Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Comprehensive Description

Longueur 40-45 cm, envergure 105-115 cm, poids 700-950 g.

Elle habite les terrains ouverts qui lui offrent une vue étendue sur les environs. Hormis les steppes à graminées hautes, elle fréquente les pâtures à moutons ou les champs de luzerne, de trèfle, de colza et de céréales. Elle montre une grande intolérance au dérangement et reste à distance des bâtiments. S’ils ne sont dérangés que de manière irrégulière, elle peut s’installer sur des aérodromes et terrains d’entraînement militaire.

L’Outarde canepetière se nourrit de plantes et d’invertébrés, notamment de coléoptères et d’orthoptères, plus rarement de petits vertébrés tels que jeunes grenouilles et campagnols. Elle est plus active le matin tôt, l’après-midi et le soir.

L’espèce est grégaire. Les nids totalement isolés sont rares alors que certains peuvent être à quelques centaines de mètres les uns des autres. En dehors de la saison de reproduction, elle forme des groupes importants, pouvant atteindre le millier d’individus. Le mâle est très territorial du début du printemps jusqu’au milieu de l’été, défendant une zone de 4 à 6 ha, parfois moins. Le chant s’accompagne parfois de démonstrations visuelles, qu’il émet depuis des emplacements spécifiques au sein du territoire.

Le nid est une simple dépression grattée au sol dans la végétation basse. Il peut mesurer 4-5 cm de profondeur, mais est parfois creusé de telle sorte que le dos de la femelle couvant arrive au niveau du sol. Cette dernière améliore souvent son camouflage en se couvrant de végétation. La ponte de 3-4 œufs (extrêmes 2 à 6) est déposée à partir de la fin avril. L’incubation dure 3 semaines et l’envol a lieu à l’âge de 25-30 jours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Tetrax tetrax has two widely separated breeding populations. In its eastern range it occurs in Russia (likely to have been previously underestimated at 9,000 displaying males as 14,000-17,000 individuals were reported in one region alone [Orenburg] in the last two years [A. Antonchikov in litt. 2012]), Georgia (60 non-breeding individuals [E. García in litt. 2007]), Kyrgyzstan, Kazakhstan (c.20,000 individuals and likely to be increasing [N. Petkov in litt. 2012]), Ukraine (100-110 individuals [Y. Andryuschenko in litt. 1999]), north-west China, northern Iran and Turkey (20-100 pairs [Eken and Magnin 1999]). Its western range covers Spain (71-147,000 individuals comprising 41,482-86,195 breeding males [García de la Morena, et al. 2006], down from 100,000-200,000 males in the 1990s [De Juana and Martínez 1996]) and Portugal (c.17,500 displaying males [E. García in litt. 2007]), with smaller populations in Italy (1,515-2,220 individuals [E. García in litt. 2007]), France (1,677-1875 displaying males in 2008 [Jolivet 2009]) and Morocco. Eastern populations winter from Turkey and the Caucasus to Iran, and erratically elsewhere in south Asia, with Azerbaijan holding the main wintering quarters (over 150,000 individuals in 2005-2006 [Gauger 2007, E. García in litt. 2007]) and sightings in the winter of 2010 report 25,000 and 50,000-70, 000 individuals in Adjinohur valley and Shirvan National Park respectively (Gauger and Heiß 2010). Western populations winter in the Mediterranean zone, with the Iberian peninsula holding the most important wintering quarters (a minimum of 16,429-35,929 and 11,200 individuals in Spain and Portugal, respectively) (E. García in litt. 2007). The global population (excluding Kazakhstan) was estimated at a minimum of c.240,000 individuals in the late 1990s (C. Martínez in litt. 1999), but it may be substantially lower than this, due to the re-evaluation of the size of the Spanish population (García et al. 2007). Whilst it remains widespread and numerous, in some parts of its range it has declined dramatically since the 19th century, leading to extinctions in at least 11 European countries, Algeria, Tunisia and probably as a breeding bird in Azerbaijan. The species has now disappeared from mainland Italy, where it occurred in Apulia, and it is presently declining in France and Spain (V. Bretagnolle in litt. 2007). In Portugal, the population appears to be stable, and eastern populations are said to have increased in recent years (E. García in litt. 2007). The population in the Eurasian steppe belt is thought to have recovered due to an increase in fallow land during the transition process of the former Soviet Union (Gauger 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

S Palearctic region.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits dry grassland and, in Europe, it also occurs in areas of low-intensity arable cultivation and pastoral land, selecting areas with a high diversity of ground cover such as mosaics of pasture, stubble fields, long-rotation fallow land and legume crops. The species has been observed to form mixed-species flocks with Pin-tailed Sandgrouse Pterocles alchata in Iberian regions and France (Martin et al. 2010). Wintering birds in Azerbaijan prefer semi-desert and steppe areas under winter pasturing, and avoid areas of intensive agriculture (Gauger 2007).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tetrax tetrax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTGATCTTTGGCGCATGAGCTGGCATAGTTGGAACAGCCCTAAGCTTGCTTATCCGTGCTGAACTTGGCCAACCTGGAACTCTCCTAGGAGATGACCAAATCTACAATGTAATCGTCACTGCCCACGCCTTCGTAATAATCTTCTTCATGGTAATACCTATCATAATCGGAGGATTCGGAAACTGACTAGTCCCACTAATAATTGGTGCCCCTGACATAGCATTCCCCCGCATAAACAACATGAGCTTCTGACTACTCCCTCCATCCTTCCTACTCCTCCTAGCATCCTCCACAGTAGAGGCAGGAGCTGGAACAGGATGAACAGTATACCCCCCACTAGCAGGCAACCTCGCCCATGCCGGAGCATCAGTAGACCTAGCCATCTTCTCCCTTCACCTAGCAGGTGTCTCCTCTATTCTAGGTGCAATTAACTTTATTACCACCGCCATCAACATAAAACCACCAACTCTCTCACAATACCAAACACCCCTATTTGTATGGTCCGTTCTCATCACAGCCGTCTTACTCCTTCTCTCCCTACCAGTCCTCGCTGCTGGCATTACCATGCTACTAACGGACCGAAATCTAAATACCACATTCTTCGACCCAGCAGGGGGAGGAGACCCAGTCCTATATCAGCACCTCTTCTGATTTTTTGGTCACCCCGAAGTCTACATCCTAATTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tetrax tetrax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Andryucshenko, Y., Bretagnolle, V., García, E., Jolivet, C., Martínez, C., Petkov, N. & Antonchikov, A.

Justification
This species is listed as Near Threatened because it is probably experiencing a moderately rapid overall population decline, driven by rapid declines in the west of its range, owing mainly to habitat loss and degradation, as well as low-level hunting pressure. Recent increases in the east of its range are so far unquantified, and require further study. Such data may have implications for the overall population trend and listing of the species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population (excluding c.20,000 individuals in Kazakhstan) has been estimated at a minimum of c.240,000 individuals (C. Martínez in litt. 1999).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The primary cause of its decline has been conversion of dry grassland and low-intensity cultivation to intensive arable agriculture, especially where this has included the planting of monocultures or perennial crops, irrigation or afforestation. The fragmentation of traditional habitats, by means of agricultural intensification or infrastructure development, negatively affects habitat availability and quality for the species, as well as male density (E. García in litt. 2007, García et al. 2007) as displaying males exhibit a preference for old and same-year fallows which offer shelter and food (Delgado et al. 2010). The use of pesticides could reduce food availability (E. García in litt. 2007). Harvesting with modern farm machinery, operated at high speed and often during the night, is the key threat to females and nests in Europe and is the cause for the observed male-biased sex structure and low fecundity (Iñigo and Barov 2010). Farm machinery accounts for 40% of clutch failure in southwest France (Inchausti & Bretagnolle, 2005). Conversion to intensive arable agriculture continues to be the primary threat and cause of continuing declines in Europe (E. García in litt. 2007) and is predicted to cause declines in the eastern population in the near future (Kamp et al. in press). It also suffers from illegal hunting (Y. Andryuschenko in litt. 1999), although this is a minor threat (V. Bretagnolle in litt. 2007). The collision of birds with overhead powerlines is a locally important cause of mortality (E. García in litt. 2007). The release of farm-reared gamebirds could eventually introduce new pathogens to wild populations of T. tetrax (E. García in litt. 2007). In Azerbaijan, the main threats are disturbance from intensive land use (mainly heavy grazing), habitat loss to infrastructure development and probably hunting (Gauger 2007). Climate change effects could lead to shorter rainy seasons and reduced winter precipitation in Southern Europe which could have a detrimental effect on habitat quality for the species (Delgado et al. 2009, Delgado and Moreira 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CITES Appendix II. A European action plan was published in 2001 (E. García in litt. 2007), its implementation reviewed in 2010 (Barov and Derhé 2011) and updated in 2010 (Iñigo and Barov 2010). A species action plan for the species in Sardinia is in preparation. In Catalonia, Management Plans for the SPA with a Little Bustard population have been developed. The species has been the subject of several LIFE Nature projects in Portugal, Spain, France and Italy. France and Spain have attempted a joint programme of reinforcement of the populations in Central and Western France by release of captive-bred chicks during 2006-2009. In France, targeted agri-environmental measures (MAET) have been developed and tested in the region of Poitou-Charentes. Management agreements have been elaborated and signed with farmers, which are believed to have led to an increase of the affected populations (Leitão et al. 2006, Bamière et al. 2011, Bretagnolle et al. 2011). In France, Spain and Portugal national census takes place every 5 (4 in France) years. The number of protected areas established in steppe habitats in those countries has increased.

Conservation Actions Proposed
Carry out coordinated surveys to obtain an up-to-date estimate for the total population. Continue to conduct surveys to monitor population trends. Preserve habitat and alter land-use practices through EU and national policies. Work with land-owners to manage land favourably and reduce hunting. Reduce hunting pressure through awareness campaigns. Ensure fields with permanent cover on arable land through agri-environmental schemes using rotations and fallow land. Eliminate dangerous powerlines.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Bustard

The Little Bustard (Tetrax tetrax) is a large bird in the bustard family, the only member of the genus Tetrax. It breeds in southern Europe and in western and central Asia. Southernmost European birds are mainly resident, but other populations migrate further south in winter. The central European population once breeding in the grassland of Hungary went extinct several decades ago.

This species is declining due to habitat loss throughout its range. It used to breed more widely, for example ranging north to Poland occasionally (Tomek & Bocheński 2005). It is only a very rare vagrant to Great Britain despite breeding in France.

Although the smallest Palearctic bustard, Little Bustard is still pheasant-sized at 42–45 cm (17–18 in) long with a 90–110 cm (35–43 in) wingspan and a weight of 830 g (29 oz).[2] In flight, the long wings are extensively white. The breeding male is brown above and white below, with a grey head and a black neck bordered above and below by white.

The female and non-breeding male lack the dramatic neck pattern, and the female is marked darker below than the male. Immature bustards resemble females. Both sexes are usually silent, although the male has a distinctive "raspberry-blowing" call: prrt.

This species is omnivorous, taking seeds, insects, rodents and reptiles. Like other bustards, the male Little Bustard has a flamboyant display with foot stamping and leaping in the air. Females lay 3 to 5 eggs on the ground.

This bird's habitat is open grassland and undisturbed cultivation, with plants tall enough for cover. It has a stately slow walk, and tends to run when disturbed rather than fly. It is gregarious, especially in winter.

On December 20, 2013, the Cypriot newspapers 'Fileleftheros' and 'Politis', as well as news website 'SigmaLive', reported the discovery of a dead Little Bustard in the United Nations Buffer Zone. The bird had been shot by poachers hunting illegally in the zone. The shooting was particularly controversial amongst conservationists and birders since the Little Bustard is a very rare visitor to Cyprus and had not been officially recorded in Cyprus since December 1979.[3][4][5]

References[edit]

  • Tomek, Teresa & Bocheński, Zygmunt (2005): Weichselian and Holocene bird remains from Komarowa Cave, Central Poland. Acta zoologica cracoviensia 48A(1–2): 43–65. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!