Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psophia leucoptera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGACATACATCAATCGATGATTATTTTCAACCAACCACAAAGACATCGGAACCCTCTACCTAATTTTCGGTGCATGGGCAGGTATAATTGGCACCGCCCTAAGCTTACTAATCCGTGCAGAACTTGGCCAACCAGGAACCCTATTAGGAGACGATCAGATCTACAATGTCATCGTCACCGCACACGCATTCGTAATAATCTTCTTCATAGTAATGCCAATTATAATTGGGGGCTTCGGAAACTGACTAGTTCCGCTTATAATCGGTGCCCCAGACATGGCATTTCCACGTATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTACTACTGCTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGTACAGGATGGACAGTATACCCACCACTAGCTGGTAACTTAGCCCATGCTGGAGCTTCAGTAGACCTGACCATCTTCTCCCTCCACCTGGCAGGTGTCTCCTCAATCTTAGGGGCAATCAACTTTATCACAACTGCCATCAACATAAAACCCCCAACACTATCACAGTACCAAACCCCCCTATTTGTCTGATCCGTCCTCATTACCGCCGTTCTACTATTACTCTCCCTCCCAGTCCTTGCCGCAGGCATCACTATATTACTAACAGACCGAAACCTAAATACGACATTCTTCGACCCCGCTGGAGGAGGTGACCCAGTATTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Psophia leucoptera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pale-winged trumpeter

The pale-winged trumpeter (Psophia leucoptera), also known as the white-winged trumpeter, is a species of bird in the Psophiidae family. It is found in the southwestern Amazon rainforest of Brazil, northern Bolivia, and eastern Peru.

It has two subspecies: The widespread nominate has a white rump and is found south of the Amazon River and west of the Madeira River, while ochroptera has a yellowish rump and is found between the Amazon River and the lower Rio Negro. Genetic evidence suggests the closest relative of ochroptera is the grey-winged trumpeter, leading some to treat it as a separate species, the ochre-winged trumpeter (P. ochroptera).[2]

The reproductive behavior of the nominate subspecies of the pale-winged trumpeter is the best known of all the trumpeters'. Groups of adults defend a territory together. Several males mate with the dominant female, the dominant male doing so most often. She lays an average of three eggs in a hole in a tree, where both males and females incubate. The young hatch covered with thick, dark, cryptically patterned down. Soon afterwards, they jump down to the ground and follow the adults. Their call is a loud staccato trumpeting.

References[edit]

  1. ^ BirdLife International (2012). "Psophia leucoptera". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Ribas, Aleixo, Nogueira, Miyaki and Cracraft. 2011. A palaeobiogeographic model for biotic diversification within Amazonia over the past three million years. Proceedings of the Royal Society
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!