Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Range

Tropical lowlands of s Mexico to ne Argentina and Brazil.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heliornis fulica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATTTTCGGGGCATGGTCTGGCATAATTGGCACAGCACTAAGCCTACTAATCCGAGCCGAACTAGGTCAACCAGGAAGCCTACTAGGTGACGACCAAATCTACAATGTAGTATTAACGGCGCACGCCTTTGTAATAATCTTCTTCATAGTTATACCCATTATGATCGGAGGGTTCGGCAATTGACTAGTACCCCTTATAATTGGCGCCCCAGACATAGCATTCCCTCGAATAAACAATATGAGCTTCTGACTACTACCCCCCTCATTCCTCCTACTACTAGCCTCCTCAACCGTAGAAGCAGGGGCAGGCACAGGATGAACAGTGTACCCCCCTCTAGCCGGCAACCTAGCCCACGCAGGAGCTTCAGTAGATCTAGCAATTTTCTCTCTACACCTTGCAGGTGTATCCTCTATCCTGGGGGCTATTAATTTTATTACAACAGCTATTAACATAAAACCCCCTGCATTATCACAATATCAAACCCCTCTGTTCGTCTGATCCGTCCTGATTACCGCTGTATTGTTACTGCTATCCCTGCCAGTACTAGCCGCAGGCATCACCATGCTATTAACCGACCGAAACCTCAATACCACATTCTTTGACCCAGCAGGAGGAGGGGATCCAATCCTATACCAGCACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Heliornis fulica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sungrebe

The sungrebe or American finfoot (Heliornis fulica) is a bird which breeds in tropical Central and South America from southern Mexico to northeast Argentina and southern Brazil.

It is the only member of the genus Heliornis. The Heliornithidae family, to which it belongs, contains just two other species: the African finfoot, Podica senegalensis, and the masked finfoot Heliopais personatus, which breeds in eastern India down through southeast Asia to the Wallace Line.

These tropical birds of swamps and marshes have broad lobes on their feet, similar to grebes. These are shy birds which swim in slow-flowing streams and secluded waterways, sometimes partly submerged, like an anhinga.

Identification[edit]

The sungrebe, an aquatic bird, is typically measured to be 28–31 cm long with a weight of around 130 grams.[2] It possesses a slimly shaped body with a tail that extends significantly beyond the body in flight. The sungrebe has predominately brown plumage with white stripes down both sides of the bird's long neck. In addition, both the throat and chin are white. It also has lobed toes that are banded a dull yellow and black[3] and a long red bill.[4]

The differences in appearance between males and females are minimal, but they can be distinguished based on cheek coloring. The male possesses white colored cheeks and the female is buff. An unusual trait of this bird species is the ability for males to carry the chicks within skin pouches on the underside of the wings. Due to the intensity that the male sungrebe grips these chicks, he is even capable of carrying them while flying.[5] This adaptation isn't a mechanism adapted by any other bird species; it is completely unique to the sungrebe. While some other birds may transport while swimming, the ability to fly while carrying the chicks is much less researched and understood due to such a limited number that are capable.[6]

Reproduction[edit]

The sungrebe has been frequently reported as having a mating season that begins in the middle of April during the "early wet season." Both the male and female birds take part in the nest building, which typically consists of twigs, reeds, and dried leaves. The nest is a platform placed about a meter above the water's surface in overhanging vegetation.

There are usually two to four eggs in a clutch, all with a white base color that is consistently covered in brown and pale purple spots. The eggs hatch after an unusually short incubation period of only 10 to 11 days. Both sexes share a responsibility in the incubation of the eggs; the female sits on the nest for most of the daylight hours and throughout the night, while male incubates them during the middle part of the day. Unlike their close relatives, the African and masked finfoot, the sungrebe chicks are hatched with only sparse down and poorly-matured feet and bill.[7] The chicks hatch naked, blind, and defenseless.[1]

Food[edit]

There is little information known about the diet of the sungrebe bird. Despite their vast population numbers, due to their solitary behavior it is somewhat rare to observe them in the wild. They have been reported to have snails and a variety of insects in their diet. Sungrebes also tend to eat spiders, small crabs, and small frogs and lizards.[8] Most of their eating takes place in the water and vegetation relatively near the water.[9]

The sungrebe is a relatively good diver and may hunt either in the water partially submerged or from low perches. Along with hunting small aquatic animals, this bird species has been known to also feed upon plant matter found within its habitat.[2]

Population[edit]

Argentina, Belize, Bolivia, Brazil, Colombia, Costa Rica, Ecuador, French Guiana, Guatemala, Guyana, Honduras, Mexico, Nicaragua, Panama, Paraguay, Peru, Suriname, and Venezuela are all countries that have been reported as containing a sungrebe population. Though it has been occasionally recorded to live in somewhat higher elevations, the sungrebe is most commonly associated with lower elevations from around 200 to 500 meters.[10] Due to the very large population size, this species is evaluated as Least Concern. There has been no established population trend, due to the uncertainty concerning the effects of habitat modification on the growth and decline of the population. However, it is believed that the sungrebe isn't decreasing in numbers rapidly enough to approach the thresholds of meeting the citeria that would label the species as Vulnerable.[11] Because there is no apparent threat, the overall global population has never been quantified as an exact number.

References[edit]

  1. ^ BirdLife International (2012). "Heliornis fulica". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Sungrebe (Heliornis fulica). (2011, May 8). Retrieved December 10, 2012, from Planet of Birds website: http://www.planetofbirds.com/gruiformes-helionithidae-sungrebe-heliornis-fulica
  3. ^ Luo, M. K. (2009, October 16). Heliornis fulica (T. S. Schulenberg, Ed.). Retrieved December 10, 2012, from The Cornell Lab of Ornithology website: http://neotropical.birds.cornell.edu/portal/species/overview?p_p_spp=142196
  4. ^ Sungrebe (Heliornis fulica). (2011, May 8). Retrieved December 10, 2012, from Planet of Birds website: http://www.planetofbirds.com/gruiformes-helionithidae-sungrebe-heliornis-fulica
  5. ^ Sungrebe or American Finfoots. (2012). Retrieved December 10, 2012, from BeautyOfBirds (formerly Avian Web) website: http://www.beautyofbirds.com/sungrebes.html
  6. ^ GrrlScientist. (2011, October 22). Mystery Bird: Sungrebe, Heliornis fulica. Retrieved December 10, 2012, from The Guardian website: http://www.guardian.co.uk/science/punctuated-equilibrium/2011/oct/22/7
  7. ^ Luo, M. K. (2009, October 16). Heliornis fulica (T. S. Schulenberg, Ed.). Retrieved December 10, 2012, from The Cornell Lab of Ornithology website: http://neotropical.birds.cornell.edu/portal/species/overview?p_p_spp=142196
  8. ^ Luo, M. K. (2009, October 16). Heliornis fulica (T. S. Schulenberg, Ed.). Retrieved December 10, 2012, from The Cornell Lab of Ornithology website: http://neotropical.birds.cornell.edu/portal/species/overview?p_p_spp=142196
  9. ^ Sungrebe (Heliornis fulica). (2011, May 8). Retrieved December 10, 2012, from Planet of Birds website: http://www.planetofbirds.com/gruiformes-helionithidae-sungrebe-heliornis-fulica
  10. ^ Luo, M. K. (2009, October 16). Heliornis fulica (T. S. Schulenberg, Ed.). Retrieved December 10, 2012, from The Cornell Lab of Ornithology website: http://neotropical.birds.cornell.edu/portal/species/overview?p_p_spp=142196
  11. ^ Butchart, S., & Ekstrom, J. (Eds.). (2012). Sungrebe. Retrieved December 6, 2012, from BirdLife International website: http://www.birdlife.org/datazone/speciesfactsheet.php?id=2802
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!