Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Range Description

Crotophaga sulcirostris occurs in the Americas, from the U.S.A. south through Mexico, Guatemala, Belize, El Salvador, Honduras, Nicaragua, Costa Rica and Panama to South America, where it occurs in Colombia, Ecuador, Peru, Chile, Venezuela, Guyana and the Netherlands Antilles (del Hoyo et al. 1997). The race pallidula, described from Cabo San Lucas in the early 20th century (Bangs and Pernard 1921), is probably now extinct.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: from southern Sonora, central and southern Texas, and southern Louisiana (rare) south through Middle and South America to northern Chile and northwestern Argentina; formerly in southern Baja California. Wanders irregularly east along Gulf coast to peninsular Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S Baja; s Texas to n Chile, n Argentina, Trinidad and Curaçao.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 34 cm

Weight: 87 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: ALL SEASONS: Open and partly open country, including scrub, thickets, cultivated lands, savanna, orchards, marshes, and second growth. BREEDING: Nests usually in low tree, shrubby thicket, or on cactus clump (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly insects taken from ground or from shrubs, also small fruits and occasionally lizards; often forages near grazing cattle (Terres 1980)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Often in loose flocks of up to 15, usually about 6-8, occasionally in pairs (Stiles and Skutch 1989). In Costa Rica, most young (75%) dispersed from natal area (Bowen et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Clutch size 3-5. Several females (of 2-4 cooperating pairs, Stiles and Skutch 1989) may lay total of 15 eggs in one nest. Incubation 13-14 days, by both sexes; several birds may incubate. Young tended by all members of group, including young of earlier brood.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crotophaga sulcirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACTTGATCTTTGGTGCCTGAGCCGGTATAATTGGAACCGCCCTAAGCCTACTTATCCGTGCAGAACTAGGCCAACCAGGGACTCTCCTAGGAGACGACCAGATCTATAACGTTATTGTCACGGCACATGCCTTCGTAATAATCTTCTTTATAGTCATGCCTATTATAATTGGAGGATTTGGAAACTGATTAGTCCCTCTTATAATTGGTGCCCCAGACATAGCATTTCCACGTATAAATAACATAAGCTTCTGACTTCTCCCCCCATCTTTCCTACTACTACTAGCATCCTCCACAGTAGAAGCCGGAGCAGGGACAGGATGAACAGTATATCCTCCACTGGCCGGAAACCTCGCTCACGCTGGAGCATCCGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGTGTGTCATCAATCTTAGGAGCAATCAACTTTATCACAACCGCCATTAACATAAAACCACCAGCTCTCTCACAATACCAAACCCCCCTATTCGTCTGATCAGTTCTCATCACTGCCATTCTACTACTCCTATCTCTCCCAGTACTTGCCGCAGGAATCACTATACTCTTAACAGACCGCAACCTAAACACTACATTCTTTGACCCGGCTGGAGGAGGCGACCCCGTATTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTATATATTCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crotophaga sulcirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Groove-billed ani

The groove-billed ani (Crotophaga sulcirostris) is an odd-looking tropical bird in the cuckoo family with a long tail and a large, curved beak. It is a resident species throughout most of its range, from southern Texas, central Mexico and The Bahamas, through Central America, to northern Colombia and Venezuela, and coastal Ecuador and Peru. It only retreats from the northern limits of its range in Texas and northern Mexico during winter.

The groove-billed ani is about 34 cm (13 in) long, and weighs 70–90 g (2.5–3.2 oz). It is completely black, with a very long tail almost as long as its body. It has a huge bill with horizontal grooves along the length of the upper mandible. It is very similar to the smooth-billed ani, some of which have bills as small as the groove-billed and with grooves on the basal half. The two species are best distinguished by voice and range. In flight, the ani alternates between quick, choppy flaps and short glides.

Like other anis, the groove-billed is found in open and partly open country, such as pastures, savanna, and orchards. It feeds largely on a mixed diet of insects, seeds, and fruits.

The groove-billed ani lives in small groups of one to five breeding pairs. They defend a single territory and lay their eggs in one communal nest. All group members incubate the eggs and care for the young.

Protected status[edit]

The groove-billed ani is protected under the Migratory Bird Treaty Act of 1918.[2]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!