Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Brief Summary

The Great Gray Owl (Strix nebulosa) is a very large nocturnal bird of northern (mainly coniferous) forests and wooded bogs as well as some high mountain meadows in western North America. Great Gray Owls are resident across much of boreal Canada and Alaska and in Eurasia from northern Scandinavia, northern Russia, and northern Siberia south to central Russia, northern Mongolia, and northern Manchuria., Amurland, and Sakhalin. where they are most often found near bogs, along forest edges overlooking fields, in mountain meadows, and around cultivated land, airports, and roadsides.



The Great Gray Owl is distinctly larger than the Great Horned Owl and Snowy Owl and much larger than the Barred Owl (although a surprising proportion of its bulk consists of feathers rather than bones and muscle). Its flat face is punctuated by small yellow eyes surrounded by concentric rings. Although Great Gray Owls are most active at dawn, at dusk, and at night, they hunt during daylight in summer (and in winter if food-stressed), although still generally near dawn or dusk. Wingbeats are deep and slow. Both sexes produce a call consisting of 5 to 10 very quiet (typically inaudible beyond 400 m) evenly spaced deep hoots at a rate of around one per second.

The diet of the Great Gray Owl consists mainly of small mammals, especially Microtus voles. These owls can detect prey under snow by sound and can plunge and break through snow crust hard enough to support 80 kg and as deep as 45 cm. Small mammals are swallowed whole and larger prey are pulled apart. Abandoned nests of other large bird such as Goshawks, Ravens, or Ospreys 10 to 50 feet above the ground are the most common nest sites, although these owls may sometimes nest on top of broken tree trunks and, rarely, on the ground; nests may be reused for several years. Typical clutch size is 2 to 5 eggs (clutch size may be larger in years with abundant food). Incubation (for 28 to 36 days) is by the female only, but the male brings food to the incubating female on nest. The female broods young for their first 2 to 3 weeks. In some areas, the adult female departs after young fledge while the male remains and feeds them for up to 3 months. In some winters, large numbers of Great Gray Owls may move south or southeast into eastern Canada and the extreme northeastern United States in North America and northern Germany and Ukraine in Europe (apparently in response to a sudden drop of rodent population). Great Gray Owls may live more than 20 years.

(Kaufman 1996; Dunne 2006; Svensson 2009; AOU 1998; Holt et al. 1999 and references therein)

  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
  • Dunne, P. 2006. Pete Dunne’s Essential Field Guide Companion. Houghton Mifflin, Boston.
  • Svensson, L. 2009. Birds of Europe, 2nd edition. Princeton University Press, Princeton, New Jersey.
  • American Ornithologists’ Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists’ Union, Washington, D.C.
  • Holt, D.W., R. Berkley, C. Deppe, P.L.Enríquez Rocha, J.L. Petersen, J.L. Rangel Salazar, K.P. Segars, and K.L. Wood. 1999. Great Grey Owl. Pp. 203-204 in: del Hoyo, J., A. Elliott, and J. Sargatal, eds. Handbook of the Birds of the World. Vol. 5. Barn-owls to Hummingbirds. Lynx Edicions, Barcelona.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: central Alaska to northern Ontario, south locally in mountains to California (vicinity of Yosemite), Idaho, Montana, Wyoming, central Saskatchewan, northern Minnesota, and south-central Ontario. WINTERS: generally throughout breeding range, wandering south irregularly to northern U.S. Also in Old World. Usually uncommon, but sometimes may be locally abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The great gray owl is a native, permanent resident of the boreal forests of North America and Eurasia [27,53,59,75]. Strix nebulosa nebulosa inhabits North America and S. n. lapponica inhabits Eurasia [27,53]. Bird Web provides a distributional map of the great gray owl in North America, as well as photos.

The great gray owl is unevenly distributed and variable throughout its North American range [27]. Information on population status is currently lacking in many geographic areas [11,22,38,53].

The known breeding range in North America is from the boreal forests of Alaska east to Ontario and south to northern Minnesota and Wisconsin [3,4,28,53]. Great gray owls also breed in northern Idaho, western Montana, northwestern Wyoming [3,48], northeastern Utah [3,28], west-central Nevada [53], and the Sierra Nevada [3,48].

The wintering range is generally the same as the breeding range, except for a tendency for great gray owls to wander south in search of prey [27,68,100]. Great gray owls may wander to southern Canada, [4,69], New England, New York, and northern Michigan [69].

The following lists are speculative and are based on the habitat characteristics and species composition of communities great gray owls are known to occupy. There is not conclusive evidence that great gray owls occur in all the habitat types listed, and some community types, especially those used rarely, may have been omitted. See Preferred Habitat for more detail.

  • 3. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 22. Bull, Evelyn L. 1989. Great gray owl (Strix nebulosa). In: Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; Genter, David L.; Groves, Craig, eds. Rare, sensitive, and threatened species of the Greater Yellowstone ecosystem. Jackson, WY: Northern Rockies Conservation Cooperative: 82-83. [64871]
  • 27. Bull, Evelyn L.; Duncan, James R. 1993. Great gray owl--Strix nebulosa. In: Poole, A.; Gill, F., eds. The birds of North America. No. 41. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-16. [25650]
  • 28. Bull, Evelyn L.; Henjum, Mark G. 1990. Ecology of the great gray owl. Gen. Tech. Rep. PNW-GTR-265. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 39 p. [15228]
  • 38. Duncan, James R. 1997. Great gray owls (Strix nebulosa nebulosa) and forest management in North America: a review and recommendations. Journal of Raptor Research. 31(2): 160-166. [64898]
  • 53. Hayward, Gregory D.; Verner, Jon, tech. eds. 1994. Flammulated, boreal, and great gray owls in the United States: a technical conservation assessment. Gen. Tech. Rep. RM-253. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 213 p. [24608]
  • 59. Johnsgard, Paul A. 1988. North American owls. Washington, DC: Smithsonian Institute Press. 295 p. [23301]
  • 68. Marti, Carl D. 1986. The owls of Utah. Utah Birds. 2(4): 81-94. [64885]
  • 69. Master, Lawrence L. 1979. Some observations on great gray owls and their prey in Michigan. The Jack-Pine Warbler. 57(4): 215-217. [64892]
  • 75. Norberg, R. Ake. 1987. Evolution, structure, and ecology of northern forest owls. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 9-43. [24599]
  • 100. Voous, K. H. 1989. Owls of the northern hemisphere. London: William Collins Sons and Company, LTD. 320 p. [25638]
  • 4. American Ornithologists' Union. 2007. The A.O.U. check-list of North American birds, 7th edition, [Online]. American Ornithologists' Union (Producer). Available: http://www.aou.org/checklist/index.php3. [50863]
  • 11. Atkinson, Eric. 1989. Great gray owl (Strix nebulosa) surveys on the Payette National Forest. [WR 223]. Boise, ID: Idaho Department of Fish and Game. 22 p. [+ appendices]. [64870]
  • 48. Groves, Craig; Zehntner, Elaine. 1990. Distribution and status of great gray owls (Strix nebulosa) on the Targhee National Forest, 1989. [Purchase Order No. 40-02S0-9-0690]. Boise, ID: Idaho Department of Fish and Game; St. Anthony, ID: U.S. Department of Agriculture, Forest Service, Targhee National Forest. 31 p. [+ appendices]. [64869]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

States or Provinces

(key to state/province abbreviations)
UNITED STATES
AK CA ID MN MT NV OR UT WA WI
WY

CANADA
AB BC MB NT NS ON PQ SK YK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

BLM PHYSIOGRAPHIC REGIONS [17]:

2 Cascade Mountains

4 Sierra Mountains

5 Columbia Plateau

6 Upper Basin and Range

8 Northern Rocky Mountains

9 Middle Rocky Mountains

10 Wyoming Basin
  • 17. Bernard, Stephen R.; Brown, Kenneth F. 1977. Distribution of mammals, reptiles, and amphibians by BLM physiographic regions and A.W. Kuchler's associations for the eleven western states. Tech. Note 301. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 169 p. [434]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Strix nebulosa resides in Alaska, Canada, the higher elevations of the Rocky Mountain States, northern Minnesota and northern Wisconsin. Also, S. nebulosa breeds from northern Yukon to northern Manitoba and northern Ontario, south locally to central California, northern Idaho, northwestern Wyoming, central Saskatchewan, northern Minnesota, and south central Ontario. Winters generally through the breeding range, wandering south irregularly to the northern tier of States. It also occurs widely across Europe and Asia. (Osborne 2001, UNEP World Conservation Monitoring Center 2001).

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Great Gray Owl is the tallest owl in Alaska standing at a length 24-33 inches high, with a wing span of 54-60 inches, depending on degree of maturity. Strix nebulosa is larger and grayer than other owls and its round head does not have any ear tufts. Its bill and eyes yellow.

The owl has a distinctive facial disk, with two obvious gray concentric circles. The feathers of the disk help direct sounds toward the ear openings that are hidden by feathers. The owl also has an asymmetrical skull with large bony cups surrounding the ear openings.

In addition to the predominately gray plumage and distinctive facial disk, the bird has a black chin spot just above two white-feathered mustaches and it has a prominent white collar on the front of the neck. Ventrally, the owl is exhibits varying shades of dark and light grays, browns, and white. The dorsal side has a little less white than the ventral side. The tail is long and extends beyond the folded wings.

Adaptations for hunting include the facial disk, soft feathers so flight is silent, and the ability to turn its head three quarters of a circle (270 degrees).

(The Owl Pages; Compton's Encyclopedia 1998; MacBride Raptor Project 1997; Baetsen 2000; Wolf 2000).

Range mass: 790 to 1454 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 69 cm

Weight: 1298 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Dense coniferous and hardwood forest, especially pine, spruce, paper birch, poplar; also second growth, especially near water, foraging in wet meadows; boreal forest and spruce-tamarack bogs in far north, coniferous forest and meadows in mountains.

Nests in top of large broken-off tree trunks (especially in south), in old nests of other large birds (e.g., hawk nest) (especially in north), or in debris platforms from dwarf mistletoe; frequently near bogs or clearings. Nests frequently reused (Franklin 1988). Same pair often nests in same area in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: cover, forb

SRM (RANGELAND) COVER TYPES [89]:



108 Alpine Idaho fescue

109 Ponderosa pine shrubland

110 Ponderosa pine-grassland

213 Alpine grassland

215 Valley grassland

216 Montane meadows

409 Tall forb

410 Alpine rangeland

411 Aspen woodland

920 White spruce-paper birch
  • 89. Shiflet, Thomas N., ed. 1994. Rangeland cover types of the United States. Denver, CO: Society for Range Management. 152 p. [23362]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

SAF COVER TYPES [39]:

1 Jack pine

5 Balsam fir

12 Black spruce

13 Black spruce-tamarack

14 Northern pin oak

15 Red pine

16 Aspen

21 Eastern white pine

27 Sugar maple

38 Tamarack

39 Black ash-American elm-red maple

63 Cottonwood

107 White spruce

201 White spruce

202 White spruce-paper birch

203 Balsam poplar

204 Black spruce

205 Mountain hemlock

206 Engelmann spruce-subalpine fir

207 Red fir

210 Interior Douglas-fir

211 White fir

212 Western larch

213 Grand fir

215 Western white pine

17 Aspen

218 Lodgepole pine

224 Western hemlock

227 Western redcedar-western hemlock

228 Western redcedar

229 Pacific Douglas-fir

230 Douglas-fir-western hemlock

233 Oregon white oak

234 Douglas-fir-tanoak

237 Interior ponderosa pine

243 Sierra Nevada mixed conifer

244 Pacific ponderosa pine-Douglas-fir

245 Pacific ponderosa pine

246 California black oak

247 Jeffrey pine

251 White spruce-aspen

252 Paper birch

253 Black spruce-white spruce

254 Black spruce-paper birch

256 California mixed subalpine
  • 39. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: bog, shrub

KUCHLER [62] PLANT ASSOCIATIONS:

K002 Cedar-hemlock-Douglas-fir forest

K004 Fir-hemlock forest

K005 Mixed conifer forest

K007 Red fir forest

K008 Lodgepole pine-subalpine forest

K010 Ponderosa shrub forest

K011 Western ponderosa forest

K012 Douglas-fir forest

K013 Cedar-hemlock-pine forest

K014 Grand fir-Douglas-fir forest

K015 Western spruce-fir forest

K026 Oregon oakwoods

K028 Mosaic of K002 and K026

K030 California oakwoods

K052 Alpine meadows and barren

K093 Great Lakes spruce-fir forest

K094 Conifer bog

K095 Great Lakes pine forest

K098 Northern floodplain forest

K099 Maple-basswood forest

K101 Elm-ash forest

K106 Northern hardwoods

K107 Northern hardwoods-fir forest

K108 Northern hardwoods-spruce forest
  • 62. Kuchler, A. W. 1964. United States [Potential natural vegetation of the conterminous United States]. Special Publication No. 36. New York: American Geographical Society. 1:3,168,000; colored. [3455]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

ECOSYSTEMS [45]:

FRES10 White-red-jack pine

FRES11 Spruce-fir

FRES17 Elm-ash-cottonwood

FRES18 Maple-beech-birch

FRES19 Aspen-birch

FRES20 Douglas-fir

FRES21 Ponderosa pine

FRES22 Western white pine

FRES23 Fir-spruce

FRES24 Hemlock-Sitka spruce

FRES25 Larch

FRES26 Lodgepole pine

FRES28 Western hardwoods

FRES29 Sagebrush

FRES37 Mountain meadows

FRES40 Desert grasslands

FRES44 Alpine
  • 45. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. 1977. Vegetation and environmental features of forest and range ecosystems. Agric. Handb. 475. Washington, DC: U.S. Department of Agriculture, Forest Service. 68 p. [998]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

See lists above.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In North America, Strix nebulosa inhabits dense coniferous forests in Canada, and montane coniferous forests of the western States. It usually prefers pine and fir forests, rarely straying far out onto tundra barrens and muskeg marshes. Nests in mature poplar woodlands, well secluded from human activities, and in spruce stands with islands of tamarack. In winter, it may inhabit forests, sparse woodland edges bordering open fields, weedy fields with posts or scattered low trees or bushes, or brackish tidal meadows (Baetsen 2000; The Owl Pages).

Terrestrial Biomes: tundra ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Greater mobility exhibited in years when food scarce (Duncan 1987). Food scarcity or unavailability may cause post-breeding movement upslope and downslope movement in winter (California Department of Fish and Game 1990). May move several hundred km southward for winter; in some areas, longest movements made by immatures (but see ECOLCOM).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet in North America dominated by pocket gophers and voles. Forages usually in open area where scattered trees or forest margin provides suitable sites for visual searching; also uses sound to locate prey under snow cover.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Food supply may be a critical factor regulating the population size of the great gray owl [27].

Diet: Primary foods eaten are small mammals, especially rodents such as voles (Microtus spp. and Clethrionomys spp.), mice (Peromyscus spp.), and pocket gophers (Thomomys spp.) [22,23,37,40,43,46,77,100,106]. Other prey items include shrews (Soricidae) and birds [37]. When desperate for food, great gray owls may eat frogs (Ranidae, Hylidae) [74].

In California, the diet of the great gray owl shifts between microtine rodents and pocket gophers as prey abundance changes [106]. Even when pocket gophers are abundant, great gray owls will not breed in the absence of microtine rodents. This may be due to the difficulty of catching pocket gophers [106].

  • 22. Bull, Evelyn L. 1989. Great gray owl (Strix nebulosa). In: Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; Genter, David L.; Groves, Craig, eds. Rare, sensitive, and threatened species of the Greater Yellowstone ecosystem. Jackson, WY: Northern Rockies Conservation Cooperative: 82-83. [64871]
  • 23. Bull, Evelyn L.; Henjum, Mark G.; Rohweder, Ronald S. 1989. Reproduction and mortality of great gray owls in Oregon. Northwest Science. 63(1): 38-43. [64874]
  • 27. Bull, Evelyn L.; Duncan, James R. 1993. Great gray owl--Strix nebulosa. In: Poole, A.; Gill, F., eds. The birds of North America. No. 41. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-16. [25650]
  • 37. Duncan, James R. 1987. Movement strategies, mortality, and behavior of radio-marked great gray owls in southeastern Manitoba and northern Minnesota. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 101-107. [65581]
  • 40. Fetz, Trevor W.; Janes, Stewart W.; Lauchstedt, Heidi. 2003. Habitat characteristics of great gray owl sites in the Siskiyou Mountains of southeastern Oregon. Journal of Raptor Research. 37(4): 315-322. [64852]
  • 43. Franklin, Alan B. 1988. Breeding biology of the great gray owl in southeastern Idaho and northwestern Montana. The Condor. 90(3): 689-696. [64875]
  • 46. Goggans, Rebecca; Platt, Melissa. 1992. Breeding season observations of great gray owls on the Willamette National Forest, Oregon. Oregon Birds. 18(2): 35-41. [64864]
  • 74. Nero, Robert W. 1986. Great gray owls apparently feeding on frogs on roads at night. Blue Jay. 44(3): 189-190. [64884]
  • 77. Osborne, Timothy O. 1987. Biology of the great gray owl in interior Alaska. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 91-95. [17929]
  • 100. Voous, K. H. 1989. Owls of the northern hemisphere. London: William Collins Sons and Company, LTD. 320 p. [25638]
  • 106. Winter, Jon. 1986. Status, distribution and ecology of the great gray owl, (Strix nebulosa) in California. San Francisco, CA: San Francisco State University. 121 p. Thesis. [64886]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

In the wild, Strix nebulosa feeds primarily on small rodents such as voles and pocket gophers. Small rodents composed 80-90% percent of the diet while other mammals (mainly shrews) and birds composed the remainder (The Owl Pages).

The Great Gray Owl hunts by perching on a tree overlooking a meadow or open area. The owl's keen hearing enables it to accurately determine the location of its prey, even under two feet of snow or in tunnels. Once the owl locates some food, it silently glides from its perch and plunges into the snow to grab the rodent with its sharp talons. Fresh "plunge marks" will occasionally show an imprint of the owl's outstretched wing feathers where the owl dropped into the snow. In many areas these marks are often the only indication that Great Gray Owls are in the area (MacBride Raptor Project, Wolf 2000, Baetsen 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

Predators for adult great gray owls include common ravens, great horned owls [23,76,103], northern goshawks [23], broad-winged hawks, and American martens (Martes americana) [103]. Owlets may be killed by red-tailed hawks [28], American black bears (Ursus americanus) [37,76], fisher (Martes pennanti) [37,100], lynx (Lynx canadensis) [37], great horned owls [37], and golden eagles (Aquila chrysaetos) [100].

Other causes of mortality: At least 20% of adult great gray owl mortality is due to starvation during winter [100]. Collisions with vehicles and shooting by humans also cause mortality [103].

  • 23. Bull, Evelyn L.; Henjum, Mark G.; Rohweder, Ronald S. 1989. Reproduction and mortality of great gray owls in Oregon. Northwest Science. 63(1): 38-43. [64874]
  • 28. Bull, Evelyn L.; Henjum, Mark G. 1990. Ecology of the great gray owl. Gen. Tech. Rep. PNW-GTR-265. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 39 p. [15228]
  • 37. Duncan, James R. 1987. Movement strategies, mortality, and behavior of radio-marked great gray owls in southeastern Manitoba and northern Minnesota. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 101-107. [65581]
  • 76. Oeming, Albert F. 1955. A preliminary study of the great gray owl (Scotiaptex nubulosa nubulosa) (Forster) in Alberta with observations on some other species of owls. Edmonton, AB: University of Alberta. 129 p. Dissertation. [64894]
  • 100. Voous, K. H. 1989. Owls of the northern hemisphere. London: William Collins Sons and Company, LTD. 320 p. [25638]
  • 103. Whitfield, Michael B.; Gaffney, Maureen. 1997. Great gray owl (Strix nebulosa) breeding habitat use within altered forest landscapes. In: Duncan, James R.; Johnson, David H.; Nicholls, Thomas H., eds. Biology and conservation of owls of the Northern Hemisphere: 2nd international symposium: Proceedings; 1997 February 5-9; Winnipeg, MB. Gen. Tech. Rep. NC-190. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 498-505. [65576]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Strix nebulosa preys on:
Parascalops breweri
Microtus xanthognathus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Guesstimated number of breeding pairs in Canada in the early 1990s was 10,000-25,000 (Kirk et al. 1995). See Johnsgard (1988) for listing of recent status studies in Manitoba, Saskatchewan, California (about 10 breeding pairs, California Department of Fish and Game 1990), Wyoming, Idaho, and Oregon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Some may remain on breeding territory all year; others may move irregularly in search of favorable foraging conditions. In Oregon, radio-tagged juveniles moved 9-31 km from nest over period of 1 year, adults moved 3-43 km during same period (see Johnsgard 1988). Predation by great horned owl was greatest known mortality factor in northern Minnesota and southeastern Manitoba (Duncan 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, duff, fire exclusion, fire management, fire severity, graminoid, natural, prescribed fire, severity, stand-replacing fire, succession, tree, wildfire

As of this writing, no information is available on the effects of fire on the great gray owl. Despite the lack of information, some generalizations based on their habitat requirements may be possible. Following fire, modifications in the food supply and habitat of great gray owls may occur, as well as changes in the abundance of competitors and predators [85]. According to Finch and others [41], the effects of fire on birds and their habitat vary with: 1) the severity and extent of the fire; 2) temporal scales; 3) life history characteristics of the bird species; and 4) whether or not salvage logging occurs following fire. Severe fires alter the forest structure more than low-severity fires, and a stand-replacing fire may result in the replacement of a bird species with a different bird species. Large, severe fires may greatly alter bird habitat in the short term but be necessary for long-term maintenance of some forest types. Salvage logging may reduce the benefits of fire to birds that utilize snags for foraging and nesting [58]. Prior to European settlement, Native Americans managed forests that provided great gray owl habitat by frequent understory burning. With fire exclusion, habitat for the great gray owl has become less suitable due to decreased forest structure diversity and the encroachment of conifers into meadows [19].

Great gray owls require mature and old-growth forests for breeding and natural forest openings for foraging [21,22,22,51,52,57,63,72,93,106]. On the forest floor, downed woody material and tree stumps are used by adults for perching [28,29]. Leaning trees are needed by owlets for roosting and perching before they learn to fly [25,28,43] (see Preferred Habitat). The availability of nesting sites, perching sites, and foraging habitat are greatly affected by natural forest disturbances such as fire, succession, and disease outbreaks [38]. In the boreal mixed woodland on the plains of Alberta, habitat would probably not be suitable for 25 years after stand-replacing fire [87].

Fire may reduce conifer invasion in natural forest openings [51]. Golden eagles in the Appalachian Mountains stopped breeding after open habitats in the mountains, which were required for foraging, reverted to brush following fire exclusion [92]. Fire exclusion in great gray owl foraging habitat may have a similar effect.

The spotted owl and great gray owl share similar habitat requirements such as large trees, snags, closed canopies, and multiple forest layers. Fire management strategies for the spotted owl may apply to the great gray owl [98]. A fire management suggestion made by the US Department of the Interior, Fish and Wildlife Service [96] and Rapp [83] for spotted owls was to isolate nesting sites from adjoining forest at high risk for fire by creating a buffer zone around sites to reduce flammability. This should be done without compromising the nest site. Verner and others [98] suggest low-severity underburning in spotted owl habitat in the Sierra Nevada, minimizing the removal of duff and large woody debris.

Effects on prey: Rodents use dead woody material on the forest floor and in forest openings for cover [26,28] and may either be positively or negatively affected by fire, depending on fire severity [28,60]. Immediately following prescribed fire in meadows, the availability of prey species increases for the great gray owl due to the removal of grass layers used for cover [10,67]. After the availability of prey increases following fire, prey populations may decrease due to lack of cover [28].

Shrews, deer mice (Peromyscus maniculatus), creeping voles (Microtus oregoni), and Townsend's chipmunks (Neotamias townsendii) were absent to rare on severely burned sites but comprised most of the small-mammal community in unburned clearcuts. The study was conducted following the Oxbow Fire, a large (170 km²), mixed-severity wildfire in a Douglas-fir and mixed-conifer forest in western Oregon [104]. Rodent populations slowly after the fire, and population numbers were similar between burned and unburned areas by postfire year 7 [18]. Populations of pocket gophers (Thomomys talpoides and T. mazama) generally increase following stand-replacing fire [13], particularly in lodgepole pine/western needlegrass (Achnatherum occidentale) communities in central Oregon. This may be due to the abundance of long-stolon sedge (Carex inops), a rhizomatous, fleshy-rooted graminoid that increases 200% to 400% following burning [99].

The following table provides fire return intervals for plant communities and ecosystems where the great gray owl is important. For further information, see the FEIS review of the dominant plant species listed below.

Community or Ecosystem Dominant Species Fire Return Interval Range (years)
grand fir Abies grandis 35-200 [6]
maple-beech-birch Acer-Fagus-Betula spp. >1,000
sugar maple Acer saccharum >1,000
sugar maple-basswood Acer saccharum-Tilia americana >1,000
black ash Fraxinus nigra 101]
tamarack Larix laricina 35-200 [80]
western larch Larix occidentalis 25-350 [7,15,35]
Great Lakes spruce-fir Picea-Abies spp. 35 to >200 [36]
Engelmann spruce-subalpine fir Picea engelmannii-Abies lasiocarpa 35 to >200 [6]
black spruce Picea mariana 35-200
conifer bog* Picea mariana-Larix laricina 35-200 [36]
jack pine Pinus banksiana <35 to 200 [34,36]
Rocky Mountain lodgepole pine* Pinus contorta var. latifolia 25-340 [14,15,95]
Sierra lodgepole pine* Pinus contorta var. murrayana 35-200
Jeffrey pine Pinus jeffreyi 5-30
western white pine* Pinus monticola 50-200
Pacific ponderosa pine* Pinus ponderosa var. ponderosa 1-47 [6]
interior ponderosa pine* Pinus ponderosa var. scopulorum 2-30 [6,12,64]
red pine (Great Lakes region) Pinus resinosa 3-18 (x=3-10) [33,44]
red-white pine* (Great Lakes region) Pinus resinosa-P. strobus 3-200 [34,54,66]
eastern white pine Pinus strobus 35-200 [101]
eastern cottonwood Populus deltoides <35 to 200 [80]
aspen-birch Populus tremuloides-Betula papyrifera 35-200 [36,101]
quaking aspen (west of the Great Plains) Populus tremuloides 7-120 [6,49,70]
mountain grasslands Pseudoroegneria spicata 3-40 (x=10) [5,6]
Rocky Mountain Douglas-fir* Pseudotsuga menziesii var. glauca 25-100 [6,8,9]
coastal Douglas-fir* Pseudotsuga menziesii var. menziesii 40-240 [6,71,84]
California oakwoods Quercus spp. <35
Oregon white oak Quercus garryana <35 [6]
California black oak Quercus kelloggii 5-30 [80]
western redcedar-western hemlock Thuja plicata-Tsuga heterophylla >200
mountain hemlock* Tsuga mertensiana 35 to >200 [6]
*fire return interval varies widely; trends in variation are noted in the species review
  • 21. Bryan, Terry; Forsman, Eric D. 1987. Distribution, abundance, and habitat of great gray owls in southcentral Oregon. The Murrelet. 68(2): 45-49. [64900]
  • 22. Bull, Evelyn L. 1989. Great gray owl (Strix nebulosa). In: Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; Genter, David L.; Groves, Craig, eds. Rare, sensitive, and threatened species of the Greater Yellowstone ecosystem. Jackson, WY: Northern Rockies Conservation Cooperative: 82-83. [64871]
  • 28. Bull, Evelyn L.; Henjum, Mark G. 1990. Ecology of the great gray owl. Gen. Tech. Rep. PNW-GTR-265. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 39 p. [15228]
  • 29. Bull, Evelyn L.; Henjum, Mark G.; Anderson, Ralph G. 1987. Nest platforms for great gray owls. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 87-90. [65578]
  • 38. Duncan, James R. 1997. Great gray owls (Strix nebulosa nebulosa) and forest management in North America: a review and recommendations. Journal of Raptor Research. 31(2): 160-166. [64898]
  • 43. Franklin, Alan B. 1988. Breeding biology of the great gray owl in southeastern Idaho and northwestern Montana. The Condor. 90(3): 689-696. [64875]
  • 51. Habeck, James R. 1994. Dynamics of forest communities used by great gray owls. In: Hayward, Gregory D.; Verner, Jon, tech. eds. Flammulated, boreal, and great gray owls in the United States: a technical conservation assessment. Gen. Tech. Rep. RM-253. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 176-201. [27356]
  • 57. Hurt, Pat. 1984. Maintenance of old growth habitat through the Forest Planning Process. The Habitat Express No. 84-8. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Region. 8 p. [16493]
  • 83. Rapp, Valerie. 2005. Conserving old forest in landscapes shaped by fire. PNW Science Update. Issue 11. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 11 p. [55436]
  • 93. Stepnisky, D. P. 1997. Landscape features and characteristics of great gray owl (Srix nebulosa) nests in fragmented landscapes of central Alberta. In: Duncan, James R.; Johnson, David H.; Nicholls, Thomas H., eds. Biology and conservation of owls of the Northern Hemisphere: 2nd international symposium: Proceedings; 1997 February 5-9; Winnipeg, MB. Gen. Tech. Rep. NC-190. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 601-607. [65577]
  • 98. Verner, Jared; McKelvey, Kevin S.; Noon, Barry R; Gutierrez, R. J.; Gould, Gordon I., Jr.; Beck, Thomas W. 1992. Assessment of the current status of the California spotted owl, with recommendations for management. In: Verner, Jared; McKelvey, Kevin S.; Noon, Barry R.; Gutierrez, R. J.; Gould, Gordon I., Jr.; Beck, Thomas W., tech. coords. The California spotted owl: a technical assessment of its current status. Gen. Tech. Rep. PSW-GTR-133. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 3-26. [28195]
  • 106. Winter, Jon. 1986. Status, distribution and ecology of the great gray owl, (Strix nebulosa) in California. San Francisco, CA: San Francisco State University. 121 p. Thesis. [64886]
  • 8. Arno, Stephen F.; Gruell, George E. 1983. Fire history at the forest-grassland ecotone in southwestern Montana. Journal of Range Management. 36(3): 332-336. [342]
  • 9. Arno, Stephen F.; Scott, Joe H.; Hartwell, Michael G. 1995. Age-class structure of old growth ponderosa pine/Douglas-fir stands and its relationship to fire history. Res. Pap. INT-RP-481. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 25 p. [25928]
  • 36. Duchesne, Luc C.; Hawkes, Brad C. 2000. Fire in northern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 35-51. [36982]
  • 6. Arno, Stephen F. 2000. Fire in western forest ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 97-120. [36984]
  • 12. Baisan, Christopher H.; Swetnam, Thomas W. 1990. Fire history on a desert mountain range: Rincon Mountain Wilderness, Arizona, U.S.A. Canadian Journal of Forest Research. 20: 1559-1569. [14986]
  • 33. Clark, James S. 1990. Fire and climate change during the last 750 yr in northwestern Minnesota. Ecological Monographs. 60(2): 135-159. [11650]
  • 5. Arno, Stephen F. 1980. Forest fire history in the Northern Rockies. Journal of Forestry. 78(8): 460-465. [11990]
  • 54. Heinselman, Miron L. 1970. The natural role of fire in northern conifer forests. In: The role of fire in the Intermountain West: Symposium proceedings; 1970 October 27-29; Missoula, MT. Missoula, MT: Intermountain Fire Research Council: 30-41. In cooperation with: University of Montana, School of Forestry. [15735]
  • 101. Wade, Dale D.; Brock, Brent L.; Brose, Patrick H.; Grace, James B.; Hoch, Greg A.; Patterson, William A., III. 2000. Fire in eastern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-96. [36983]
  • 64. Laven, R. D.; Omi, P. N.; Wyant, J. G.; Pinkerton, A. S. 1980. Interpretation of fire scar data from a ponderosa pine ecosystem in the central Rocky Mountains, Colorado. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 46-49. [7183]
  • 84. Ripple, William J. 1994. Historic spatial patterns of old forests in western Oregon. Journal of Forestry. 92(11): 45-49. [33881]
  • 49. Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and ungulate browsing in Jackson Hole, Wyoming. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 33 p. In cooperation with: U.S. Department of the Interior, National Park Service, Rocky Mountain Region. [3862]
  • 80. Paysen, Timothy E.; Ansley, R. James; Brown, James K.; Gottfried, Gerald J.; Haase, Sally M.; Harrington, Michael G.; Narog, Marcia G.; Sackett, Stephen S.; Wilson, Ruth C. 2000. Fire in western shrubland, woodland, and grassland ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 121-159. [36978]
  • 7. Arno, Stephen F.; Fischer, William C. 1995. Larix occidentalis--fire ecology and fire management. In: Schmidt, Wyman C.; McDonald, Kathy J., compilers. Ecology and management of Larix forests: a look ahead: Proceedings of an international symposium; 1992 October 5-9; Whitefish, MT. Gen. Tech. Rep. GTR-INT-319. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 130-135. [25293]
  • 58. Hutto, Richard L. 1995. Composition of bird communities following stand-replacement fires in northern Rocky Mountain (U.S.A.) conifer forests. Conservation Biology. 9(5): 1041-1058. [26003]
  • 10. Artman, Vanessa L.; Sutherland, Elaine K.; Downhower, Jerry F. 2001. Prescribed burning to restore mixed-oak communities in southern Ohio: effects on breeding bird populations. Conservation Biology. 15(5): 1423-1434. [42055]
  • 13. Barnes, Victor G., Jr. 1974. Response of pocket gopher populations to silvicultural practices in central Oregon. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 167-175. [8004]
  • 18. Black, H. C.; Hooven, E. H. 1974. Response of small-mammal communities to habitat changes in western Oregon. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 177-186. [8005]
  • 19. Bonnicksen, Thomas M.; Anderson, M. Kat; Lewis, Henry T.; Kay, Charles E.; Dnudson, Ruthann. 1999. Native American influences on the development of forest ecosystems. In: Szaro, R. C.; Johnson, N. C.; Sexton, W. T.; Malk, A. J., eds. Ecological stewardship: A common reference for ecosystem management. Vol. 2. Oxford, UK: Elsevier Science Ltd: 439-470. [37072]
  • 25. Bull, Evelyn L.; Henjum, Mark G.; Rohweder, Ronald S. 1988. Nesting and foraging habitat of great gray owls. Journal of Raptor Research. 22(4): 107-115. [64879]
  • 26. Bull, Evelyn L.; Blumton, Arlene K. 1999. Effect of fuels reduction on American martens and their prey. Res. Note RNW-RN-539. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 9 p. [30825]
  • 35. Davis, Kathleen M. 1980. Fire history of a western larch/Douglas-fir forest type in northwestern Montana. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 69-74. [12813]
  • 41. Finch, Deborah M.; Ganey, Joseph L.; Yong, Wang; Kimball, Rebecca T.; Sallabanks, Rex. 1997. Effects and interactions of fire, logging, and grazing. In: Block, William M.; Finch, Deborah M., tech. eds. Songbird ecology in southwestern ponderosa pine forests: a literature review. Gen. Tech. Rep. RM-GTR-292. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 103-136. [27990]
  • 44. Frissell, Sidney S., Jr. 1968. A fire chronology for Itasca State Park, Minnesota. Minnesota Forestry Research Notes No. 196. St. Paul, MN: University of Minnesota. 2 p. [34527]
  • 52. Hayward, Gregory D. 1994. Conservation status of great gray owls in the United States. In: Hayward, Gregory D.; Verner, Jon, tech. eds. Flammulated, boreal, and great gray owls in the United States: a technical conservation assessment. Gen. Tech. Rep. RM-253. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 202-206. [27357]
  • 60. Kayll, A. J. 1968. The role of fire in the boreal forest of Canada. Information Report PS-X-7. Chalk River, ON: Department of Forestry and Rural Development of Canada, Petawawa Forest Experiment Station. 15 p. [24962]
  • 63. Larrison, Earl J. 1981. Birds of the Pacific Northwest: Washington, Oregon, Idaho, and British Columbia. A Northwest Naturalist Book. Moscow, ID: University Press of Idaho. 337 p. [61134]
  • 66. Loope, Walter L. 1991. Interrelationships of fire history, land use history, and landscape pattern within Pictured Rocks National Seashore, Michigan. The Canadian Field-Naturalist. 105(1): 18-28. [5950]
  • 67. Lyon, L. Jack; Huff, Mark H.; Telfer, Edmund S.; Schreiner, David Scott; Smith, Jane Kapler. 2000. Fire effects on animal populations. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 25-34. [44436]
  • 70. Meinecke, E. P. 1929. Quaking aspen: A study in applied forest pathology. Tech. Bull. No. 155. Washington, DC: U.S. Department of Agriculture. 34 p. [26669]
  • 71. Morrison, Peter H.; Swanson, Frederick J. 1990. Fire history and pattern in a Cascade Range landscape. Gen. Tech. Rep. PNW-GTR-254. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 77 p. [13074]
  • 85. Rotenberry, John T.; Cooper, Robert J.; Wunderle, Joseph M.; Smith, Kimberly G. 1995. When and how are populations limited? The roles of insect outbreaks, fire, and other natural perturbations. In: Ecology and management of neotropical migratory birds: A synthesis and review of critical issues. New York: Oxford University Press: 55-84. [26801]
  • 87. Schieck, Jim; Lertzman, Ken; Nyberg, Brian; Page, Rick. 1995. Effects of patch size on birds in old-growth montane forests. Conservation Biology. 9(5): 1072-1084. [26013]
  • 92. Spofford, Walter R. 1971. The golden eagle--rediscovered. Conservationist. 26(1): 6-8. [22516]
  • 95. Tande, Gerald F. 1979. Fire history and vegetation pattern of coniferous forests in Jasper National Park, Alberta. Canadian Journal of Botany. 57: 1912-1931. [18676]
  • 96. U.S. Department of the Interior, Fish and Wildlife Service. 1995. Recovery plan for the Mexican spotted owl: Vols. 1-2. Albuquerque, NM: U. S. Department of the Interior, Fish and Wildlife Service. 370 p. [27998]
  • 99. Volland, Leonard A. 1974. Relation of pocket gophers to plant communities in the pine region of central Oregon. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 149-166. [8003]
  • 104. Wimberly, Michael C.; Ohmann, Janet L. 2004. A multi-scale assessment of human and environmental constraints on forest land cover change on the Oregon (USA) coast range. Landscape Ecology. 19: 631-646. [65876]
  • 14. Barrett, Stephen W. 1993. FIRE REGIMES on the Clearwater and Nez Perce National Forests north-central Idaho. Final Report: Order No. 43-0276-3-0112. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 21 p. [41883]
  • 15. Barrett, Stephen W.; Arno, Stephen F.; Key, Carl H. 1991. FIRE REGIMES of western larch - lodgepole pine forests in Glacier National Park, Montana. Canadian Journal of Forest Research. 21: 1711-1720. [17290]
  • 34. Cleland, David T.; Crow, Thomas R.; Saunders, Sari C.; Dickmann, Donald I.; Maclean, Ann L.; Jordan, James K.; Watson, Richard L.; Sloan, Alyssa M.; Brosofske, Kimberley D. 2004. Characterizing historical and modern FIRE REGIMES in Michigan (USA): a landscape ecosystem approach. Landscape Ecology. 19: 311-325. [54326]
  • 72. Munther, Greg; Diebert, Jerry; Hillis, Mike. 1978. Some wildlife and fisheries Habitat management concepts. Forest Workshops; 1978 May 3-4; [Location of workshops unknown]. Missoula, MT: U.S. Department of Agriculture, Forest Service, Lolo National Forest. 66 p. [17163]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: formation, nidicolous, presence

Migration: Great gray owls may be resident or seminomadic, depending on the availability of rodent prey [59,68,69,100]. They may move to low elevations during winter to avoid hunting in deep snow [43].

Mating: Great gray owls are generally not monogamous; however, pair bonds may be maintained in boreal forests if prey populations remain high over subsequent years [37]. Great gray owls probably first breed when 3 years old [22,23]. Pair formation begins in January and extends as late as 2 weeks before egg-laying in April and May [43].

Nesting: Nesting chronology data for the great gray owl are meager. Timing of egg laying may depend on the availability of rodent prey and habitat quality [100]. Egg laying may be delayed during years of heavy snow [43]. In California, great gray owls nest in April [106]. Egg laying occurs in April and May in southeastern Idaho and northwestern Wyoming [43]. In northern Alberta, the earliest egg-laying date was 23 March, but most eggs were laid by 15 April [76].

Eggs are laid at 1- to 3-day intervals [27]. Clutch size ranges from 2 to 5 eggs, and 3-egg clutches are most typical [76]. Average clutch size was 2.67 (n=6) eggs in the Targhee National Forest, Idaho [103] and 2.3 eggs (n=64, SD=0.87) in northeastern Oregon [23].

Incubation is performed only by the female [27,76], and brooding lasts 2 to 3 weeks [27,76]. Brooding lasted an average of 29.7 days in southeastern Idaho and northwestern Wyoming [43].

Development: Great gray owls are semiprecocial and nidicolous [27]. Adults may sometimes favor their smaller or weaker offspring [23].

Fledging: Young leave the nest 26 days [23] to 28.5 days [43] after hatching. Owlets learn to fly 7 to 14 days after leaving the nest. Before learning to fly, they climb leaning trees using their talons, wings, and bills, and roost off of the ground [28,43]. Females continue protecting their young after fledging and males bring prey items. Males may extend fledgling care longer than females. In Oregon, females abandoned their young between 3 and 6 weeks after fledging, but males provided care for up to 3 months after fledging [28]. Young are independent by late summer and leave the natal site in fall and winter. Maximum dispersal distance of radio-tagged juvenile great gray owls from their natal site in Oregon ranged from 4.7 to 19.9 miles (7.5-32.0 km) [24].

Survival: The survival of young depends on the availability of leaning and deformed trees as well as the presence of forested habitat within a 1,640- foot (500 m) radius around the nest for roosting and avoiding prey [43]. Owlets have a 63% chance surviving from the egg to the flight stage [43]. In northeastern Oregon, the probabilities of juveniles surviving to the following ages were: 12 months old=0.53; 18 months old=0.39; and 24 months old=0.31 (n=32). Mortality was due to starvation, falling from the nest [28], or predation) [23]. Survival rates are high if juveniles survive to breeding age [28].

Home range: The home range of 5 nesting males in northeastern Oregon averaged 4.5 km² (range 1.3-6.5 km²) [24].

  • 22. Bull, Evelyn L. 1989. Great gray owl (Strix nebulosa). In: Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; Genter, David L.; Groves, Craig, eds. Rare, sensitive, and threatened species of the Greater Yellowstone ecosystem. Jackson, WY: Northern Rockies Conservation Cooperative: 82-83. [64871]
  • 23. Bull, Evelyn L.; Henjum, Mark G.; Rohweder, Ronald S. 1989. Reproduction and mortality of great gray owls in Oregon. Northwest Science. 63(1): 38-43. [64874]
  • 24. Bull, Evelyn L.; Henjum, Mark G.; Rohweder, Ronald S. 1988. Home range and dispersal of great gray owls in northeastern Oregon. Journal of Raptor Research. 22(4): 101-106. [64877]
  • 27. Bull, Evelyn L.; Duncan, James R. 1993. Great gray owl--Strix nebulosa. In: Poole, A.; Gill, F., eds. The birds of North America. No. 41. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-16. [25650]
  • 28. Bull, Evelyn L.; Henjum, Mark G. 1990. Ecology of the great gray owl. Gen. Tech. Rep. PNW-GTR-265. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 39 p. [15228]
  • 37. Duncan, James R. 1987. Movement strategies, mortality, and behavior of radio-marked great gray owls in southeastern Manitoba and northern Minnesota. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 101-107. [65581]
  • 43. Franklin, Alan B. 1988. Breeding biology of the great gray owl in southeastern Idaho and northwestern Montana. The Condor. 90(3): 689-696. [64875]
  • 59. Johnsgard, Paul A. 1988. North American owls. Washington, DC: Smithsonian Institute Press. 295 p. [23301]
  • 68. Marti, Carl D. 1986. The owls of Utah. Utah Birds. 2(4): 81-94. [64885]
  • 69. Master, Lawrence L. 1979. Some observations on great gray owls and their prey in Michigan. The Jack-Pine Warbler. 57(4): 215-217. [64892]
  • 76. Oeming, Albert F. 1955. A preliminary study of the great gray owl (Scotiaptex nubulosa nubulosa) (Forster) in Alberta with observations on some other species of owls. Edmonton, AB: University of Alberta. 129 p. Dissertation. [64894]
  • 100. Voous, K. H. 1989. Owls of the northern hemisphere. London: William Collins Sons and Company, LTD. 320 p. [25638]
  • 103. Whitfield, Michael B.; Gaffney, Maureen. 1997. Great gray owl (Strix nebulosa) breeding habitat use within altered forest landscapes. In: Duncan, James R.; Johnson, David H.; Nicholls, Thomas H., eds. Biology and conservation of owls of the Northern Hemisphere: 2nd international symposium: Proceedings; 1997 February 5-9; Winnipeg, MB. Gen. Tech. Rep. NC-190. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 498-505. [65576]
  • 106. Winter, Jon. 1986. Status, distribution and ecology of the great gray owl, (Strix nebulosa) in California. San Francisco, CA: San Francisco State University. 121 p. Thesis. [64886]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

As of 2007, no research directly investigated great gray owl mortality due to fire. The direct impact of fire on birds is a function of the bird's size and mobility as well as the characteristics of the fire. Fire may kill great gray owls [79], but mortality is generally minor for adult birds of most species [65,85]. Mortality of nestlings or fledglings is possible if fires occur during the breeding season, so adult birds may experience reduced reproduction rates [79]. Severe fires may result in proportionately greater mortality [82].
  • 65. Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire exclusion and fire management on raptor habitats in the western United States. In: Pendleton, B. G., ed. Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 236-244. [22324]
  • 79. Patton, David R.; Gordon, Janet. 1995. Fire, habitats, and wildlife. Final report. Flagstaff, AZ: U.S. Department of Agriculture, Forest Service, Coconino National Forest. 85 p. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [61019]
  • 82. Quinn, Ronald D. 1979. Effects of fire on small mammals in the chaparral. Cal-Neva Wildlife Transactions: 125-133. [5984]
  • 85. Rotenberry, John T.; Cooper, Robert J.; Wunderle, Joseph M.; Smith, Kimberly G. 1995. When and how are populations limited? The roles of insect outbreaks, fire, and other natural perturbations. In: Ecology and management of neotropical migratory birds: A synthesis and review of critical issues. New York: Oxford University Press: 55-84. [26801]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: In winter, hunts primarily in early morning and from late afternoon until dusk. When nesting, may hunt day or night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
153 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg dates: late March-May in Alberta, late April-early June in Ontario, peak mid-April to late May in California, mean date of first egg 5 May in southern Idaho and northwestern Wyoming; eggs laying may be delayed in years with deep snow (Franklin 1988). Clutch size is 2-5 (usually 2-3 or 3-4). Incubation lasts 28-29 days, by female (male brings food). Young begin to leave nest at 3-4 weeks (4 weeks in Idaho/Wyoming), fly well at 5-6 weeks (6 weeks in Idaho/Wyoming), independent at about 4-5 months (Idaho/Wyoming: Franklin 1988). Usually first breeds at 3-4 years. Pair bond is not maintained outside breeding season, but bond may reform if both birds return to the same breeding territory. Some pairs may not breed in years of low prey abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding takes place in late winter with the pair generally utilizing an abandoned hawk or crow's nest. The female Strix nebulosa lays eggs in March- June, depending on temperature range (egg laying may be delayed in deep snow years). Two to five dull white oval eggs are laid and are incubated by the female Strix nebulosa for a period of 28-29 days. The owlets hatch covered by soft white down with their eyes open. Both parents feed the young by bringing food to the nest, tearing into very small pieces that are eagerly consumed by the little ones. Soon the down begins to disappear and is replaced by feathers. Once the owlets are 'feathered out' they begin the pre-flight exercises. They can be observed walking around the top of their nest flapping their wings and gripping the nest edge with their talons. Young leave nest after three to four weeks with the ability to climb well. (The Owl Pages).

Average time to hatching: 30 days.

Average eggs per season: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Strix nebulosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Strix nebulosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGACATTGGCACCCTCTATCTAGTCTTTGGCACATGAGCTGGCATAGTCGGCACTGCCCTTAGCCTACTCATCCGAGCCGAACTAGGCCAACCCGGAACACTCCTAGGTGACGACCAAATCTACAATGTAATCGTTACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATACCCATCATGATCGGGGGATTTGGAAACTGACTAGTTCCCCTAATAATTGGAGCCCCAGATATGGCCTTTCCCCGTATAAATAACATAAGCTTTTGACTCCTCCCACCCTCATTCCTACTCCTACTAGCCTCCTCCACAGTAGAGGCCGGAGCAGGCACCGGATGAACCGTCTACCCCCCACTAGCCAGCAACCTAGCCCACGCTGGAGCCTCGGTAGACCTGGCCATCTTTTCCCTCCACCTAGCCGGAGTGTCATCCATCCTAGGGGCAATCAACTTCATCACCACTGCCATCAACATAAAACCCCCATCTCTATCGCAATACCAAACCCCTCTATTTGTATGATCCGTCCTCATCACTGCCATTCTCCTACTCCTGTCCCTCCCAGTCCTCGCTGCAGGCATCACAATACTACTAACTGACCGCAACCTAAATACCACATTCTTCGACCCCGCTGGCGGCGGCGATCCAGTCCTATACCAACACCTCTTCTGATTCTTTGGACACCCAGAAGTCTACATCCTCATCCTACCAGGATTTGGAATTATCTCCCACGTAAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large circumboreal range; no decline is evident in the vast majority of the range, but few data are available for most areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The U. S. Department of Interior Bureau of Land Management considers Strix nebulosa to be a sensitive species, and it is protected in the United States on both federal and state levels. It has been the subject of extensive management studies (Huff et al. 1997)

The Great Gray Owl is rarely seen by people and is very vulnerable to human disturbance such as clearing of forests for timber or farming. The main limit to its distribution is the availability of nest sites. If there are sufficient nest sites, then other factors such as food supply, determine how many owls live in the area. Chemicals used in exterminating mice and other pests have detrimentally affected the food chain of Strix nebulosa 

Wildfires can increase the availability of nest sites by creating suitable stumps, and they can also increase mouse populations.

(Idaho Conservation Data Center 2001, Huff et. al 1997, Mann,

Osborne 2000).

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.60,000 individuals (Rich et al. 2004), while national population sizes have been estimated at < c.100 breeding pairs in China and < c.10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: In California, habitat loss through logging of mature forest and overgrazing of meadows has been the primary cause for decline (California Department of Fish and Game 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: In addition to the provision of suitable habitat, management needs include protection of nesting areas from excessive human activity during the nesting season. For the Pacific Northwest, U.S. Forest Service et al. (1993) and Thomas et al. (1993) recommended providing a no-harvest buffer of 300 feet around meadows and natural openings and establishment of a 1/4-mile protection zone around known nest sites.

Artificial nest platforms have been used successfully (Bull et al. 1987, California Department of Fish and Game 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: cover, fire exclusion, fire management, prescribed fire, severity, snag, stand-replacing fire, wildfire

A 1989 analysis of western raptor habitat concludes: 1) properly managed prescribed fires and wildfires are necessary within raptor habitat; 2) fire exclusion has led to ecosystem stagnation and will ultimately lead to "devastating" wildfires; 3) prescribed fire can be used to reduce fuels, maintain historic conditions in an ecosystem, and create mosaics of open and closed habitat, thus increasing raptor carrying capacities as well as prey abundance; and 4) unless vegetation types are very similar, it will be difficult to standardize fire management practices [65].

As of 2007, there was no research on the effects of wildfire or prescribed burning for the great gray owl. Data are needed to make detailed management recommendations. Based on the habitat requirements for the great gray owl, fire management generalizations are possible.

Great gray owls could be greatly affected by fire, depending on its severity. Stand-replacing fire may negatively affect the great gray owl due to the destruction of nesting sites such as vacated raptor nests [11,28,43,73,76,100,103] and dwarf mistletoe brooms [11,28,43,78,103,106]. Snag availability would probably increase, providing perching, roosting, and nesting sites [11,43,103,106]; however, great gray owls may not use these sites due to decreased canopy cover (see Preferred Habitat). Salvage logging could have negative effects. Mammalian prey species populations may be very low for the first several years following severe fire, but would eventually increase [13,18,28,38,99].

Low-severity wildfire and prescribed burns open dense forest structure and may benefit the great gray owl; however, the removal of large-diameter snags and dwarf mistletoe brooms used for nesting would be "detrimental" [81]. If prescribed surface burns are performed, some dead woody material on the forest floor needs to be retained due to its importance to the great gray owl [25,26,28,43,46] and mammalian prey species. To maintain prey species, prescribed burning should be restricted during the great gray owl's breeding season (see Timing of Major Life History Events) [46].

Great gray owls and spotted owls share similar habitat requirements, and may respond similarly to wildfire and prescribed fire. For detailed fire effects and use for the spotted owl, see spotted owl.
  • 28. Bull, Evelyn L.; Henjum, Mark G. 1990. Ecology of the great gray owl. Gen. Tech. Rep. PNW-GTR-265. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 39 p. [15228]
  • 38. Duncan, James R. 1997. Great gray owls (Strix nebulosa nebulosa) and forest management in North America: a review and recommendations. Journal of Raptor Research. 31(2): 160-166. [64898]
  • 43. Franklin, Alan B. 1988. Breeding biology of the great gray owl in southeastern Idaho and northwestern Montana. The Condor. 90(3): 689-696. [64875]
  • 46. Goggans, Rebecca; Platt, Melissa. 1992. Breeding season observations of great gray owls on the Willamette National Forest, Oregon. Oregon Birds. 18(2): 35-41. [64864]
  • 76. Oeming, Albert F. 1955. A preliminary study of the great gray owl (Scotiaptex nubulosa nubulosa) (Forster) in Alberta with observations on some other species of owls. Edmonton, AB: University of Alberta. 129 p. Dissertation. [64894]
  • 78. Parks, Catherine G.; Bull, Evelyn L.; Torgersen, Torolf R. 1997. Field guide for the identification of snags and logs in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 40 p. [44149]
  • 100. Voous, K. H. 1989. Owls of the northern hemisphere. London: William Collins Sons and Company, LTD. 320 p. [25638]
  • 103. Whitfield, Michael B.; Gaffney, Maureen. 1997. Great gray owl (Strix nebulosa) breeding habitat use within altered forest landscapes. In: Duncan, James R.; Johnson, David H.; Nicholls, Thomas H., eds. Biology and conservation of owls of the Northern Hemisphere: 2nd international symposium: Proceedings; 1997 February 5-9; Winnipeg, MB. Gen. Tech. Rep. NC-190. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 498-505. [65576]
  • 106. Winter, Jon. 1986. Status, distribution and ecology of the great gray owl, (Strix nebulosa) in California. San Francisco, CA: San Francisco State University. 121 p. Thesis. [64886]
  • 13. Barnes, Victor G., Jr. 1974. Response of pocket gopher populations to silvicultural practices in central Oregon. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 167-175. [8004]
  • 18. Black, H. C.; Hooven, E. H. 1974. Response of small-mammal communities to habitat changes in western Oregon. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 177-186. [8005]
  • 25. Bull, Evelyn L.; Henjum, Mark G.; Rohweder, Ronald S. 1988. Nesting and foraging habitat of great gray owls. Journal of Raptor Research. 22(4): 107-115. [64879]
  • 26. Bull, Evelyn L.; Blumton, Arlene K. 1999. Effect of fuels reduction on American martens and their prey. Res. Note RNW-RN-539. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 9 p. [30825]
  • 65. Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire exclusion and fire management on raptor habitats in the western United States. In: Pendleton, B. G., ed. Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 236-244. [22324]
  • 73. Munts, Michael A.; Powers, Leon R. 1991. Observations on the occurrence and nesting of the great gray owl (Strix nebulosa Forster) in Valley County, Idaho. Journal of the Idaho Academy of Science. 27(2): 37-44. [17659]
  • 81. Pilliod, David S.; Bull, Evelyn L.; Hayes, Jane L.; Wales, Barbara C. 2006. Wildlife and invertebrate response to fuel reduction treatments in dry coniferous forests of the western United States: a synthesis. Gen. Tech. Rep. RMRS-GTR-173. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 34 p. [65071]
  • 99. Volland, Leonard A. 1974. Relation of pocket gophers to plant communities in the pine region of central Oregon. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 149-166. [8003]
  • 11. Atkinson, Eric. 1989. Great gray owl (Strix nebulosa) surveys on the Payette National Forest. [WR 223]. Boise, ID: Idaho Department of Fish and Game. 22 p. [+ appendices]. [64870]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: cover, density, natural, presence, succession, tree

Forest management practices impact great gray owl populations [38]. On the Salmon National Forest in Idaho, the great gray owl is an indicator species for healthy old-growth forests [57]. Because great gray owls occur in local concentrations, management is recommended in areas where they have been seen in the past or in prime great gray owl hunting habitats characterized as forest edges or meadows with deep soils [28,47].

Management of great gray owl habitat includes protecting nest sites and surrounding habitat, restricting activity around nest sites during the breeding season, retaining stands near foraging areas, and installing artificial nest platforms [42,106]. Artificial nesting platforms placed 30 to 49 feet (9-15 m) from the ground have been used successfully by the great gray owl in Oregon and California [16,28,29]. For detailed building instructions, see Bull and others [29]. Depressions cut into tree stumps make nest sites [30].

Duncan's [38] management recommendations include collecting occurrence data, limiting clearcutting area size to <10 ha within a mosaic of different aged forest stands, clearcutting in irregular shapes such as scalloped-shaped edges to reduce great gray owl predation, and leaving large-diameter dead trees for nest sites and perches [38].

According to Gould [47], management of the great gray owl "should follow in the steps of the spotted owl (Strix occidentalis)" due to similar habitat requirements. This includes managing for large-diameter trees in closed-canopy forest [98].

For general management recommendations and survey techniques for the great gray owl, see the Bureau of Land Management's Survey and Management Recommendations and the Forest Service's Management and Standards Guidelines.

Population trends: Nest site availability, suitable foraging habitat [42,53], and fluctuating rodent prey populations [42] are the most important factors limiting great gray owl populations [53]. Currently, no data substantiate historical population trends in great gray owl distribution [42,48,53], and a standardized survey protocol needs to be developed to determine long-term (>10 years) population trends [38,48,53]. Great gray owl populations in North America are believed to have been stable [27,28,106] for the previous 10 to 100+ years [38]. The population of great gray owls in south-central Oregon is probably declining due to habitat loss from timber harvest, urban sprawl into prime great gray owl areas, and mountain pine beetle (Dendroctonus ponderosae) infestations [21]. In 1987, Duncan [38] estimated that North American great gray owl populations ranged between 20,000 and 70,000 breeding pairs. These numbers reflect the dependence on microtine rodents, which exhibit population fluctuations over 3 to 5 year periods [38].

To sustain a viable population, 30 pairs of great gray owls are needed on the Salmon National Forest in Idaho, requiring a minimum total amount of 50,000 acres (1,670 acres/pair) of old-growth forest [57].

Silviculture: Timber harvest has great impact on the great gray owl. This species requires specific Habitat management to persist [48], and monitoring the effects of forest fragmentation is critical [93].

Intensive logging limits the number of nesting, perching, and roosting sites, and can be detrimental to great gray owl populations [22,27,38]. Great gray owl management guidelines emphasize the connectivity of old-growth forest as dispersal corridors [83]. Great gray owl populations may persist with "some amount" of logging [38]. Partial cuts are generally suitable for foraging; however, dead and downed material should be left to increase cover for great gray owl prey such as voles. For natural nests, dead, broken topped trees [31,94] >20 inches (50 cm) DBH should be retained, as well as any tree with old raptor nests, especially northern goshawk nests [28].

Downed wood is important in great gray owl habitat. In northeastern Oregon, downed wood was within 3 feet (1 m) of where prey was caught or attempted to be caught 80% of the time [28]. For detailed recommendations on managing trees and logs in the Interior Columbia River Basin, see Bull and others [29].

Clearcutting may increase the amount of viable foraging habitat for the great gray owl; however, it decreases nesting habitat quality. Clearcutting creates "temporary meadows" capable of supporting rodent populations consumed by the great gray owl, but these meadows undergo "rapid" succession to forests [51]. In southeastern Idaho and northwestern Wyoming, northern pocket gopher (Thomomys talpoides) populations increased in great gray owl diet proportionally to the amount of clearcut forest [43].

Clearcutting decreases the number of mature, large-diameter trees needed for nesting by the great gray owl, which could lead to a decline in great gray owl populations [46,51]. On the Targhee National Forest in eastern Idaho and northwestern Wyoming, great gray owl presence was related to the amount of clearcutting. Areas clearcut 39% to 62% (SD=11.68) did not contain great gray owls. Areas clearcut 14% to 26% (SD= 5.124) contained successful nesting in 2 locations [103].

Dwarf mistletoe: Trees infected with dwarf mistletoe are important nesting sites for great gray owl [28,43,78,103] (see Preferred Habitat). Bull and others [30] suggest that to manage forests containing dwarf mistletoe, choose groups of lightly-infected trees, where the brooms are large and dense enough for animals to build or use an existing nesting platform. Preserve old, infected larch trees when managing for western larch, because they produce high-quality snags sought by wildlife [30].

Agriculture and livestock grazing: Great gray owl nesting density is strongly influenced by the intensity of land use, including agricultural practices and human activity [107]. According to Young [107], the great gray owl is capable of persisting in agricultural areas. Livestock grazing may be harmful, however [32]. The great gray owl may abandon meadows that are heavily grazed by cattle and domestic sheep due to the reduction of rodent prey populations in grazed areas [106].
  • 16. Beck, Thomas W.; Smith, Randall A. 1987. Nesting chronology of the great gray owl at an artificial nest site in the Sierra Nevada. Journal of Raptor Research. 21(3): 116-118. [64882]
  • 21. Bryan, Terry; Forsman, Eric D. 1987. Distribution, abundance, and habitat of great gray owls in southcentral Oregon. The Murrelet. 68(2): 45-49. [64900]
  • 22. Bull, Evelyn L. 1989. Great gray owl (Strix nebulosa). In: Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; Genter, David L.; Groves, Craig, eds. Rare, sensitive, and threatened species of the Greater Yellowstone ecosystem. Jackson, WY: Northern Rockies Conservation Cooperative: 82-83. [64871]
  • 27. Bull, Evelyn L.; Duncan, James R. 1993. Great gray owl--Strix nebulosa. In: Poole, A.; Gill, F., eds. The birds of North America. No. 41. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-16. [25650]
  • 28. Bull, Evelyn L.; Henjum, Mark G. 1990. Ecology of the great gray owl. Gen. Tech. Rep. PNW-GTR-265. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 39 p. [15228]
  • 29. Bull, Evelyn L.; Henjum, Mark G.; Anderson, Ralph G. 1987. Nest platforms for great gray owls. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 87-90. [65578]
  • 30. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 31. Call, Mayo. 1979. Habitat management guides for birds of prey. Tech. Note 338. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 70 p. [22451]
  • 32. Carrier, W. Dean; Czech, Brian. 1996. Threatened and endangered wildlife and livestock interactions. In: Krausman, Paul R., ed. Rangeland wildlife. Denver, CO: The Society for Range Management: 39-47. [27319]
  • 38. Duncan, James R. 1997. Great gray owls (Strix nebulosa nebulosa) and forest management in North America: a review and recommendations. Journal of Raptor Research. 31(2): 160-166. [64898]
  • 42. Forsman, Eric; Bull, Evelyn L. 1989. Great horned, great gray, spotted and barred owls. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation, Institute for Wildlife Research: 118-123. [64872]
  • 43. Franklin, Alan B. 1988. Breeding biology of the great gray owl in southeastern Idaho and northwestern Montana. The Condor. 90(3): 689-696. [64875]
  • 46. Goggans, Rebecca; Platt, Melissa. 1992. Breeding season observations of great gray owls on the Willamette National Forest, Oregon. Oregon Birds. 18(2): 35-41. [64864]
  • 47. Gould, Gordon I., Jr. 1985. A case for owls. In: Proceedings, 7th annual wildlife conference; 1983 February 4-6; San Francisco, CA. San Francisco, CA: San Francisco Zoological Society: 14-21. [22601]
  • 51. Habeck, James R. 1994. Dynamics of forest communities used by great gray owls. In: Hayward, Gregory D.; Verner, Jon, tech. eds. Flammulated, boreal, and great gray owls in the United States: a technical conservation assessment. Gen. Tech. Rep. RM-253. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 176-201. [27356]
  • 53. Hayward, Gregory D.; Verner, Jon, tech. eds. 1994. Flammulated, boreal, and great gray owls in the United States: a technical conservation assessment. Gen. Tech. Rep. RM-253. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 213 p. [24608]
  • 57. Hurt, Pat. 1984. Maintenance of old growth habitat through the Forest Planning Process. The Habitat Express No. 84-8. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Region. 8 p. [16493]
  • 78. Parks, Catherine G.; Bull, Evelyn L.; Torgersen, Torolf R. 1997. Field guide for the identification of snags and logs in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 40 p. [44149]
  • 83. Rapp, Valerie. 2005. Conserving old forest in landscapes shaped by fire. PNW Science Update. Issue 11. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 11 p. [55436]
  • 93. Stepnisky, D. P. 1997. Landscape features and characteristics of great gray owl (Srix nebulosa) nests in fragmented landscapes of central Alberta. In: Duncan, James R.; Johnson, David H.; Nicholls, Thomas H., eds. Biology and conservation of owls of the Northern Hemisphere: 2nd international symposium: Proceedings; 1997 February 5-9; Winnipeg, MB. Gen. Tech. Rep. NC-190. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 601-607. [65577]
  • 94. Stevenson, Susan K.; Jull, Michael J.; Rogers, Bruce J. 2006. Abundance and attributes of wildlife trees and coarse woody debris at three silvicultural systems study areas in the interior cedar-hemlock zone, British Columbia. Forest Ecology and Management. 233(1): 176-191. [64073]
  • 98. Verner, Jared; McKelvey, Kevin S.; Noon, Barry R; Gutierrez, R. J.; Gould, Gordon I., Jr.; Beck, Thomas W. 1992. Assessment of the current status of the California spotted owl, with recommendations for management. In: Verner, Jared; McKelvey, Kevin S.; Noon, Barry R.; Gutierrez, R. J.; Gould, Gordon I., Jr.; Beck, Thomas W., tech. coords. The California spotted owl: a technical assessment of its current status. Gen. Tech. Rep. PSW-GTR-133. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 3-26. [28195]
  • 103. Whitfield, Michael B.; Gaffney, Maureen. 1997. Great gray owl (Strix nebulosa) breeding habitat use within altered forest landscapes. In: Duncan, James R.; Johnson, David H.; Nicholls, Thomas H., eds. Biology and conservation of owls of the Northern Hemisphere: 2nd international symposium: Proceedings; 1997 February 5-9; Winnipeg, MB. Gen. Tech. Rep. NC-190. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 498-505. [65576]
  • 106. Winter, Jon. 1986. Status, distribution and ecology of the great gray owl, (Strix nebulosa) in California. San Francisco, CA: San Francisco State University. 121 p. Thesis. [64886]
  • 107. Young, Leonard S. 1989. Effects of agriculture on raptors in the western United States: an overview. In: Pendleton, B. G., ed. Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 209-218. [22649]
  • 48. Groves, Craig; Zehntner, Elaine. 1990. Distribution and status of great gray owls (Strix nebulosa) on the Targhee National Forest, 1989. [Purchase Order No. 40-02S0-9-0690]. Boise, ID: Idaho Department of Fish and Game; St. Anthony, ID: U.S. Department of Agriculture, Forest Service, Targhee National Forest. 31 p. [+ appendices]. [64869]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The restrictions enforced on the logging industry because of the threatened status, will most likely be costly, and will potentially set back any business that relies on these resources for lumber and wood products. (Mann)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Strix nebulosa is important in the ecological balance; they scavenge and dispose of carrion and provide a check on rodent populations. Also, this rare owl draws many bird-watchers from everywhere. In Alaska, Athabaskans may use it as a food source due to its stored winter fat.(Compton's Encyclopedia 1998; Osborne 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great grey owl

The great grey owl or great gray owl (Strix nebulosa) is a very large owl, documented as the world's largest species of owl by length. It is distributed across the Northern Hemisphere. In some areas it is also called Phantom of the North, cinereous owl, spectral owl, Lapland owl, spruce owl, bearded owl, and sooty owl.[2]

Description[edit]

Cross sectioned great grey owl specimen showing the extent of the body plumage, Zoological Museum, Copenhagen

Adults have a large, rounded head with a grey face and yellow eyes with darker circles around them. The underparts are light with dark streaks; the upper parts are grey with pale bars. This owl does not have ear tufts and has the largest facial disc of any raptor.

In terms of length, the great grey owl is believed to exceed the Eurasian eagle-owl and the Blakiston's fish owl as the world's largest owl.[3] The great grey is outweighed by those two species as well as several others, including most of the Bubo genus.[4] Much of its size is deceptive, since this species' fluffy feathers, large head and the longest tail of any extant owl obscure a body lighter than that of most other large owls. The length ranges from 61 to 84 cm (24 to 33 in), averaging 72 cm (28 in) for females and 67 cm (26 in) for males. The wingspan can exceed 152 cm (60 in), but averages 142 cm (56 in) for females and 140 cm (55 in) for males. The adult weight ranges from 580 to 1,900 g (1.28 to 4.19 lb), averaging 1,290 g (2.84 lb) for females and 1,000 g (2.2 lb) for males.[5] The males are usually smaller than females, as with most owl species.[2]

Breeding[edit]

They breed in North America from as far east as Quebec[2] to the Pacific coast and Alaska, and from Finland and Estonia across northern Asia. They are permanent residents, but may move south and southeast when food is scarce. A small population, estimated at less than 100 birds, occurs in the Sierra Nevada mountains of California. This population is the southernmost population of the species' range and is listed Endangered under California's Endangered Species Act. In Europe they are found breeding in Norway and Sweden and more numerously through Finland and Russia.

Adult female

Their breeding habitat is the dense coniferous forests of the taiga, near open areas, such as meadows or bogs. Great grey owls do not build nests, so typically use nests previously used by a large bird, such as a raptor. They will also nest in broken-topped trees and cavities in large trees. Nesting may occur from March to May. Four eggs are the usual clutch size. Eggs average 42.7 mm (1.68 in) wide and 53.5 mm (2.11 in) long. The incubation period is about 30 days, ranging from 28 to 36 days. Brooding lasts 2 to 3 weeks, after which the female starts roosting on a tree near nests. The young jump or fall from the nest at 3 to 4 weeks, and start to fly 1 to 2 weeks after this. Most offspring remain near their natal sites for many months after fledging.

The abundance of food in the area usually affects the number of eggs a female lays, a feature quite common in northern owl species. If food is scarce, they may travel a fair distance to find more prey, with considerable movements by large numbers in some years of particularly scarce prey. Though they do not migrate, many are at least somewhat nomadic.

Feeding[edit]

Owl in flight

These birds wait, listen, and watch for prey, then swoop down; they also may fly low through open areas in search of prey. Their large facial disks, also known as "ruffs", focus sound, and the asymmetrical placement of their ears assists them in locating prey, because of the lack of light during the late and early hours in which they hunt. On the nesting grounds, they mainly hunt at night and near dawn and dusk; at other times, they are active mostly during the night.

They have excellent hearing, and may locate (and then capture) prey moving beneath 60 cm (2.0 ft) of snow in a series of tunnels solely with that sense. They then can crash to a snow depth roughly equal to their own body size to grab their prey. Only this species and, more infrequently, other fairly large owls from the Strix genus are known to "snow-plunge" for prey, a habit that is thought to require superb hearing not possessed by all types of owls.[6]

Unlike the more versatile eagle and horned owls, great grey owls rely almost fully upon small rodents, with voles being their most important food source. Locally, alternative prey animals (usually comprising less than 20% of prey intake) include hares, moles, shrews, weasels, thrushes, grouse, grey jays, small hawks and ducks. Although seldom preyed upon, great grey owl nestlings and juveniles may themselves fall prey to bears, fishers, and large hawks, especially Northern goshawks; while adults may fall prey to Bubo owls, golden eagles and lynxes.

The song of the male is a series of very deep, rhythmic hoots whoo, whoo, whoo, whoo, whoo.... At other times, adults are normally silent. The young may chatter, shriek or hiss.

Habitat[edit]

The harvest of timber from the great grey owl's habitat is, perhaps, the greatest threat to this species.[7] Intensified timber management typically reduces live and dead large-diameter trees used for nesting, leaning trees used by juveniles for roosting before they can fly, and dense canopy closures in stands used by juveniles for cover and protection.[7] If perches are not left in clearcuts, great grey owls cannot readily hunt in them. Although human-made structures (made specifically for use by this species) have been utilized by these owls, the species is far more common in areas protected from logging. Livestock grazing in meadows also adversely affects great grey owls, by reducing habitat for preferred prey species.[7]

Plumage of the face (Weltvogelpark Walsrode)
Bartkauz 0504025 w.jpg

Due to their large size, great grey owls have few natural predators. Great horned owls, various small carnivores, and black bears have been documented preying on young, but such predators rarely threaten adults, and owls have been known to fend off animals as large as black bears when defending their nests.[8] The only known predator of adult great grey owls is the Eurasian eagle-owl (Bubo bubo), which occasionally preys on the former in parts of Europe.[9]

Provincial bird[edit]

The great grey owl is the provincial bird of Manitoba, where it is known as the great gray owl.

Footnotes[edit]

  1. ^ BirdLife International (2012). "Strix nebulosa". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c Great Gray Owl, Owl Pages
  3. ^ http://animals.jrank.org/pages/786/Owls-Strigiformes-PHYSICAL-CHARACTERISTICS.html
  4. ^ Great Grey Owl, The Owl Foundation
  5. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  6. ^ Lynch, Wayne, Owls of the United States and Canada: A Complete Guide to Their Biology and Behavior. The Johns Hopkins University Press (2007), ISBN 978-0-8018-8687-4
  7. ^ a b c Great Gray Owl, Sierra Forest Registry
  8. ^ "Great Gray Owl - Strix nebulosa". The Owl Pages. 
  9. ^ International Masters Publishers. Wildlife Explorer. Connecticut, Group 7, Card 89. ISBN 1-886614-77-6.

References[edit]

  • [1] The great grey owl (GGO) was placed on the California state endangered species list in June 1980.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Strix nebulosa (Forster) is the scientific name for the great gray owl, a member of
the Strigidae family [1,4,90]. Listed below are the 2 recognized subspecies [2,4,90]:

Strix nebulosa nebulosa (Forster)

Strix nebulosa lapponica (Thunberg)
  • 2. American Ornithologists' Union. 1957. Checklist of North American birds. 5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p. [21235]
  • 1. Amadon, Dean; Bull, John. 1988. Hawks and owls of the world: a distributional and taxonomic list. Western Foundation of Vertebrate Zoology. 3(4): 295-357. [25642]
  • 90. Sibley, Charles G.; Monroe, Burt L., Jr. 1990. Distribution and taxonomy of the birds of the world. New Haven, CT: Yale University Press. 1111 p. [22814]
  • 4. American Ornithologists' Union. 2007. The A.O.U. check-list of North American birds, 7th edition, [Online]. American Ornithologists' Union (Producer). Available: http://www.aou.org/checklist/index.php3. [50863]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

great gray owl

great grey owl

great cinereous owl

Lapland owl

Siberian owl

sooty owl

speckled owl

spectral owl

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!