Overview

Distribution

Range

C and e Brazil to Bolivia, Paraguay and central Argentina.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cariama cristata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTGTATCTAATCTTCGGTGCATGAGCTGGTATGATCGGCACTGCTCTCAGCCTCCTCATCCGTGCAGAGCTAGGCCAACCAGGTACCCTACTGGGAGACGACCAAATCTACAATGTAATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTGATGCCAATCATAATCGGCGGGTTCGGAAACTGACTAGTGCCGCTCATAATCGGAGCCCCTGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCGTCCCTTCTACTCCTACTAGCCTCCTCCACAGTAGAGGCAGGGGCAGGAACAGGATGAACAGTATACCCACCACTAGCCGGCAACCTAGCCCACGCTGGAGCCTCAGTAGACCTAACCATCTTCTCCCTCCACCTCGCAGGTGTATCCTCAATCCTAGGGGCAATCAACTTCATCACAACTGCCATCAACATAAAACCCCCTATTCTCTCACAATACCAAACACCCCTATTCGTATGATCTGTTCTCATCACAGCCGTCCTACTCCTACTCTCCCTACCCGTCCTCGCTGCCGGCATTACTATACTTCTAACAGACCGAAATCTAAACACTACATTCTTTGACCCTGCCGGAGGAGGGGATCCAGTCCTATACCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cariama cristata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-legged Seriema

The Red-legged Seriema or Crested Cariama (Cariama cristata) is a mostly predatory terrestrial bird in the seriema family (Cariamidae), included in the "Gruiformes" in the old paraphyletic circumscription, but increasingly placed in a distinct order Cariamiformes (along with three extinct families). The Red-legged Seriema inhabits grasslands from Brazil south of the Amazon to Uruguay and northern Argentina. The area over which it occurs is estimated at 5.9 million km², though the bird is not found everywhere in this region of course. The species is absent from the Mata Atlântica and planalto uplands along the coast of Brazil.[1]

Description[edit]

Close-up of Cariama cristata

It is 75 to 90 cm (30 to 36 in) long and weighs about 1.5 kg, with a fairly long neck, tail, and legs. The plumage is medium brown above with black markings; pale brown on the head, neck, and breast; and white on the belly. The tail has a black band near the tip and a white tip. The beak and legs are red, and the eyes are yellow. Soft feathers emerge from the base of the bill to form a fan-shaped crest.[2]

Many other characteristics are shared with the Black-legged Seriema (Chunga burmeisteri), the only other living member of its family. Some of these traits are discussed in the Cariamidae article.

The song has a quality described as "a cross between 'the serrated bark of a young dog and the clucking of turkeys'".[3] At the loudest part of the song, the bird has its neck bent so its head is touching its back. Both members of a pair as well as young down to the age of two weeks sing; often one member of a family starts a song just as another finishes, or two sing simultaneously. The song can be heard several kilometres away; in Emas National Park, Brazil, in 1981–1982, observers often heard four Red-legged Seriemas or groups singing at once.[4]

The full song consists of three sections:

  1. Repeated single notes at constant pitch (1,200 to 1,300 Hz) and duration but increasing tempo
  2. Repeated two- or three-note subphrases of slightly higher pitch with increasing tempo
  3. Subphrases of up to 10 notes, shorter ones rising in pitch and longer ones falling, two-subphrase combinations increasing in number of notes and tempo and then decreasing in tempo.

Ecology[edit]

The sickle claw of a red-legged seriema, used in fighting.

The Red-legged Seriema prefers grassland habitat to any other. Though it likes to inhabit lush meadows near rivers, it will not readily move into wetlands or crop fields.[5] It is usually seen singly or in pairs, but sometimes in groups up to four, apparently families. It typically walks on the ground and can easily run faster than a human in its habitat. It will flee a car on foot at speeds up to 25 km/h (15 mi/hr) before flying.[4]

In one conflict between two birds, they jumped at each other feet-first, keeping their balance by flapping.[4]

This species nests on the ground[2] or in a bush or tree up to 3 m above the ground. In the latter case adults jump into the nest rather than fly.[4]

Gallery[edit]

References[edit]

  1. ^ a b BirdLife International (2012). "Cariama cristata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Holyoak, David T. & Heinsohn, Robert (2003): Seriemas. In: Perrins, Christopher (ed.): Firefly Encyclopedia of Birds: 222. Firefly Books. ISBN 1-55297-777-3
  3. ^ H. Burmeister, quoted and translated by Redford & Peters (1986)
  4. ^ a b c d Redford, Kent H. & Peters, Gustav (1986). "Notes on the biology and song of the Red-legged Seriema (Cariama cristata)". Journal of Field Ornithology 57 (4): 261–269. 
  5. ^ Accordi, Iury Almeida & Barcellos, André (2006): Composição da avifauna em oito áreas úmidas da Bacia Hidrográfica do Lago Guaíba, Rio Grande do Sul [Bird composition and conservation in eight wetlands of the hidrographic basin of Guaíba lake, State of Rio Grande do Sul, Brazil]. Revista Brasileira de Ornitologia 14(2): 101–115 [Portuguese with English abstract]. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!