Overview

Distribution

Range Description

Psophia leucoptera is restricted to west-central Amazonia, west of the Madeira and south of the Amazon/Solimesin Brazil, west into north-eastern Bolivia, and through Amazonian Peru, north to the Maranon (Sherman 1996). Densities of c.8 birds/km2 have been recorded in ideal conditions in Manu National Park, Peru. The population size has apparently not been quantified, but it has been noted to have become rare or absent in areas where it was once common, and it is suspected to be in decline owing to habitat loss and hunting pressure (Sherman 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is widespread in undisturbed dense tropical moist forest away from human settlement, and has been recorded up to 750 m (Sherman 1996). It lives in cooperatively polyandrous groups of up to about 10 individuals, roaming a permanent territory on foot in search of ripe fruit, arthropods and some small vertebrates, including snakes. Breeding takes place between September and April, with the nest located in a hollowed out tree trunk on average 11 m above ground (Sherman 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psophia leucoptera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGACATACATCAATCGATGATTATTTTCAACCAACCACAAAGACATCGGAACCCTCTACCTAATTTTCGGTGCATGGGCAGGTATAATTGGCACCGCCCTAAGCTTACTAATCCGTGCAGAACTTGGCCAACCAGGAACCCTATTAGGAGACGATCAGATCTACAATGTCATCGTCACCGCACACGCATTCGTAATAATCTTCTTCATAGTAATGCCAATTATAATTGGGGGCTTCGGAAACTGACTAGTTCCGCTTATAATCGGTGCCCCAGACATGGCATTTCCACGTATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTACTACTGCTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGTACAGGATGGACAGTATACCCACCACTAGCTGGTAACTTAGCCCATGCTGGAGCTTCAGTAGACCTGACCATCTTCTCCCTCCACCTGGCAGGTGTCTCCTCAATCTTAGGGGCAATCAACTTTATCACAACTGCCATCAACATAAAACCCCCAACACTATCACAGTACCAAACCCCCCTATTTGTCTGATCCGTCCTCATTACCGCCGTTCTACTATTACTCTCCCTCCCAGTCCTTGCCGCAGGCATCACTATATTACTAACAGACCGAAACCTAAATACGACATTCTTCGACCCCGCTGGAGGAGGTGACCCAGTATTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Psophia leucoptera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Lees, A.

Justification
Based on a model of future deforestation in the Amazon basin, and the species's susceptibility to the impacts of hunting pressure and habitat degradation, it is suspected that its population will decline by 25-29% over three generations from 2002, and it has therefore been uplisted to Near Threatened.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5