds thrive in. Many times, after natural disasters such as fires, forests grow where open grassland used to be, this forces the birds to find new areas to inhabit. The conservation of open land is vital to the survival and successful breeding of this bird. There was no record of this species on the U.S. ESA Threatened and Endangered Species list or CITES. Horned larks are protected by the US Migratory Bird Treaty Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.140,000,000 individuals (Rich et al. 2004), while national population sizes have been estimated at c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.50-1,000 wintering individuals in China and < c.1,000 individuals on migration and < c.1,000 wintering individuals in Japan (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of E._alpestris on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

As an insectivore E._alpestris can help control insect pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse affects of E. alpestris on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

As an insectivore E. alpestris can help control insect pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Horned lark

The horned lark (Eremophila alpestris), called the shore lark in Europe, is a species of bird in the genus Eremophila.

Description[edit]

Unlike most other larks, this is a distinctive-looking species on the ground, mainly brown-grey above and pale below, with a striking black and yellow face pattern. Except for the central feathers, the tail is mostly black, contrasting with the paler body; this contrast is especially noticeable when the bird is in flight. The summer male has black "horns", which give this species its American name. America has a number of races distinguished by the face pattern and back colour of males, especially in summer. The southern European mountain race Eremophila alpestris penicillata is greyer above, and the yellow of the face pattern is replaced with white.

Vocalizations are high-pitched, lisping or tinkling, and weak. The song, given in flight as is common among larks, consists of a few chips followed by a warbling, ascending trill.

Distribution and habitat[edit]

The horned lark breeds across much of North America from the high Arctic south to the Isthmus of Tehuantepec, northernmost Europe and Asia and in the mountains of south-east Europe. There is also an isolated population on a plateau in Colombia. It is mainly resident in the south of its range, but northern populations of this passerine bird are migratory, moving further south in winter.

This is a bird of open ground. In Eurasia it breeds above the tree line in mountains and the far north. In most of Europe, it is most often seen on seashore flats in winter, leading to the European name. In the UK it can be found as a winter stopover along the coasts and in eastern England although a mated pair have been recently spotted in Windmill End nature reserve in the West Midlands. In America, where there are no other larks to compete with, it is also found on farmland, on prairies, in deserts, on golf courses and airports, and the like.

Behaviour[edit]

Breeding[edit]

The nest is on the ground, with two to five eggs being laid. Food is seeds supplemented with insects in the breeding season. The nest may be near corn or soybeans for a source of food, and the female chooses the site.

Status and conservation[edit]

Streaked horned lark
Conservation status
Scientific classification
Subspecies:E. a. strigata

In the open areas of western North America, horned larks are among the bird species most often killed by wind turbines.[3] In 2013, the U.S. Fish and Wildlife Service listed the subspecies streaked horned lark (Eremophila alpestris strigata) as threatened under the Endangered Species Act.[2]

References[edit]

  1. ^ BirdLife International (2012). "Eremophila alpestris". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b "Species Fact Sheet: Streaked horned lark". U.S. Fish and Wildlife Service. 2014-08-05. Retrieved 2014-08-19. 
  3. ^ Erickson, W.P., G. D. Johnson, D. P. Young, Jr., M. D. Strickland, R.E. Good, M.Bourassa, K. Bay. 2002. Synthesis and Comparison of Baseline Avian and Bat Use, Raptor Nesting and Mortality Information from Proposed and Existing Wind Developments. Technical Report prepared for Bonneville Power Administration, Portland, Oregon. http://www.bpa.gov/Power/pgc/wind/Avian_and_Bat_Study_12-2002.pdf

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Composed of two groups: alpestris of North and South America and Eurasia and teleschowi (Przewalski's Lark) of China (AOU 1998). Horned Lark subspecies and patterns of geographic variation are in need of review (see Beason 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!