Overview

Distribution

Range

Java, Bali, Lombok, Sumbawa, Flores and Alor islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gallus varius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCAACCAACCACAAAGACATTGGCACTCTCTACCTAATTTTCGGCACATGGGCAGGCATAGCCGGCACAGCACTTAGCCTCCTAATTCGCGCAGAGCTAGGACAGCCCGGAACTCTCTTAGGAGAC---GACCAAATTTACAACGTAATCGTCACAGCCCATGCCTTCGTCATAATCTTCTTTATAGTAATACCCATCATGATCGGCGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCAGACATAGCATTCCCCCGCATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCATCTACCGTAGAAGCTGGGGCCGGCACAGGATGGACAGTTTACCCCCCTTTAGCCGGCAACCTAGCCCACGCTGGCGCATCAGTAGACCTAGCCATCTTTTCATTACACTTAGCAGGTGTTTCCTCCATTCTAGGAGCCATCAACTTTATCACTACCATCATCAACATAAAACCCCCCGCACTGTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATTACTGCCATCCTACTACTCCTCTCCTTACCCGTCCTAGCAGCTGGGATTACCATACTACTTACCGACCGCAACCTTAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGTCACCCCGAAGTTTACATCCTCATCCTCCCAGGTTTCGGAATAATTTCCCACGTAGTAGCATACTATGCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTCTGAGCCATACTGTCAATCGGATTCCTTGGCTTCATTGTATGAGCCCACCATATATTCACAGTCGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gallus varius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as locally common in suitable habitat throughout its range (Madge and McGowan 2002).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Green Junglefowl

The green junglefowl (Gallus varius), also known as Javan junglefowl, forktail or green Javanese junglefowl, is a medium-sized (up to 75 cm long) bird in the pheasant family Phasianidae. Recent molecular work (Kimball et al., Barrowclough) has revealed that junglefowl and pheasants are not monophyletic.[clarification needed]

Description[edit]

The colouration of the green junglefowl is sexually dichromatic. The male's plumage is dark and blackish at a distance. A closer view will reveal an iridescent mantle of gleaming scales reminiscent in colour and pattern to those seen in the ocellated turkey and green peafowl. Each scale is vivid blue at its base and moves through various shades of gold and bronzed green. Specialized plumes framing the throat of the male green junglefowl are highly light reflective and appear violet at the proximal and sky blue at the distal edges. The lesser coverts of the wing are a striking burned orange with bronzed black centers. The distal edges of the greater secondary coverts are vivid ocher.

Like its cousin the red junglefowl, the breast and ventral regions are a dense light absorbing black. Like its closer relative the Ceylon junglefowl, the male green junglefowl exhibits vivid 'windows' of bare facial skin that contrast against the dark scarlet red of the face. The green junglefowl exhibits an ice blue center in its comb. A region of electric yellow facial skin extends below each ear, delineating the plumed hackles from gular lappet. Its head is topped by a light blue comb, which turns purple or red towards the top. Its wattle is also of the same colour but is bordered with blue on the edges and yellow closer to the throat. The female is mostly brown with occasional green feathers and has no comb.

female

Distribution and habitat[edit]

The green junglefowl is endemic to Java, Bali, Lombok, Komodo, Flores, Rinca and small islands linking Java with Flores, Indonesia. It has been introduced to the Cocos (Keeling) Islands where there is a small wild population. It is found from a natural altitude of 0 – 2000 m in subtropical/tropical lowland moist forest, shrubland and arable land.

Behaviour[edit]

The green junglefowl usually lives in groups of two to five in the wild led by a dominant male, who takes the flock to feed and drink and then back into the cover of the forest. In the night the flock roosts in bamboo stands at 15–20 feet above the forest floor. In the breeding season the dominant males in each flock are challenged by other males without flocks. The two males clap their wings and crow loudly while fighting each other with their spurs.

Relationship with humans[edit]

The green junglefowl is being maintained and increasingly bred in captivity as its genetic diversity is disappearing. This is because these birds are bred with domestic chickens by many people, producing a hybrid known as the bekisar. The bekisar has become very popular in the East Java province and has become the mascot-bird of the area. Therefore the green junglefowl requires more protected conditions than chickens. However, it is known to be able to fly more strongly than chickens,

The captive green junglefowl requires warm aviaries with lots of foliage and cover due to their shy nature and are fed with grains and seeds, as well as fruit and insects as these are the same type of food they would feed on in the wild. This bird has also been known for a long time as a pet animal because of its beauty and unique call.

Status and conservation[edit]

The green junglefowl is evaluated as Least Concern on the IUCN Red List of Threatened Species.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Bekisar

The Bekisar, or Ayam Bekisar, is the first generation hybrid offspring of the Green Junglefowl (Gallus varius) and domesticated Red Junglefowl from Java (Gallus gallus bankiva). The roosters have a glossy blackish green plumage and are highly prized for their loud clear calls and striking colouration, while the hens are usually dull and infertile.

Bekisars were traditionally used by the original inhabitants of the Sunda Islands as symbolic or spiritual mascots on outrigger canoes, and consequently spread over a wide area. The original hybrids are rarely fertile (and hens are generally sterile), but backcrosses with domestic chicken are sometimes achieved and thus several landraces of Pacific chickens have some Bekisar ancestry. While the hybrid is only of historical interest in most regions, on Java it is still being produced as a more stereotyped breed with several local varieties, known as Ayam Bekisar.

History[edit]

Background[edit]

The wild Green Junglefowl is a mangrove forest adapted species. Unlike the Red Junglefowl, the ancestor of most domestic chickens, it is adapted for life with little fresh water. During the dry season, and also on arid volcanic islands, the Green Junglefowl gets most of its water from dew in the coastal fog on fruits and insects. It also feeds on aquatic animals washed up on the shores and littoral pools, which Red Junglefowl are unable to do. At low tide, Green Junglefowl forage for starfish, small crabs, copepods and detritus. At high tide they fly to mangrove islets to roost. The far-carrying cries of the male Green Junglefowl can be heard over the breakers, even though their calls' volume is quite low in comparison to that of a domestic fowl or Red Junglefowl.

Hybridisation[edit]

The practice of hybridisation is so ancient that it is not known precisely where it began. Modern Sundanese and Javanese people claim that it first occurred in the Kangean Islands in the Java Sea. The native peoples of the Sunda Archipelago learned that they could persuade young, unpaired wild Green Junglefowl males to mate with domestic game hens.

Development[edit]

æneus-type Ayam Bekisar

The progeny were used for communication between canoes. Each rooster has a unique voice, due to its hybrid ancestry. A rooster would be selected for its unusual voice, and hoisted up the mast of the canoe in a special bamboo basket. From their elevated baskets the roosters crowed incessantly in prolonged shrieking matches. The calls combine the prolonged notes of the Green Junglefowl with the added volume of domestic fowl, whose wild ancestors' voices had to be heard through dense vegetation. The Bekisar's voice can often be heard for two miles over the sea. The seafaring cultures took to keeping these male Bekisars on their canoes at all times.

Spread[edit]

When the native peoples of Java and the Sunda Islands migrated to Oceania and beyond, they brought with them dogs, pigs, yams, coconuts and chickens. Each migration brought a few dozen semi-domestic game fowl, not unlike those seen today running feral in tropical Asian villages. Anthropologists have provided evidence that only a very few boats in any flotilla carried domestic animals. Each seafaring vessel would, however, have carried at least two or three cages with Bekisars aboard. The chieftain and warriors may have carried even more Bekisars on each of their vessels.

Nearly every new migration of seafaring people brought game fowl (the semi-domestic chickens descended from the Indonesian Red Junglefowl Gallus bankiva) to their new island homes. The Bekisar roosters were also present in sufficient number to significantly impact each island's native base population of feral fowl. An escaped Bekisar was next to impossible to capture. A Bekisar rooster released into a tropical mangrove forested island in Oceania or the South Pacific would easily re-adapt to the wild, as if it were a wild Green Junglefowl.

Establishment of feral populations[edit]

Many of the more remote, typhoon-prone islands with very small or failed human colonies are the naturalized homes of wild junglefowl, described as Violaceous Junglefowl by early European naturalists and considered a new species. Backcrossing of many generations of the hybrid Bekisar males with feral domestic game hens must occur before fertile females are produced. Female hybrid offspring of Green Junglefowl crossed with domestic fowl are always sterile, laying eggs which are incapable of being fertilized by either Green or Red Junglefowl, or by domestic fowl. This means that backcrossing would be a common mode of self-perpetuation.

When competing clans, tribal wars, disease and typhoons extirpated or very nearly exterminated human populations or forced migrations, feral fowl, pigs and dogs would often remain on these remote islands. Natural predators such as monitor lizards, seabirds, pythons and other predators would hunt out the feral chickens with the most domesticated traits. Those incapable of flying or running rapidly would not live long enough to reproduce. Those incapable of surviving long periods without fresh water would also perish, and those lacking the appropriate instincts to survive frequent typhoons would also be selected against.

Local adaptation[edit]

The Bekisar, with the progeny they generated by interbreeding with feral chickens, have adapted to local conditions. With each successive generation of backcrossing, the odds of a fertile hybrid female increases. At a certain point a genetic equilibrium is reached, and a fresh generation of viable females, capable of reproducing, is produced. Over the long run, some of the more remote islands, such as New Caledonia, Ponape, Marquesas, Rapa and Rapa Nui, became populated with flocks unique in appearance, not closely resembling either parental form.

When successive migrations of Polynesians carrying domestic fowl (derived from Red Junglefowl) appeared on these islands, most of the Violaceous traits vanished through genetic swamping, only persisting on the most isolated islands. From these isolated island populations unique breeds have developed, in particular on Ponape, the Marquesas and Rapa Nui (Easter Island). The famous Araucana hens, named after the Araucanian Indians of Chile, are derived from these breeds. These breeds produce tinted blue, grey, lilac and green eggs. The Green Junglefowl is the only species of junglefowl that produces tinted eggs.

In popular culture[edit]

The Bekisar is the faunal symbol of East Java, a province of Indonesia. The male is used in East Java, Bali and the surrounding islands in popular vocal competitions; this practice has caused the decline of wild Green Junglefowl populations.

References[edit]

  • Beebe, William. Monograph of the Phasianidae.
  • Blackwood, Kermit. Ayam Bekisar.[1]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!