Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Brief Summary

The Great Gray Owl (Strix nebulosa) is a very large nocturnal bird of northern (mainly coniferous) forests and wooded bogs as well as some high mountain meadows in western North America. Great Gray Owls are resident across much of boreal Canada and Alaska and in Eurasia from northern Scandinavia, northern Russia, and northern Siberia south to central Russia, northern Mongolia, and northern Manchuria., Amurland, and Sakhalin. where they are most often found near bogs, along forest edges overlooking fields, in mountain meadows, and around cultivated land, airports, and roadsides.



The Great Gray Owl is distinctly larger than the Great Horned Owl and Snowy Owl and much larger than the Barred Owl (although a surprising proportion of its bulk consists of feathers rather than bones and muscle). Its flat face is punctuated by small yellow eyes surrounded by concentric rings. Although Great Gray Owls are most active at dawn, at dusk, and at night, they hunt during daylight in summer (and in winter if food-stressed), although still generally near dawn or dusk. Wingbeats are deep and slow. Both sexes produce a call consisting of 5 to 10 very quiet (typically inaudible beyond 400 m) evenly spaced deep hoots at a rate of around one per second.

The diet of the Great Gray Owl consists mainly of small mammals, especially Microtus voles. These owls can detect prey under snow by sound and can plunge and break through snow crust hard enough to support 80 kg and as deep as 45 cm. Small mammals are swallowed whole and larger prey are pulled apart. Abandoned nests of other large bird such as Goshawks, Ravens, or Ospreys 10 to 50 feet above the ground are the most common nest sites, although these owls may sometimes nest on top of broken tree trunks and, rarely, on the ground; nests may be reused for several years. Typical clutch size is 2 to 5 eggs (clutch size may be larger in years with abundant food). Incubation (for 28 to 36 days) is by the female only, but the male brings food to the incubating female on nest. The female broods young for their first 2 to 3 weeks. In some areas, the adult female departs after young fledge while the male remains and feeds them for up to 3 months. In some winters, large numbers of Great Gray Owls may move south or southeast into eastern Canada and the extreme northeastern United States in North America and northern Germany and Ukraine in Europe (apparently in response to a sudden drop of rodent population). Great Gray Owls may live more than 20 years.

(Kaufman 1996; Dunne 2006; Svensson 2009; AOU 1998; Holt et al. 1999 and references therein)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Strix nebulosa resides in Alaska, Canada, the higher elevations of the Rocky Mountain States, northern Minnesota and northern Wisconsin. Also, S. nebulosa breeds from northern Yukon to northern Manitoba and northern Ontario, south locally to central California, northern Idaho, northwestern Wyoming, central Saskatchewan, northern Minnesota, and south central Ontario. Winters generally through the breeding range, wandering south irregularly to the northern tier of States. It also occurs widely across Europe and Asia. (Osborne 2001, UNEP World Conservation Monitoring Center 2001).

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: central Alaska to northern Ontario, south locally in mountains to California (vicinity of Yosemite), Idaho, Montana, Wyoming, central Saskatchewan, northern Minnesota, and south-central Ontario. WINTERS: generally throughout breeding range, wandering south irregularly to northern U.S. Also in Old World. Usually uncommon, but sometimes may be locally abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The great gray owl is a native, permanent resident of the boreal forests of North America and Eurasia [27,53,59,75]. Strix nebulosa nebulosa inhabits North America and S. n. lapponica inhabits Eurasia [27,53]. Bird Web provides a distributional map of the great gray owl in North America, as well as photos.

The great gray owl is unevenly distributed and variable throughout its North American range [27]. Information on population status is currently lacking in many geographic areas [11,22,38,53].

The known breeding range in North America is from the boreal forests of Alaska east to Ontario and south to northern Minnesota and Wisconsin [3,4,28,53]. Great gray owls also breed in northern Idaho, western Montana, northwestern Wyoming [3,48], northeastern Utah [3,28], west-central Nevada [53], and the Sierra Nevada [3,48].

The wintering range is generally the same as the breeding range, except for a tendency for great gray owls to wander south in search of prey [27,68,100]. Great gray owls may wander to southern Canada, [4,69], New England, New York, and northern Michigan [69].

The following lists are speculative and are based on the habitat characteristics and species composition of communities great gray owls are known to occupy. There is not conclusive evidence that great gray owls occur in all the habitat types listed, and some community types, especially those used rarely, may have been omitted. See Preferred Habitat for more detail.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

States or Provinces

(key to state/province abbreviations)
UNITED STATES
AK CA ID MN MT NV OR UT WA WI
WY

CANADA
AB BC MB NT NS ON PQ SK YK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

BLM PHYSIOGRAPHIC REGIONS [17]:

2 Cascade Mountains

4 Sierra Mountains

5 Columbia Plateau

6 Upper Basin and Range

8 Northern Rocky Mountains

9 Middle Rocky Mountains

10 Wyoming Basin

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Great Gray Owl is the tallest owl in Alaska standing at a length 24-33 inches high, with a wing span of 54-60 inches, depending on degree of maturity. Strix nebulosa is larger and grayer than other owls and its round head does not have any ear tufts. Its bill and eyes yellow.

The owl has a distinctive facial disk, with two obvious gray concentric circles. The feathers of the disk help direct sounds toward the ear openings that are hidden by feathers. The owl also has an asymmetrical skull with large bony cups surrounding the ear openings.

In addition to the predominately gray plumage and distinctive facial disk, the bird has a black chin spot just above two white-feathered mustaches and it has a prominent white collar on the front of the neck. Ventrally, the owl is exhibits varying shades of dark and light grays, browns, and white. The dorsal side has a little less white than the ventral side. The tail is long and extends beyond the folded wings.

Adaptations for hunting include the facial disk, soft feathers so flight is silent, and the ability to turn its head three quarters of a circle (270 degrees).

(The Owl Pages; Compton's Encyclopedia 1998; MacBride Raptor Project 1997; Baetsen 2000; Wolf 2000).

Range mass: 790 to 1454 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 69 cm

Weight: 1298 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In North America, Strix nebulosa inhabits dense coniferous forests in Canada, and montane coniferous forests of the western States. It usually prefers pine and fir forests, rarely straying far out onto tundra barrens and muskeg marshes. Nests in mature poplar woodlands, well secluded from human activities, and in spruce stands with islands of tamarack. In winter, it may inhabit forests, sparse woodland edges bordering open fields, weedy fields with posts or scattered low trees or bushes, or brackish tidal meadows (Baetsen 2000; The Owl Pages).

Terrestrial Biomes: tundra ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Dense coniferous and hardwood forest, especially pine, spruce, paper birch, poplar; also second growth, especially near water, foraging in wet meadows; boreal forest and spruce-tamarack bogs in far north, coniferous forest and meadows in mountains.

Nests in top of large broken-off tree trunks (especially in south), in old nests of other large birds (e.g., hawk nest) (especially in north), or in debris platforms from dwarf mistletoe; frequently near bogs or clearings. Nests frequently reused (Franklin 1988). Same pair often nests in same area in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: cover, forb

SRM (RANGELAND) COVER TYPES [89]:



108 Alpine Idaho fescue

109 Ponderosa pine shrubland

110 Ponderosa pine-grassland

213 Alpine grassland

215 Valley grassland

216 Montane meadows

409 Tall forb

410 Alpine rangeland

411 Aspen woodland

920 White spruce-paper birch

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

SAF COVER TYPES [39]:

1 Jack pine

5 Balsam fir

12 Black spruce

13 Black spruce-tamarack

14 Northern pin oak

15 Red pine

16 Aspen

21 Eastern white pine

27 Sugar maple

38 Tamarack

39 Black ash-American elm-red maple

63 Cottonwood

107 White spruce

201 White spruce

202 White spruce-paper birch

203 Balsam poplar

204 Black spruce

205 Mountain hemlock

206 Engelmann spruce-subalpine fir

207 Red fir

210 Interior Douglas-fir

211 White fir

212 Western larch

213 Grand fir

215 Western white pine

17 Aspen

218 Lodgepole pine

224 Western hemlock

227 Western redcedar-western hemlock

228 Western redcedar

229 Pacific Douglas-fir

230 Douglas-fir-western hemlock

233 Oregon white oak

234 Douglas-fir-tanoak

237 Interior ponderosa pine

243 Sierra Nevada mixed conifer

244 Pacific ponderosa pine-Douglas-fir

245 Pacific ponderosa pine

246 California black oak

247 Jeffrey pine

251 White spruce-aspen

252 Paper birch

253 Black spruce-white spruce

254 Black spruce-paper birch

256 California mixed subalpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: bog, shrub

KUCHLER [62] PLANT ASSOCIATIONS:

K002 Cedar-hemlock-Douglas-fir forest

K004 Fir-hemlock forest

K005 Mixed conifer forest

K007 Red fir forest

K008 Lodgepole pine-subalpine forest

K010 Ponderosa shrub forest

K011 Western ponderosa forest

K012 Douglas-fir forest

K013 Cedar-hemlock-pine forest

K014 Grand fir-Douglas-fir forest

K015 Western spruce-fir forest

K026 Oregon oakwoods

K028 Mosaic of K002 and K026

K030 California oakwoods

K052 Alpine meadows and barren

K093 Great Lakes spruce-fir forest

K094 Conifer bog

K095 Great Lakes pine forest

K098 Northern floodplain forest

K099 Maple-basswood forest

K101 Elm-ash forest

K106 Northern hardwoods

K107 Northern hardwoods-fir forest

K108 Northern hardwoods-spruce forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

ECOSYSTEMS [45]:

FRES10 White-red-jack pine

FRES11 Spruce-fir

FRES17 Elm-ash-cottonwood

FRES18 Maple-beech-birch

FRES19 Aspen-birch

FRES20 Douglas-fir

FRES21 Ponderosa pine

FRES22 Western white pine

FRES23 Fir-spruce

FRES24 Hemlock-Sitka spruce

FRES25 Larch

FRES26 Lodgepole pine

FRES28 Western hardwoods

FRES29 Sagebrush

FRES37 Mountain meadows

FRES40 Desert grasslands

FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

See lists above.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Greater mobility exhibited in years when food scarce (Duncan 1987). Food scarcity or unavailability may cause post-breeding movement upslope and downslope movement in winter (California Department of Fish and Game 1990). May move several hundred km southward for winter; in some areas, longest movements made by immatures (but see ECOLCOM).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In the wild, Strix nebulosa feeds primarily on small rodents such as voles and pocket gophers. Small rodents composed 80-90% percent of the diet while other mammals (mainly shrews) and birds composed the remainder (The Owl Pages).

The Great Gray Owl hunts by perching on a tree overlooking a meadow or open area. The owl's keen hearing enables it to accurately determine the location of its prey, even under two feet of snow or in tunnels. Once the owl locates some food, it silently glides from its perch and plunges into the snow to grab the rodent with its sharp talons. Fresh "plunge marks" will occasionally show an imprint of the owl's outstretched wing feathers where the owl dropped into the snow. In many areas these marks are often the only indication that Great Gray Owls are in the area (MacBride Raptor Project, Wolf 2000, Baetsen 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet in North America dominated by pocket gophers and voles. Forages usually in open area where scattered trees or forest margin provides suitable sites for visual searching; also uses sound to locate prey under snow cover.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Food supply may be a critical factor regulating the population size of the great gray owl [27].

Diet: Primary foods eaten are small mammals, especially rodents such as voles (Microtus spp. and Clethrionomys spp.), mice (Peromyscus spp.), and pocket gophers (Thomomys spp.) [22,23,37,40,43,46,77,100,106]. Other prey items include shrews (Soricidae) and birds [37]. When desperate for food, great gray owls may eat frogs (Ranidae, Hylidae) [74].

In California, the diet of the great gray owl shifts between microtine rodents and pocket gophers as prey abundance changes [106]. Even when pocket gophers are abundant, great gray owls will not breed in the absence of microtine rodents. This may be due to the difficulty of catching pocket gophers [106].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

Predators for adult great gray owls include common ravens, great horned owls [23,76,103], northern goshawks [23], broad-winged hawks, and American martens (Martes americana) [103]. Owlets may be killed by red-tailed hawks [28], American black bears (Ursus americanus) [37,76], fisher (Martes pennanti) [37,100], lynx (Lynx canadensis) [37], great horned owls [37], and golden eagles (Aquila chrysaetos) [100].

Other causes of mortality: At least 20% of adult great gray owl mortality is due to starvation during winter [100]. Collisions with vehicles and shooting by humans also cause mortality [103].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Strix nebulosa preys on:
Parascalops breweri
Microtus xanthognathus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Guesstimated number of breeding pairs in Canada in the early 1990s was 10,000-25,000 (Kirk et al. 1995). See Johnsgard (1988) for listing of recent status studies in Manitoba, Saskatchewan, California (about 10 breeding pairs, California Department of Fish and Game 1990), Wyoming, Idaho, and Oregon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Some may remain on breeding territory all year; others may move irregularly in search of favorable foraging conditions. In Oregon, radio-tagged juveniles moved 9-31 km from nest over period of 1 year, adults moved 3-43 km during same period (see Johnsgard 1988). Predation by great horned owl was greatest known mortality factor in northern Minnesota and southeastern Manitoba (Duncan 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, duff, fire exclusion, fire management, fire severity, graminoid, natural, prescribed fire, severity, stand-replacing fire, succession, tree, wildfire

As of this writing, no information is available on the effects of fire on the great gray owl. Despite the lack of information, some generalizations based on their habitat requirements may be possible. Following fire, modifications in the food supply and habitat of great gray owls may occur, as well as changes in the abundance of competitors and predators [85]. According to Finch and others [41], the effects of fire on birds and their habitat vary with: 1) the severity and extent of the fire; 2) temporal scales; 3) life history characteristics of the bird species; and 4) whether or not salvage logging occurs following fire. Severe fires alter the forest structure more than low-severity fires, and a stand-replacing fire may result in the replacement of a bird species with a different bird species. Large, severe fires may greatly alter bird habitat in the short term but be necessary for long-term maintenance of some forest types. Salvage logging may reduce the benefits of fire to birds that utilize snags for foraging and nesting [58]. Prior to European settlement, Native Americans managed forests that provided great gray owl habitat by frequent understory burning. With fire exclusion, habitat for the great gray owl has become less suitable due to decreased forest structure diversity and the encroachment of conifers into meadows [19].

Great gray owls require mature and old-growth forests for breeding and natural forest openings for foraging [21,22,22,51,52,57,63,72,93,106]. On the forest floor, downed woody material and tree stumps are used by adults for perching [28,29]. Leaning trees are needed by owlets for roosting and perching before they learn to fly [25,28,43] (see Preferred Habitat). The availability of nesting sites, perching sites, and foraging habitat are greatly affected by natural forest disturbances such as fire, succession, and disease outbreaks [38]. In the boreal mixed woodland on the plains of Alberta, habitat would probably not be suitable for 25 years after stand-replacing fire [87].

Fire may reduce conifer invasion in natural forest openings [51]. Golden eagles in the Appalachian Mountains stopped breeding after open habitats in the mountains, which were required for foraging, reverted to brush following fire exclusion [92]. Fire exclusion in great gray owl foraging habitat may have a similar effect.

The spotted owl and great gray owl share similar habitat requirements such as large trees, snags, closed canopies, and multiple forest layers. Fire management strategies for the spotted owl may apply to the great gray owl [98]. A fire management suggestion made by the US Department of the Interior, Fish and Wildlife Service [96] and Rapp [83] for spotted owls was to isolate nesting sites from adjoining forest at high risk for fire by creating a buffer zone around sites to reduce flammability. This should be done without compromising the nest site. Verner and others [98] suggest low-severity underburning in spotted owl habitat in the Sierra Nevada, minimizing the removal of duff and large woody debris.

Effects on prey: Rodents use dead woody material on the forest floor and in forest openings for cover [26,28] and may either be positively or negatively affected by fire, depending on fire severity [28,60]. Immediately following prescribed fire in meadows, the availability of prey species increases for the great gray owl due to the removal of grass layers used for cover [10,67]. After the availability of prey increases following fire, prey populations may decrease due to lack of cover [28].

Shrews, deer mice (Peromyscus maniculatus), creeping voles (Microtus oregoni), and Townsend's chipmunks (Neotamias townsendii) were absent to rare on severely burned sites but comprised most of the small-mammal community in unburned clearcuts. The study was conducted following the Oxbow Fire, a large (170 km²), mixed-severity wildfire in a Douglas-fir and mixed-conifer forest in western Oregon [104]. Rodent populations slowly after the fire, and population numbers were similar between burned and unburned areas by postfire year 7 [18]. Populations of pocket gophers (Thomomys talpoides and T. mazama) generally increase following stand-replacing fire [13], particularly in lodgepole pine/western needlegrass (Achnatherum occidentale) communities in central Oregon. This may be due to the abundance of long-stolon sedge (Carex inops), a rhizomatous, fleshy-rooted graminoid that increases 200% to 400% following burning [99].

The following table provides fire return intervals for plant communities and ecosystems where the great gray owl is important. For further information, see the FEIS review of the dominant plant species listed below.

Community or Ecosystem Dominant Species Fire Return Interval Range (years)
grand fir Abies grandis 35-200 [6]
maple-beech-birch Acer-Fagus-Betula spp. >1,000
sugar maple Acer saccharum >1,000
sugar maple-basswood Acer saccharum-Tilia americana >1,000
black ash Fraxinus nigra 101]
tamarack Larix laricina 35-200 [80]
western larch Larix occidentalis 25-350 [7,15,35]
Great Lakes spruce-fir Picea-Abies spp. 35 to >200 [36]
Engelmann spruce-subalpine fir Picea engelmannii-Abies lasiocarpa 35 to >200 [6]
black spruce Picea mariana 35-200
conifer bog* Picea mariana-Larix laricina 35-200 [36]
jack pine Pinus banksiana <35 to 200 [34,36]
Rocky Mountain lodgepole pine* Pinus contorta var. latifolia 25-340 [14,15,95]
Sierra lodgepole pine* Pinus contorta var. murrayana 35-200
Jeffrey pine Pinus jeffreyi 5-30
western white pine* Pinus monticola 50-200
Pacific ponderosa pine* Pinus ponderosa var. ponderosa 1-47 [6]
interior ponderosa pine* Pinus ponderosa var. scopulorum 2-30 [6,12,64]
red pine (Great Lakes region) Pinus resinosa 3-18 (x=3-10) [33,44]
red-white pine* (Great Lakes region) Pinus resinosa-P. strobus 3-200 [34,54,66]
eastern white pine Pinus strobus 35-200 [101]
eastern cottonwood Populus deltoides <35 to 200 [80]
aspen-birch Populus tremuloides-Betula papyrifera 35-200 [36,101]
quaking aspen (west of the Great Plains) Populus tremuloides 7-120 [6,49,70]
mountain grasslands Pseudoroegneria spicata 3-40 (x=10) [5,6]
Rocky Mountain Douglas-fir* Pseudotsuga menziesii var. glauca 25-100 [6,8,9]
coastal Douglas-fir* Pseudotsuga menziesii var. menziesii 40-240 [6,71,84]
California oakwoods Quercus spp. <35
Oregon white oak Quercus garryana <35 [6]
California black oak Quercus kelloggii 5-30 [80]
western redcedar-western hemlock Thuja plicata-Tsuga heterophylla >200
mountain hemlock* Tsuga mertensiana 35 to >200 [6]
*fire return interval varies widely; trends in variation are noted in the species review

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: formation, nidicolous, presence

Migration: Great gray owls may be resident or seminomadic, depending on the availability of rodent prey [59,68,69,100]. They may move to low elevations during winter to avoid hunting in deep snow [43].

Mating: Great gray owls are generally not monogamous; however, pair bonds may be maintained in boreal forests if prey populations remain high over subsequent years [37]. Great gray owls probably first breed when 3 years old [22,23]. Pair formation begins in January and extends as late as 2 weeks before egg-laying in April and May [43].

Nesting: Nesting chronology data for the great gray owl are meager. Timing of egg laying may depend on the availability of rodent prey and habitat quality [100]. Egg laying may be delayed during years of heavy snow [43]. In California, great gray owls nest in April [106]. Egg laying occurs in April and May in southeastern Idaho and northwestern Wyoming [43]. In northern Alberta, the earliest egg-laying date was 23 March, but most eggs were laid by 15 April [76].

Eggs are laid at 1- to 3-day intervals [27]. Clutch size ranges from 2 to 5 eggs, and 3-egg clutches are most typical [76]. Average clutch size was 2.67 (n=6) eggs in the Targhee National Forest, Idaho [103] and 2.3 eggs (n=64, SD=0.87) in northeastern Oregon [23].

Incubation is performed only by the female [27,76], and brooding lasts 2 to 3 weeks [27,76]. Brooding lasted an average of 29.7 days in southeastern Idaho and northwestern Wyoming [43].

Development: Great gray owls are semiprecocial and nidicolous [27]. Adults may sometimes favor their smaller or weaker offspring [23].

Fledging: Young leave the nest 26 days [23] to 28.5 days [43] after hatching. Owlets learn to fly 7 to 14 days after leaving the nest. Before learning to fly, they climb leaning trees using their talons, wings, and bills, and roost off of the ground [28,43]. Females continue protecting their young after fledging and males bring prey items. Males may extend fledgling care longer than females. In Oregon, females abandoned their young between 3 and 6 weeks after fledging, but males provided care for up to 3 months after fledging [28]. Young are independent by late summer and leave the natal site in fall and winter. Maximum dispersal distance of radio-tagged juvenile great gray owls from their natal site in Oregon ranged from 4.7 to 19.9 miles (7.5-32.0 km) [24].

Survival: The survival of young depends on the availability of leaning and deformed trees as well as the presence of forested habitat within a 1,640- foot (500 m) radius around the nest for roosting and avoiding prey [43]. Owlets have a 63% chance surviving from the egg to the flight stage [43]. In northeastern Oregon, the probabilities of juveniles surviving to the following ages were: 12 months old=0.53; 18 months old=0.39; and 24 months old=0.31 (n=32). Mortality was due to starvation, falling from the nest [28], or predation) [23]. Survival rates are high if juveniles survive to breeding age [28].

Home range: The home range of 5 nesting males in northeastern Oregon averaged 4.5 km² (range 1.3-6.5 km²) [24].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

As of 2007, no research directly investigated great gray owl mortality due to fire. The direct impact of fire on birds is a function of the bird's size and mobility as well as the characteristics of the fire. Fire may kill great gray owls [79], but mortality is generally minor for adult birds of most species [65,85]. Mortality of nestlings or fledglings is possible if fires occur during the breeding season, so adult birds may experience reduced reproduction rates [79]. Severe fires may result in proportionately greater mortality [82].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: In winter, hunts primarily in early morning and from late afternoon until dusk. When nesting, may hunt day or night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
153 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding takes place in late winter with the pair generally utilizing an abandoned hawk or crow's nest. The female Strix nebulosa lays eggs in March- June, depending on temperature range (egg laying may be delayed in deep snow years). Two to five dull white oval eggs are laid and are incubated by the female Strix nebulosa for a period of 28-29 days. The owlets hatch covered by soft white down with their eyes open. Both parents feed the young by bringing food to the nest, tearing into very small pieces that are eagerly consumed by the little ones. Soon the down begins to disappear and is replaced by feathers. Once the owlets are 'feathered out' they begin the pre-flight exercises. They can be observed walking around the top of their nest flapping their wings and gripping the nest edge with their talons. Young leave nest after three to four weeks with the ability to climb well. (The Owl Pages).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 30 days.

Average eggs per season: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg dates: late March-May in Alberta, late April-early June in Ontario, peak mid-April to late May in California, mean date of first egg 5 May in southern Idaho and northwestern Wyoming; eggs laying may be delayed in years with deep snow (Franklin 1988). Clutch size is 2-5 (usually 2-3 or 3-4). Incubation lasts 28-29 days, by female (male brings food). Young begin to leave nest at 3-4 weeks (4 weeks in Idaho/Wyoming), fly well at 5-6 weeks (6 weeks in Idaho/Wyoming), independent at about 4-5 months (Idaho/Wyoming: Franklin 1988). Usually first breeds at 3-4 years. Pair bond is not maintained outside breeding season, but bond may reform if both birds return to the same breeding territory. Some pairs may not breed in years of low prey abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strix nebulosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGACATTGGCACCCTCTATCTAGTCTTTGGCACATGAGCTGGCATAGTCGGCACTGCCCTTAGCCTACTCATCCGAGCCGAACTAGGCCAACCCGGAACACTCCTAGGTGACGACCAAATCTACAATGTAATCGTTACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATACCCATCATGATCGGGGGATTTGGAAACTGACTAGTTCCCCTAATAATTGGAGCCCCAGATATGGCCTTTCCCCGTATAAATAACATAAGCTTTTGACTCCTCCCACCCTCATTCCTACTCCTACTAGCCTCCTCCACAGTAGAGGCCGGAGCAGGCACCGGATGAACCGTCTACCCCCCACTAGCCAGCAACCTAGCCCACGCTGGAGCCTCGGTAGACCTGGCCATCTTTTCCCTCCACCTAGCCGGAGTGTCATCCATCCTAGGGGCAATCAACTTCATCACCACTGCCATCAACATAAAACCCCCATCTCTATCGCAATACCAAACCCCTCTATTTGTATGATCCGTCCTCATCACTGCCATTCTCCTACTCCTGTCCCTCCCAGTCCTCGCTGCAGGCATCACAATACTACTAACTGACCGCAACCTAAATACCACATTCTTCGACCCCGCTGGCGGCGGCGATCCAGTCCTATACCAACACCTCTTCTGATTCTTTGGACACCCAGAAGTCTACATCCTCATCCTACCAGGATTTGGAATTATCTCCCACGTAAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Strix nebulosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5