Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Distribution

Range

Palearctic; winters in ne Africa and s Asia.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

There are six main locations of populations of Anthropoides virgo. A stable/declining population of 70 to 100,000 individuals is located in eastern Asia. In central Asia, there is a stable and increasing population of 100,000 individuals. Kalmykia is the third eastern population, which consists of 30 to 35,000 individuals, and this count is presently stable. Northern Africa holds a declining population of fifty individuals on the Atlas Plateau. The population of about 500 individuals near the Black Sea is declining, and in Turkey, there exists a small breeding population of less than 100 individuals. Demoiselle cranes are a cosmopolitan species found within the wide range of the Ethiopian, Palearctic, and Oriental regions. As demoiselles are migratory birds, their winter habitats include those of Northeastern Africa, Pakistan, and India.

Biogeographic Regions: palearctic ; oriental ; ethiopian

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Generally, cranes are large birds, ranging from a length of 90 cm to 150 cm. Anthropoides virgo is known to be the smallest crane, with an average adult length of 90 cm. Cranes are recognized for their long necks and legs, their streamlined bodies, and long rounded wings. Demoiselle cranes can be distinguished by specific physical features and other unique characteristics. Most cranes have bare, red skin patches on their heads, however, demoiselles have a completely feathered head with a white line that extends from the corner of their red eye, to the back of their head. During display, they can elongate these feathers on the sides of their head. With feathery gray areas ranging from the crown to the nape, the bird has a dark underside, with black legs and toes. The main distinguishing features of A. virgo are their short toes and bills. Adapting to run in the grassland habitat, the toes have evolved to be shorter, as the shorter bills can forge for food more efficiently in upland areas. The length and positioning of the trachea can also distinguish a demoiselle crane from other cranes; Demoiselles have a trachea that makes a slight indentation on the sternum.

After hatching, demoiselle chicks are silver gray, and as they develop into a juvenile demoiselle, they become predominately grey at the time of fledging. This color assists in camouflaging the bird. Once developing into an adult, they appear as previously described above. An important fact about A. virgo is that the male and female are monomorphic - identical in their external features; however, the males are usually larger.

Range mass: 2000 to 2700 g.

Average length: 90 cm.

Range wingspan: 51 to 59 cm.

Average basal metabolic rate: I could not recover any information on the Basal Metabolic Rate cm^3 oxygen/hour.

Sexual Dimorphism: sexes alike; male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory (del Hoyo et al. 1996). It migrates on a narrow front via specific routes (Johnsgard 1983), and may travel vast distances without alighting to rest or feed (Urban et al. 1986). The Autumn migration begins in late summer (Meine and Archibald 1996) (August-September), with the species returning in flocks from its wintering areas to breed in March and April (sometimes as late as early-June in the north) (Johnsgard 1983, del Hoyo et al. 1996). On arrival in the breeding grounds the species remains gregarious for a few weeks, before becoming more territorial and eventually nesting in solitary pairs (although the species may still forage in small groups of c.7 individuals during the breeding season) (Johnsgard 1983). After breeding (from mid-August) (Snow and Perrins 1998) migratory flocks as large as 400 individuals begin to form (Johnsgard 1983), and on arrival in its wintering grounds the species often aggregates into huge flocks of up to several thousands or tens-of-thousands (Johnsgard 1983, Urban et al. 1986). Habitat In both its breeding and wintering ranges this species shows a preference for grassland habitats in close proximity to streams, shallow lakes and other wetlands, also frequenting desert areas where water is available (Johnsgard 1983, Ellis et al. 1996, del Hoyo et al. 1996, Meine and Archibald 1996). Breeding In its breeding range the species occurs from sea-level up to 3000 m (Johnsgard 1983, Ellis et al. 1996), inhabiting grassy steppes of feather grass Stipa and fescue Festuca, and dry areas dominated by wormwood Artemisia (Johnsgard 1983), the essential habitat requirement being access to water (e.g. rivers, streams or wells) for drinking (Johnsgard 1983). It can be found on hilly steppes along wide river valleys (Johnsgard 1983), shrubby steppes and semi-desert (Johnsgard 1983), forest edge habitats (e.g. meadows) (Johnsgard 1983), and occasionally unvegetated alkaline flats, or large expanses of rock or gravel (Johnsgard 1983). It will often forage in damp marshes and swamps (Johnsgard 1983), and is regularly found in cultivated areas (Johnsgard 1983). Non-breeding In Africa the species inhabits dry Acacia savanna, grassland, grassy river margins (Johnsgard 1983, del Hoyo et al. 1996) and semi-desert (where water is available) (Johnsgard 1983), but in India a wider range of habitat types are used, including marshes, freshwater lakes, rivers (Urban et al. 1986), cultivated fields and rice stubble (Johnsgard 1983, del Hoyo et al. 1996), sandy riverbeds, the flat and open margins of seasonal pans and farm ponds (Johnsgard 1983), and hot desert (if water is readily available) (Johnsgard 1983, Ellis et al. 1996, del Hoyo et al. 1996, Meine and Archibald 1996). It often roosts in shallow water or on sandbars and mudflats surrounded by water (Johnsgard 1983, Urban et al. 1986, del Hoyo et al. 1996). Diet The diet of this species consists mainly of plant material (Snow and Perrins 1998) (such as grass seeds) (Johnsgard 1983, Urban et al. 1986, del Hoyo et al. 1996), although lizards and small invertebrates such as large insects (especially beetles) and worms (Johnsgard 1983, Urban et al. 1986, del Hoyo et al. 1996) are also taken during the summer (Snow and Perrins 1998). The species will forage in cultivated fields (Johnsgard 1983), feeding on ripening cereal crops in its breeding grounds (Johnsgard 1983), peanuts, beans and other crops on migration (Meine and Archibald 1996), and wheat, chickpeas, alfalfa (Johnsgard 1983) and lucerne (Snow and Perrins 1998) in India (Johnsgard 1983, Snow and Perrins 1998). Breeding site The nest is a shallow scrape (Urban et al. 1986, Snow and Perrins 1998) (although often no attempt is made to find or construct a cavity) (Johnsgard 1983)on dry ground, lined or surrounded by pebbles and plant materials (eggs may be laid directly onto the ground) (del Hoyo et al. 1996). The nest may be placed on gravel (del Hoyo et al. 1996) in areas partially or entirely free of vegetation (Johnsgard 1983), or in open patches of grass and cultivation, usually less than 1-2 km away from a source of water (Johnsgard 1983, Urban et al. 1986). Nests are rarely positioned closer than 200-300 m apart (Johnsgard 1983).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found primarily in open spaces with a wide range of visibility, A. virgo lives in upland areas, unlike most other cranes which can be found in wetland habitat. Space and solitude are important for the maintenance of demoiselle cranes, therefore their habitats vary from semi-arid savannas, grasslands, and steppes, to high plateaus. They can also inhabit semi-deserts to true deserts as long as water is available within 200 to 500 meters. Ranging in habitat from sea level to 3,000 meters, they are usually found no farther than a few hundred meters away from rivers, for they need the source of water to survive. After migration, the wintering habitats of A. virgo include acacia savannas, grasslands, and riparian areas.

Range elevation: sea level to 3,000 m.

Range depth: N/A (low) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Foraging during the morning and the early afternoon, A. virgo are generalists and opportunists with respect to their diet and foraging behavior. With more efficient shorter bills and toes for feeding in dry uplands, croplands, and pastures, these birds hunt with their heads lowered to peck at the ground. Furthermore, demoiselle cranes are omnivores, consuming a wide variety of plant materials year round, and supplementing their diet with other animals. More specifically, demoiselles can be considered: carnivores, insectivores, molluscivores, folivores, frugivores, granivores. Precisely, their diet includes: seeds, leaves, acorns, nuts, berries, fruits, waste grains, small mammals, birds, insects, worms, snails, grasshoppers, beetles, snakes, lizards, and rodents.

Animal Foods: birds; mammals; reptiles; insects; mollusks; terrestrial worms

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As generalist omnivores and potential prey items, A. virgo interacts with many other species. Additionally, demoiselle cranes are hosts to parasites of various nematodes such as the Gapeworm, Capillarids, and Ascarids, which are all intestinal parasites. Coccidiosis is another parasite in chicks that infests the gut and visceral parts of the bird such as the heart, liver, kidneys, and lungs.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Little is known about the predators of this species. Little information is available regarding the predators of demoiselles other than those species that threaten the breeding territory of these cranes. Anthropoides virgo are fierce protectors of their nests, and will attack eagles (Aquila), and bustards (Otis tarda), and will give chase to foxes and dogs. Man can also be considered a predator, for even though hunting of this species is illegal, in areas with lacking resources, exceptions are made. Information on anti-predator adaptation, behavior, and structure, is sparse also. As mentioned previously, demoiselle cranes have numerous communication behaviors that assist in protecting them from predators, such as various threat postures, vocalizations, visualizations, the modification of the bill and toes for more efficient feeding and running, and the silver-gray coloration of the juvenile crane for camouflage, as well as their eggs that are yellow-green with lavender spots.

Known Predators:

Anti-predator Adaptations: aposematic ; cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Anthropoides virgo has elaborate methods of communication vocally, and visually. The voice of demoiselles is low and raspy, and has an extensive repertoire for communication that develops at an early age. There are several vocalizations that these cranes will make, including: contact calls, stress calls, food begging calls, guard calls, location calls, precopulatory calls, flight-intention calls, alarm calls, and the well known duet of the unison call. All of these vocalizations are crucial for the initiation, development and maintenance of a pair and for the social interaction and survival of the individual bird.

Visual communication is equally important. As mentioned earlier, the spectacular dancing of demoiselle cranes, is very contagious among flocks, and can be a displacement activity when nervous, or the performance of a courtship dance (See "Reproduction"). Other forms of expression include: threat postures, hissing, tail fluttering, feather ruffling, crouching, rigid strutting, ritualized preening of the back of the thigh, flapping, stamping, and growling. Appearing genetically determined, these displays are not learned socially from the instruction of the parents or other cranes. However, the object at which the display is oriented around is learned, and if a young demoiselle is more habituated to humans or other species, these displays will be directed more towards them.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity, the longevity of demoiselle cranes is at least twenty-seven years, though records do exist of particular cranes living a life of more than sixty-seven years! The lifespan of A. virgo in the wild is unknown presently. The marking of individuals for identification has been initiated only recently. Because life is more hazardous in the wild, the longevity of a demoiselle crane is predicted to be shorter than one living in captivity.

Range lifespan

Status: wild:
27 (high) years.

Average lifespan

Status: wild:
unknown years.

Range lifespan

Status: captivity:
67 (high) years.

Average lifespan

Status: captivity:
27 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27 years (captivity) Observations: In captivity, these animals appear to live up to 27 years (http://www.zoo.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system of A. virgo is monogamous. A male and a female will remain a pair for their entire lives. However, this remains true only if reproduction is successful, and reproduction is usually not successful until the age of four to eight years. The breeding season of demoiselle cranes coincides with the local rainy season, and usually takes place in the Eurasion Steppes from the Black Sea to Northeastern China.

Mating System: monogamous ; cooperative breeder

Duets and vocalizations are extravagant mating behaviors of A. virgo. To begin, the bond between two individual cranes is formed in non-breeding flocks or in mixed flocks outside of the breeding season. This bond can be created rapidly, or it can take months of interaction. Vocalizations have a critical role in the interaction, development and maintenance of pair bonds. Developed between the ages of two to three years, demoiselles have the ability to vocalize unison calls. These calls last from a few seconds to a minute, and they allow the partners to come into a breeding condition at the same time. Unison calls also are important for the ovarian development of the female. When vocalizing a unison call, demoiselle cranes have a distinct posture where both of the individuals call with their wings closed, although the female calls with her bill pointed upward, and the male calls with the bill held horizontally. Unison calls are used to help defend mates and individuals along with various other threat postures and actual attacks. Within the pair, the male maintains a role of defense, while the female deals with more domestic affairs.

Initiated by either sex, A. virgo also perform a dance before copulation. This courtship dance strengthens the bonds between mating pairs and synchronizes sexual response. Demoiselles are more energetic and more ballet-like in their dancing compared to other cranes. Their courtship dance consists of long, intricate sequences of bows, leaps, runs, short flights, and the picking up and throwing of random objects into the air. Spectator demoiselles will often join in these dances - circling the pair, dancing, and taking to flight.

Breeding interval: These cranes breed seaonally, on average producing one clutch. Little is known of the possibility of producing more than one clutch. Growth seasons are so short that there would be little time to fledge a second clutch in time fore the preperation for migration.

Breeding season: Breeding is seasonal, and directly coincides with the local rainy season. The nesting period has a duration of three to five months.

Average eggs per season: 2.

Range time to hatching: 27 to 29 days.

Range fledging age: 55 to 60 days.

Range time to independence: 8 to 10 months.

Range age at sexual or reproductive maturity (female): 4 to 8 years.

Range age at sexual or reproductive maturity (male): 4 to 8 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 2.

The cycle of reproduction has many stages. First, there is a three to five month nesting period, whereas the non-breeding period is much longer. Migrating between breeding grounds and wintering grounds, when in the breeding season, these birds nest in grasslands. Usually the nest is on the bare ground consisting of a few twigs and pebbles. On average, the clutch size of a demoiselle crane consists of two eggs that are yellow-green in color with spots of lavender. Both sexes assist with the incubation of the eggs over a period of twenty-nine days, however females perform the major part of the task. Protecting their nest, demoiselle cranes will chase dogs, foxes, and eagles without hesitation and will even receive help from several other birds to drive invaders away from the nest.

After the eggs hatch, a fledging period lasts for fifty-five to sixty days upland areas. This is the shortest fledging period out of all other cranes. Until the next breeding season, for eight to ten months immature cranes remain with their parents. After the Juvenile cranes leave their parents, they collect into non-breeding flocks and are nomadic, forging for food and roosting sites during the breeding season of the sexually mature adults. A young crane starts to exhibit adult like social behavior after eighteen months, and pairing can begin to occur, however reproduction is usually not successful until the demoiselle crane is four to eight years of age.

As discussed above, incubation lasts for a duration of twenty-seven to twenty-nine days, the fledging periods lasts from fifty-five to sixty days, and it is well up to eight to ten months before the juvenile crane is independent from his/her parents. Demoiselle cranes, like all cranes, exhibit a prolonged period of parental care. This care proceeds directly after hatching, where bill touching is iniciated by the chick, and frequently performed between chicks and parents. Associated possibly with direct feeding or begging, bill touching takes place for the chicks are fed by both parents. As the male typically takes the lead, followed by the female and chicks, gradually the adults lead the young to the food sources (rather than supplying them). The parents also provide protection for their young when enemies are encountered. Assuming an aggressive posture associated with intense threat, breeding demoiselles will utter alarm calls while directly attacking the enemy, or attempting diversionary displays while moving away from the nest.

  • Ellis, D., G. Gee, C. Mirande. 1996. Cranes: Their Biology, Husbandry, and Conservation. Washington, DC: Department of the Interior, National Biological Service.
  • Johnsgard, P. 1983. Cranes of the World. Bloominton, IN: Indiana University Press.
  • Meine, C., G. Archibald. 1996. The Cranes. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources.
  • 2000. "Demoiselle Crane" (On-line ). Animal Fact Sheets. Accessed 03/19/03 at http://zoo.org/educate/fact_sheets/dem_crane/dcrane.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anthropoides virgo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAATCTTCGGCGCATGGGCCGGCATAATTGGCACCGCTCTCAGCCTACTAATCCGCGCAGAACTCGGCCAACCAGGAAGCCTATTAGGGGACGACCAAATCTATAATGTAATCGTCACCGCCCACGCCTTCGTAATAATTTTCTTCATAGTCATACCCATCATGATTGGGGGGTTTGGAAATTGACTAGTCCCACTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAATATAAGCTTCTGACTCCTCCCTCCATCCTTTTTACTACTACTTGCCTCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACAGTCTACCCACCACTAGCCGGCAACCTAGCCCACGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTTCACTTAGCAGGTGTATCCTCCATTCTAGGGGCAATTAATTTCATCACAACGGCCATTAACATAAAACCACCAGCCCTATCACAATACCAAACACCCCTATTCGTGTGATCCGTCCTAATTACCGCCGTCCTATTACTGCTCTCTCTCCCAGTCCTTGCTGCTGGCATCACCATGTTACTAACAGACCGAAACCTCAATACTACATTCTTCGACCCTGCTGGAGGAGGAGATCCAGTCCTGTATCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anthropoides virgo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Grus virgo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATCGATGACTATTCTCAACCAACCACAAAGATATCGGAACCCTCTACCTAATCTTCGGCGCATGGGCCGGCATAATTGGCACCGCTCTC---AGCCTATTAATCCGCGCAGAACTCGGCCAACCAGGAAGCCTATTAGGGGAC---GACCAAATCTATAATGTAATCGTCACCGCCCACGCCTTCGTAATAATTTTCTTCATAGTCATACCCATCATGATTGGGGGGTTTGGAAATTGACTAGTCCCACTTATA---ATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAATATAAGCTTCTGACTCCTCCCTCCATCCTTTTTACTACTACTTGCCTCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACAGTCTACCCACCACTAGCCGGCAACCTAGCCCACGCCGGAGCTTCAGTAGACCTA---GCCATCTTCTCCCTTCACTTAGCAGGTGTATCCTCCATTCTAGGGGCAATTAATTTCATCACAACGGCCATTAACATTAAACCACCAGCCCTATCACAATACCAAACACCCCTATTCGTGTGATCCGTCCTAATTACCGCCGTCCTATTACTGCTCTCTCTCCCAGTCCTTGCTGCT---GGCATCACCATGTTACTAACAGACCGAAACCTCAATACTACATTCTTCGACCCTGCTGGAGGAGGAGATCCAGTCCTGTATCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGCTTTGGAATCATCTCACACGTAGTAACCTACTACGCAGGCAAAAAA---GAACCTTTTGGCTATATAGGAATAGTATGAGCTATACTATCCATTGGATTCCTAGGCTTCATCGTATGAGCCCACCATATATTTACAGTAGGAATAGACGTAGATACTCGAGCATACTTCACATCCGCTACCATAATCATTGCCATTCCAACTGGCATTAAAGTCTTTAGCTGATTA---GCTACACTACACGGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Grus virgo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are a variety of threats that affect the population of A. virgo, including:

Habitat Loss and Degradation:
  • Conversion of grasslands
  • Changes in agricultural land use
  • Dams and water diversion
  • Urban expansion and land development
  • Afforestation
  • Changes in vegetation
  • Pollution and Environmental contamination
  • Oil development
  • Collision with utility lines
Direct Exploitation:
  • Overhunting
  • Poaching
  • Live trapping for domestication and commercial trade
  • Poisoning

The future of demoiselle cranes is more stable and secure than other cranes species. Measures are being taken however to diminish the threats listed above. Conservation measures that have been successful thus far in benefiting A. virgo include increased:

  • Protection
  • Establishment of protected areas
  • Local surveys and studies of migration routes
  • Development of monitoring programs
  • Availability of Information exchange

The development of a public education programs in the breeding and migration ranges of demoiselle cranes, and the development of more specialized education programs involving hunters in Afghanistan and Pakistan are currently underway. These programs will assure more public awareness of this species, and will hopefully and eventually derive more support in the conservation of A. virgo.

The Cranes: Status Survey and Conservation Action Plan has looked at the conservation status of individuals in the six regional populations where demoiselle cranes are located. Their estimate is as follows:

  • The Atlas population:

    Critically endangered

  • The Black Sea population:

    Endangered

  • The Turkey population:

    Critically endangered

  • The Kalmykia population:

    Lower Risk

  • The Kazakhstan/Central Asia population:

    Lower Risk

  • The Eastern Asia population:

    Vulnerable

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.230,000-280,000 individuals (Wetlands International 2006), while the population in China has been estimated at c.100-10,000 breeding pairs and c.50-1,000 individuals on migration (Brazil 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Habitat loss and degradation from agriculture (e.g. agricultural conversion of steppe grassland (Ellis et al. 1996, del Hoyo et al. 1996), intensification of agricultural methods and changes in agricultural practices such as increased spring ploughing) (Meine and Archibald 1996) is the primary threat to this species throughout its range. Other threats include disturbance due to rising human populations (Ellis et al. 1996), intensive use of pesticides (Ellis et al. 1996, del Hoyo et al. 1996, Meine and Archibald 1996), hunting for sport (along the migration route in Afghanistan and Pakistan) (Meine and Archibald 1996), and shooting and intentional poisoning in some areas where crop damage occurs (Ellis et al. 1996, del Hoyo et al. 1996, Meine and Archibald 1996). Many migratory habitats have also been lost through the building of dams and the drainage of wetlands (Meine and Archibald 1996), and the breeding population in Morocco is threatened by over-grazing and mining (Meine and Archibald 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The only known adverse affect of A. virgo is that they will use cultivated lands because of the growing pressures on their natural habitat. Sometimes these cranes will cause conflict with farmers. Since the breeding grounds in the Eurasian Steppes are extremely appealing for agricultural development, demoiselle cranes have learned to successfully reproduce in agricultural fields. However, these birds can cause significant crop damage, inflicting serious damage to ripened millet and other crops in result of having to live in these fields. Two of the leading controversies that affect the population of this species are the poisoning and shooting of these birds, mainly by the adversely affected farmers.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The human relationship with A. virgo varies. Africans will raise demoiselle chicks as pets, these cranes are popular in the zoos of Europe and the Orient, and they are also hunted or trapped during migration for food, or for pets. The economic importance of demoiselle cranes is limited mostly to the food and pet trade.

Positive Impacts: pet trade ; food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Demoiselle Crane

The Demoiselle Crane (Anthropoides virgo) is a species of crane found in central Eurasia, ranging from the Black Sea to Mongolia and North Eastern China. There is also a small breeding population in Turkey. These cranes are migratory birds. Birds from western Eurasia will spend the winter in Africa whilst the birds from Asia, Mongolia and China will spend the winter in the Indian subcontinent. The bird is symbolically significant in the culture of North India, where it is known as the koonj.[2]

Characteristics[edit]

The Demoiselle is 85–100 cm (34–39 in) long, 76 cm (30 in) tall and has a 155–180 cm (61–71 in) wingspan. It weighs 2–3 kg (4.4–6.6 lbs). It is the smallest species of crane.[3][4] The Demoiselle Crane is slightly smaller than the Common Crane but has similar plumage. It has a long white neck stripe and the black on the foreneck extends down over the chest in a plume.

It has a loud trumpeting call, higher-pitched than the Common Crane. Like other cranes it has a dancing display, more balletic than the Common Crane, with less leaping.

Life[edit]

Individual from Tal Chhapar Sanctuary, Churu, Rajasthan

The Demoiselle Crane lives in a variety of different environments, including desert areas and numerous types of grasslands (flooded, mountain, temperate and tropical grassland) which are often within a few hundred metres of streams or lakes. However, when nesting, they prefer patchy areas of vegetation which is tall enough to conceal them and their nests, yet short enough to allow them look out for predators whilst incubating their eggs.

Demoiselle Cranes have to take one of the toughest migrations in the world. In late August through September, they gather in flocks of up to 400 individuals and prepare for their flight to their winter range. During their migratory flight south, Demoiselles fly like all cranes, with their head and neck straight forward and their feet and legs straight behind, reaching altitudes of 16,000-26,000 feet (4,875-7,925 m). Along their arduous journey they have to cross the Himalayan mountains to get to their over-wintering grounds in India. Many die from fatigue, hunger and predation from Golden Eagles. Simpler, lower routes are possible, such as crossing the range via the Khyber Pass. However, their presently preferred route has been hard-wired by countless cycles of migration. At their wintering grounds, Demoiselles have been observed flocking with Common Cranes, their combined totals reaching up to 20,000 individuals. Demoiselles maintain separate social groups within the larger flock. In March and April, they begin their long spring journey back to their northern nesting grounds.

In Khichan, Rajasthan in India, villagers feed the Cranes on their migration and these large congregations have become an annual spectacle.

The congregation of cranes in Khichan, Rajasthan
Demoisselle Crane.jpg

The Demoiselle Crane is evaluated as Least Concern on the IUCN Red List of Threatened Species. It is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Symbolism in North Indian culture[edit]

The Demoiselle Crane is known as the Koonj (कूंज, کونج, ਕੂੰਜ) in the languages of North India, and figure prominently in the literature, poetry and idiom of the region. Beautiful women are often compared to the koonj because its long and thin shape is considered graceful. Metaphorical references are also often made to the koonj for people who have ventured far from home or undertaken hazardous journeys.[5]

The name koonj is derived from the Sanskrit word kraunch, which is a cognate Indo-European term for crane itself.[2] In the mythology of Valmiki, the composer of the Hindu epic Ramayana, it is claimed that his first verse was inspired by the sight of a hunter kill the male of a pair of Demoiselle[citation needed] Cranes that were courting. Observing the lovelorn female circling and crying in grief, he cursed the hunter in verse. Since tradition held that all poetry prior to this moment had been revealed rather than created by man, this verse concerning the Demoiselle Cranes is regarded as the first human-composed meter.[6][dubious ]

The flying formation of the koonj during migrations also inspired infantry formations in ancient India. The Mahabharata epic describes both warring sides adopting the koonj formation on the second day of the Kurukshetra War.[7]

References[edit]

  1. ^ BirdLife International (2012). "Anthropoides virgo". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b R. K. Gaur, Indian birds, Brijbasi Printers, 1994, "... The smallest member of the crane family, the demoiselle crane (Anthropoides virgo ) is a distinctive looking bird, with ashy grey ... The local name for this crane — koonj — is onomatopoeic, deriving from the Sanskrit 'kraunch', the origin of the word crane itself ..." 
  3. ^ [1]
  4. ^ Ali, S. (1993). The Book of Indian Birds. Bombay: Bombay Natural History Society. ISBN 978-0-19-563731-1. 
  5. ^ Department of English, University of Delhi, The Individual and Society, Pearson Education India, 2005, ISBN 978-81-317-0417-2, "... kunj: more properly koonj is a demoiselle crane. The word is used metaphorically for a young bride far from her home ..." 
  6. ^ Dinkar Joshi, Yogesh Patel, Glimpses of Indian Culture, Star Publications, 2005, ISBN 978-81-7650-190-3, "... Valmiki saw a pair of kraunch (cranes) birds making love. Suddenly, a hunter killed the male kraunch with an arrow. Valmiki was moved by the cries of the female ... Valmiki's pain was expressed through a shloka ... The first man-composed meter ..." 
  7. ^ Ramesh Menon, The Mahabharata: A Modern Rendering, iUniverse, 2006, ISBN 978-0-595-40188-8, "... The second day: Two kraunchas ... Yudhishtira decides to form his legions in the vyuha called the krauncha, after the crane ..." 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!