Articles on this page are available in 1 other language: Spanish (18) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 15 years (captivity) Observations: Not much is known about the lifespan of these animals. They have been reported to live up to 15 years in captivity (http://www.zoo.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurypyga helias

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTACCTAATTTTCGGGGCATGAGCGGGGATAGTTGGCACAGCCCTAAGTCTCCTCATCCGCGCAGAACTTGGTCAACCCGGAACTCTCCTGGGAGATGACCAAATTTACAACGTAATTGTCACTGCCCATGCGTTTGTAATAATCTTTTTTATAGTTATACCTGTCATGATTGGCGGATTTGGCAACTGACTAGTACCCCTAATAATCGGAGCACCAGATATGGCATTCCCACGCATAAACAACATGAGCTTCTGACTGCTACCCCCCTCCTTCCTACTTCTCCTAGCATCATCCACTGTTGAAGCAGGAGCTGGCACAGGATGAACCGTATACCCGCCCCTAGCGGGCAATTTGGCTCATGCAGGAGCCTCTGTAGACCTGGCTATCTTCTCACTACATCTAGCAGGTGTATCCTCCATTCTTGGTGCGATCAACTTCATCACAACTGCCATCAACATAAAACCCCCAGCCTTGTCCCAATACCAAACACCATTGTTCGTTTGATCAGTCCTTATTACTGCCGTTCTTCTCCTCCTTTCACTCCCAGTCCTCGCTGCCGGCATCACCATGCTCCTCACAGATCGTAATCTAAACACCACCTTCTTCGACCCTGCTGGCGGAGGTGACCCAGTACTCTATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eurypyga helias

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sunbittern

The Sunbittern (Eurypyga helias) is a bittern-like bird of tropical regions of the Americas, and the sole member of the family Eurypygidae (sometimes spelled Eurypigidae) and genus Eurypyga. It ranges from Mexico to southern Peru, showing three extant subspecies. The Subbittern show both morphological and molecular similarities with the Kagu (Rhynochetos jubatus) of New Caledonia, indicating an gondwanic origin, being both placed in the clade Eurypygiformes.[2]

Contents

Taxonomy [edit]

The wing display of the Sunbittern is shared with the Kagu (Rhynochetos jubatus) of New Caledonia.

The Sunbittern is usually placed in the Gruiformes, but this was always considered preliminary. Altogether, the bird is most similar to another enigmatic bird that was provisionally placed in the Gruiformes, the Kagu (Rhynochetos jubatus).[3] Molecular studies seem to confirm that the Kagu and Sunbittern are each other's closest living relatives.[4][5] They are probably not Gruiformes (though the proposed Metaves are just as weakly supported).[6] Altogether, the two species seem to form a minor Gondwanan lineage which could also include the extinct adzebills and/or the mesites, and is of unclear relation to the Gruiformes proper. Notably, the Kagu and mesites also have powder down.

Subspecies [edit]

There were formerly two species (E. helias and E. major), but now E. helias is divided into three subspecies differentiated by plumage characters and size. The three subspecies are apparently allopatry.[2]

  • E. h. helias, live in the east of the Andes in lowland tropical South America, from the Orinoco basin, through the Amazonia.
  • E. h. major, it's found at higher altitudes ranging from southern Mexico to Ecuador.
  • E. h. meridionalis, occurs in southern central Peru, in the lower subtropical zone at 800–1830 m.

Description [edit]

Song

The bird has a generally subdued coloration, with fine linear patterns of black, grey and brown. Its remiges however have vividly colored middle webs, which with wings fully spread show bright eyespots in red, yellow, and black. These are shown to other sunbitterns in courtship and threat displays, or used to startle potential predators. Male and female adult Sunbitterns have can be differentiated by small differences in the feather patterns of the throat and head. Like some other birds, the Sunbittern has powder down.

The Sunbittern have a long and pointed bill, a short hallux as in shorebirds and rails, orange-yellow feet present in the lowland individuals in the east of the Andes, while the Central America species (E. h. major) are much redder.[2]

Distribution and habitat [edit]

The Sunbittern's range extends from Guatemala to Brazil, in the humid Neotropical forests, generally with and open understorey and near rivers and streams. The species may also be present in southern Mexico. It has been traditionally reported from the Atlantic slope of Chiapas, but no specimens are known and there have been no recent records.[7]

Behaviour and ecology [edit]

The Sunbittern is a non-migrant bird that is normally found foraging on the ground and scratching for insects. They are cryptic birds that display their large wings, that exhibits a pattern that resemble eyes, when they feel threatened. Sunbitterns start nesting in the early wet season and before it start they make flight displays 10–15 m high in the forest canopy. They build open nests in trees, and lay two eggs with blotched markings. The young are precocial, but remain in the nest for several weeks after hatching.[2][8]

References [edit]

  1. ^ BirdLife International (2012). "Eurypyga helias". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d del Hoyo, J. Elliott, A. & Sargatal, J. (editors). (1996) Handbook of the Birds of the World. Volume 3: Hoatzin to Auks. Lynx Edicions. ISBN 84-87334-20-2
  3. ^ Houde et al. (1997) Phylogeney and evolution of 12S rDNA in Gruiformes (Aves). In: Mindell, D. P. (ed.), Avian Molecular Evolution and Systematics. Academic Press, San Diego. Pp. 121–158.
  4. ^ Fain & Houde (2004) Parallel radiations in the primary clades of birds. Evolution 58(11): 2558–2573.
  5. ^ Ericson et al. (2006) Diversification of Neoaves: Integration of molecular sequence data and fossils. Biology Letters 2 (4): pp. 543–547
  6. ^ Morgan-Richards et al. (2008) Bird evolution: testing the Metaves clade with six new mitochondrial genomes. BMC Evolutionary Biology 8 (20).
  7. ^ Howell, Steve N. G. and Webb, Sophie (1995) A guide to the birds of Mexico and Northern Central America ISBN 0-19-854012-4
  8. ^ Archibald, George W. (1991). In Forshaw, Joseph. Encyclopaedia of Animals: Birds. London: Merehurst Press. p. 100. ISBN 1-85391-186-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!