Overview

Brief Summary

Biology

Sri Lanka junglefowl roost in trees, usually singly but sometimes in pairs or family parties, and spend much of the day on the ground (3), foraging in the morning and evening along open tracks in the forest. This bird feeds on grain, weed seeds, berries, flowers, various succulent leaves and buds, and a large proportion of small animals, such as termites, beetles, woodlice, crickets and centipedes (2) (3). Animal matter forms the bulk of the diet for chicks (3). While the main breeding season is from February to May, a second clutch is often laid in August to September, and breeding appears to go on throughout the year (2) (3). Nests are constructed in a variety of locations, but typically occur on the ground amongst bushes or under logs, although use of a deserted squirrel and crows nest have been recorded, several metres above the ground. Clutches normally consist of two to four eggs, incubated for 20 to 21 days (in captivity) (2). The chicks are well developed and learn to scratch for food as soon as they leave the nest, although they will instantly scatter and hide at their mother's alarm call (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The handsome cocks of this endemic species, the national bird of Sri Lanka (3), are remarkably similar to those of domestic chickens (4). The longish plumage on the breast and upperparts is mainly a rich, fiery yellow to coppery orange with golden streaks, while the abdomen, flanks and bushy tail are a dark metallic purplish-black (2) (4) (5). The bare facial skin and two lappets hanging from the throat are red, and a fleshy red crest (comb) with central yellow patch adorns the crown (4) (5). In summer, after the main breeding season, males slowly moult and their comb shrinks in size (5). The female is much smaller than the male and has no lappets and only a tiny comb, a small purplish-black lump behind the beak (6). The hen is mostly brown with a darker tail and bold brown and buff barring on the wings (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Sri Lanka.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Native to Sri Lanka (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in a variety of habitats from coastal scrub to mountain forest, anywhere between sea level and 2,000 m (2). Although wary of man and normally not venturing far from cover, this bird will visit cultivated areas and plantations in search of food (7), and likes to frequent open places in wet weather, such as roadsides or glades, in order to feed free from drippings trees (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gallus lafayetii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTCTCAACCAACCACAAAGACATTGGCACTCTTTACCTAATTTTCGGCACATGGGCAGGCATAGCCGGCACAGCACTTAGCCTTCTAATTCGCGCAGAACTCGGACAACCCGGAACTCTCTTAGGAGACGACCAAATTTACAACGTAATCGTCACAGCCCATGCCTTCGTCATAATCTTCTTTATAGTCATACCCATCATGATCGGCGGCTTCGGAAATTGACTAGTCCCACTTATAATCGGTGCCCCAGACATAGCATTTCCCCGCATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCCTCCACCGTAGAAGCTGGGGCCGGTACAGGATGAACAGTCTACCCTCCCTTAGCCGGCAACCTAGCCCACGCTGGCGCATCAGTAGACCTAGCCATCTTTTCATTACACTTAGCCGGTGTTTCCTCCATCCTAGGAGCCATCAACTTTATCACCACCATCATCAACATAAAACCCCCCGCACTGTCACAATACCAAACACCCTTATTCGTATGATCCGTACTCATTACTGCCATCCTACTACTCCTCTCCTTACCAGTTCTAGCAGCTGGAATTACTATGTTACTTACCGACCGCAACCTTAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTTATTCTCCCAGGCTTTGGAATAATTTCCCATGTAGTAGCCTACTATGCAGGAAAAAAAGAACCATTCGGATACATGGGAATAGTCTGAGCCATACTCTCAATCGGATTCCTTGGCTTCATTGTATGAGCCCACCATATATTCACAGTCGGAATGGACGTAGACACCCGAGCCTACTTCACATCAGCCACAATGATCATTGCCATCCCTACTGGCATTAAAGTCTTCAGCTGACTAGCAACCCTGCACGGGGGGACAATTAAATGGGATCCCCCTATACTATGAGCCCTGGGGTTCATCTTCCTCTTCACTATCGGAGGCCTAACGGGAATCGTCCTTGCTAACTCATCACTAGATATTGCCCTTCATGACACCTACTATGTAGTCGCCCACTTCCACTATGTCCTCTCAATGGGGGCAGTTTTTGCCATTCTAGCAGGATTTACCCACTGATTTCCCCTCTTCACAGGCTTTACCCTACACCCATCATGAACCAAGGCACATTTCGGAGTAATATTTACCGGAGTTAACCTAACCTTTTTCCCCCAACATTTCCTGGGCCTAGCTGGAATACCCCGACGATACTCAGATTACCCAGACGCCTACACACTATGAAACACACTATCCTCAATCGGCTCCTTAATTTCAATAACAGCCGTAATCATACTCATATTCATCGTCTGAGAAGCCTTCTCAGCAAAACGAAAAGTACTCCAACCCGAATTAACTGCCACTAATATCGAATGAATTCATGGCTGCCCACCCCCATACCACACCTTCGAAGAACCAGCCTTTGTACAAGTGCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gallus lafayetii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a restricted range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List 2006 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as locally plentiful (Madge and McGowan 2002).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

The Sri Lanka junglefowl is not currently threatened, and appears to tolerate human disturbance and habitat degradation well (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

There are currently no conservation measures targeting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sri Lankan junglefowl

The Sri Lankan junglefowl (Gallus lafayettii), also known as the Ceylon junglefowl, is a member of the Galliformes bird order which is endemic to Sri Lanka, where it is the national bird. It is closely related to the red junglefowl (G. gallus), the wild junglefowl from which the chicken was domesticated. The specific name of the Sri Lankan junglefowl commemorates the French aristocrat Gilbert du Motier, marquis de La Fayette. In Sinhala it is known as වළි කුකුළා (Wali Kukula)[2] and in Tamil it is known as இலங்கைக் காட்டுக்கோழி.

Description[edit]

Female at Sinharaja Forest Reserve, Sri Lanka

As with other junglefowl, the Sri Lankan junglefowl is strongly sexually dimorphic: the male is much larger than the female, with more vivid plumage and a highly exaggerated wattle and comb.

The male Sri Lankan junglefowl ranges from 66–72 cm (26–28 in) in length[3] and 790–1,140 g (1.74–2.51 lb) in weight, essentially resembling a large, muscular rooster.[4] The male has orange-red body plumage, and dark purple to black wings and tail. The feathers of the mane descending from head to base of spine are golden, and the face has bare red skin and wattles. The comb is red with a yellow centre. As with the green junglefowl, the cock does not possess an eclipse plumage.

The female is much smaller, at only 35 cm (14 in) in length and 510–645 g (1.124–1.422 lb) in weight, with dull brown plumage with white patterning on the lower belly and breast, ideal camouflage for a nesting bird.[4]

Classification[edit]

This is one of four species of birds in the genus Gallus. The other three members of the genus are red junglefowl (G. gallus), grey junglefowl (G. sonneratii), and green junglefowl (G. varius).

The Sri Lankan junglefowl is most closely related to the grey junglefowl,[5] though physically the male resembles the red junglefowl. Female Sri Lanka junglefowl are very similar to those of the grey junglefowl. Like the green junglefowl, Sri Lankan junglefowl are island species that have evolved side by side with their similarly stranded island predators and competitors. Uniquely complex anti-predator behaviors and foraging strategies are integral components in the long evolutionary story of the Sri Lankan junglefowl.

Behaviour[edit]

As with other junglefowl, Sri Lanka junglefowl are primarily terrestrial. It spends most of its time foraging for food by scratching the ground for various seeds, fallen fruit and insects.

It lays 2-4 eggs in a nest either on the forest floor in steep hill country or in the abandoned nests of other birds and squirrels. Like the Grey and green junglefowl, male Sri Lankan junglefowl play an active role in nest protection and chick rearing.

Reproduction[edit]

Gallus lafayetii.jpg

The reproductive strategy of this species is best described as facultative polyandry, in that a single female is typically linked with two or three males that form a pride of sorts. These males are likely to be siblings. The female pairs with the alpha male of the pride and nests high off the ground.

Her eggs are highly variable in colour but generally are cream with a yellow or pink tint. Purple or brownish spots are common.

Occasionally a female will produce red eggs or blotched eggs.

The hen incubates her eggs, while the alpha male guards her nest from a nearby perch during the nesting season. The beta males remain in close proximity as well guarding the nesting territory from intruders or potential predators, such as rival males, or snakes and mongooses. Sri Lankan junglefowl are unique amongst the junglefowl in the brevity of their incubation, which may be as short as twenty days as contrasted with the 21–26 days of the green junglefowl.

The chicks require a constant diet of live food, usually insects and isopods such as sowbugs and pillbugs. In particular, the juveniles of land crabs are also highly important to the growth and survivability of the juvenile and subadult Sri Lankan junglefowl. In captivity this species is particularly vulnerable to pulloram and other bacterial diseases common in domestic poultry.

The chicks, and to a slightly lesser extent the adults, are incapable of utilizing vegetable-based proteins and fats. Their dietary requirements can not be met with commercial processed food materials. As a result they are exceedingly rare in captivity.

Habitat[edit]

It is common in forest and scrub habitats, and is commonly spotted at sites such as Kitulgala, Yala and Sinharaja.

References[edit]

  1. ^ BirdLife International (2012). "Gallus lafayetii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ http://www.bnhsenvis.nic.in/pdf/vol%203%20(1).pdf
  3. ^ del Hoyo, J. Elliott, A. and Sargatal, J. Handbook of the Birds of the World Lynx Edicions, Barcelona
  4. ^ a b CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  5. ^ International Chicken Polymorphism Map Consortium Wong, GK et al. (2004). "A genetic variation map for chicken with 2.8 million single-nucleotide polymorphisms". Nature 432: 717–722. doi:10.1038/nature03156. PMC 2263125. PMID 15592405. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!