Overview

Distribution

Range Description

Psophia leucoptera is restricted to west-central Amazonia, west of the Madeira and south of the Amazon/Solimões in Brazil, west into north-eastern Bolivia, and through Amazonian Peru, north to the Maranon (Sherman 1996). Densities of c.8 birds/km2 have been recorded in ideal conditions in Manu National Park, Peru. The population size has apparently not been quantified, but it has been noted to have become rare or absent in areas where it was once common, and it is suspected to be in decline owing to habitat loss and hunting pressure (Sherman 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is widespread in undisturbed dense tropical moist forest away from human settlement, and has been recorded up to 750 m (Sherman 1996). It lives in cooperatively polyandrous groups of up to about 10 individuals, roaming a permanent territory on foot in search of ripe fruit, arthropods and some small vertebrates, including snakes. Breeding takes place between September and April, with the nest located in a hollowed out tree trunk on average 11 m above ground (Sherman 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psophia leucoptera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGACATACATCAATCGATGATTATTTTCAACCAACCACAAAGACATCGGAACCCTCTACCTAATTTTCGGTGCATGGGCAGGTATAATTGGCACCGCCCTAAGCTTACTAATCCGTGCAGAACTTGGCCAACCAGGAACCCTATTAGGAGACGATCAGATCTACAATGTCATCGTCACCGCACACGCATTCGTAATAATCTTCTTCATAGTAATGCCAATTATAATTGGGGGCTTCGGAAACTGACTAGTTCCGCTTATAATCGGTGCCCCAGACATGGCATTTCCACGTATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTACTACTGCTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGTACAGGATGGACAGTATACCCACCACTAGCTGGTAACTTAGCCCATGCTGGAGCTTCAGTAGACCTGACCATCTTCTCCCTCCACCTGGCAGGTGTCTCCTCAATCTTAGGGGCAATCAACTTTATCACAACTGCCATCAACATAAAACCCCCAACACTATCACAGTACCAAACCCCCCTATTTGTCTGATCCGTCCTCATTACCGCCGTTCTACTATTACTCTCCCTCCCAGTCCTTGCCGCAGGCATCACTATATTACTAACAGACCGAAACCTAAATACGACATTCTTCGACCCCGCTGGAGGAGGTGACCCAGTATTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Psophia leucoptera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Lees, A.

Justification
Based on a model of future deforestation in the Amazon basin, and the species's susceptibility to the impacts of hunting pressure and habitat degradation, it is suspected that its population will decline by 25-29% over three generations from 2002, and it has therefore been uplisted to Near Threatened.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The primary threat to this species is accelerating deforestation in the Amazon Basin as land is cleared for cattle ranching and soy production, facilitated by expansion of the road network (Soares-Filho et al. 2006, Bird et al. 2011, A. Lees in litt. 2011). Proposed changes to the Brazilian Forest Code reduce the percentage of land a private landowner is legally required to maintain as forest (including, critically, a reduction in the width of forest buffers alongside perennial steams) and include an amnesty for landowners who deforested before July 2008 (who would subsequently be absolved of the need to reforest illegally cleared land) (Bird et al. 2011). The species's habitat preferences suggest that it is also sensitive to habitat degradation and disturbance. Hunting appears to be a significant threat across the range of the species, and has become a greater problem with the increased availability of firearms during the past century (Sherman 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
No targeted conservation actions are known for this species, although some of its habitat is protected, for example in Manu National Park, Peru (Sherman 1996).

Conservation Actions Proposed
Carry out surveys to assess the total population size. Study the species's habitat requirements in detail. Quantify the impacts of hunting. Monitor rates of forest loss across its range. Increase the area of suitable habitat that is protected.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pale-winged trumpeter

The pale-winged trumpeter (Psophia leucoptera), also known as the white-winged trumpeter, is a species of bird in the Psophiidae family. It is found in the southwestern Amazon rainforest of Brazil, northern Bolivia, and eastern Peru.

It has two subspecies: The widespread nominate has a white rump and is found south of the Amazon River and west of the Madeira River, while ochroptera has a yellowish rump and is found between the Amazon River and the lower Rio Negro. Genetic evidence suggests the closest relative of ochroptera is the grey-winged trumpeter, leading some to treat it as a separate species, the ochre-winged trumpeter (P. ochroptera).[2]

The reproductive behavior of the nominate subspecies of the pale-winged trumpeter is the best known of all the trumpeters'. Groups of adults defend a territory together. Several males mate with the dominant female, the dominant male doing so most often. She lays an average of three eggs in a hole in a tree, where both males and females incubate. The young hatch covered with thick, dark, cryptically patterned down. Soon afterwards, they jump down to the ground and follow the adults. Their call is a loud staccato trumpeting.

References[edit]

  1. ^ BirdLife International (2012). "Psophia leucoptera". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Ribas, Aleixo, Nogueira, Miyaki and Cracraft. 2011. A palaeobiogeographic model for biotic diversification within Amazonia over the past three million years. Proceedings of the Royal Society
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!