Overview

Distribution

Range

Peninsular India.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gallus sonneratii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGACATTGGCACTCTTTACCTAATTTTCGGCACATGGGCGGGCATAGCCGGCACAGCACTTAGCCTTCTAATCCGCGCAGAACTAGGACAGCCCGGAACTCTCTTAGGAGAC---GACCAAATTTACAATGTAATCGTCACAGCCCATGCTTTCGTCATAATCTTCTTTATAGTTATACCCATCATGATCGGTGGCTTCGGAAACTGACTAGTCCCGCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGCATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCATCTACCGTAGAAGCTGGGGCCGGCACAGGATGGACAGTTTACCCCCCTTTAGCCGGCAACCTAGCCCACGCTGGCGCATCAGTAGACCTAGCCATCTTTTCATTACACTTAGCAGGTGTTTCCTCCATTCTAGGAGCCATCAACTTTATCACTACCATCATCAACATAAAACCCCCCGCACTGTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATTACTGCCATCCTACTACTCCTCTCCTTACCCGTCCTAGCAGCTGGGATTACCATACTACTTACCGACCGCAACCTTAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGTCACCCCGAAGTTTACATCCTCATCCTCCCAGGTTTCGGAATAATTTCCCACGTAGTAGCATACTATGCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTCTGAGCCATACTGTCAATCGGATTCCTTGGCTTCATTGTATGAGCCCACCATATATTCACAGTCGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gallus sonneratii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as locally common throughout much of its range (Madge and McGowan 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey Junglefowl

The Grey Junglefowl (Gallus sonneratii), also known as Sonnerat's Junglefowl, is a wild relative of domestic fowl that is endemic to India. This species is found mainly in peninsular India and where it overlaps with the distribution of the Red Junglefowl, it is known to form hybrids. The calls are loud and distinctive and they are hunted for meat and the long neck hackle feathers that are sought after for making fishing lures.

Contents

Description

GreyJunglefowl.jpg
Painting by John Gould

The male has a black cape with ochre spots and the body plumage on a grey ground colour is finely patterned. The elongated neck feathers are dark and end in a small, hard, yellowish plate; this peculiar structure making them popular for making high-grade artificial flies.[2] The male has red wattles and combs but not as strongly developed as in the Red Junglefowl. Legs of males are red and have spurs while the yellow legs of females usually lack spurs.[3][4] The central tail feathers are long and sickle shaped. Males have an eclipse plumage in which they moult their colourful neck feathers in summer during or after the breeding season.[5] The female is duller and has black and white streaking on the underparts and yellow legs. They are found in thickets, on the forest floor and open scrub. Their loud calls of Ku-kayak-kyuk-kyuk can be heard in the early mornings and at dusk. Unlike the Red Junglefowl, the male does not flap its wing before uttering the call.[6] They forage in small mixed or single sex groups. They breed from February to May.[3] They lay 4 to 7 eggs which are pale creamy in a scrape. Eggs hatch in about 21 days. Although mostly seen on the ground, Grey Junglefowl fly into trees to escape predators and to roost. About this sound Call of maleAbout this sound Other callsAbout this sound calls They feed on grains including bamboo seeds, berries, insects and termites.

The populations from the Mt. Abu region of Rajasthan named as subspecies wangyeli is usually not recognized[7] although it is said that the calls of the cock from this region differs from the call of birds from southern India and the plumage is much paler.[8]

The species epithet commemorates the French explorer Pierre Sonnerat. Local names include Komri in Rajasthan, Geera kur or Parda komri in Gondi, Jangli Murghi in Hindi, Raan kombdi in Marathi, Kattu Kozhi in Tamil and Malayalam, Kaadu koli in Kannada and Tella adavi kodi in Telugu.[9]

Distribution

The species is mainly in the Indian Peninsula but extends into Gujarat, Madhya Pradesh and south Rajasthan. This species and the Red Junglefowl overlap slightly along the northern boundary of the distribution[3] although the ranges are largely non-overlapping.[8]

Evolution and status

The Grey Junglefowl is found mostly in Peninsular India, while the Red Junglefowl is found more along the foothills of the Himalayas. A region of overlap occurs in the Aravalli range. The species has been isolated by a variety of mechanisms including behavioural differences and genic incompatibility but hybridization is not unknown.[10][11] Some phylogenetic studies of Junglefowl show that this species is more closely related to the Ceylon Junglefowl Gallus lafayetii than to the Red Junglefowl, Gallus gallus[12] but another study shows a more ambiguous position due to hybridization.[13] An endogenous retroviral DNA sequence, of the EAV-HP group noted in domestic fowl is also found in the genome of this species pointing to the early integration of the virus DNA into the genome of Gallus.[14]

A study in southern India found a density of 19.8 groups per square kilometer (but ranging from 1.67 to 34.42 in dry deciduous forests on plains) with an average group size of 1.3. The male to female ratio was 1:1.2 and the preferred habitat was low to moderate canopied forest with low or no grass cover.[15]

They are threatened by hunting for food and habitat loss. Feather use in fly-fishing has also been suggested as a threat.[16]

References

  1. ^ BirdLife International (2009). Gallus sonneratii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 9 October 2010.
  2. ^ "Identification Notes". US Fish and Wildlife. 
  3. ^ a b c Rasmussen PC & JC Anderton (2005). Birds of South Asia: The Ripley Guide. Volume 2. Smithsonian Institution and Lynx Edicions. p. 132. 
  4. ^ Editors (1954). "Occurrence of spurs in the female Junglefowl (Gallus sonnerati)". J. Bombay Nat. Hist. Soc. 52 (2–3): 603–604. 
  5. ^ Morejohn, G. V. (1968). "Study of the plumage of the four species of the genus Gallus". The Condor 70 (1): 56–65. doi:10.2307/1366508. JSTOR 1366508. 
  6. ^ Finn, Frank (1911). The game birds of India and Asia. Thacker, Spink and Co., Calcutta. pp. 21–23. 
  7. ^ Storer, RW (1988). Type Specimens of Birds in the Collections of the University of Michigan Museum of Zoology. University of Michigan, Miscellaneous publications No. 174. 
  8. ^ a b Ali S & SD Ripley. Handbook of the birds of India and Pakistan. Volume 2 (2 ed.). Oxford University Press. pp. 106–109. 
  9. ^ Anonymous (1998). "Vernacular Names of the Birds of the Indian Subcontinent" (PDF). Buceros 3 (1): 53–109. 
  10. ^ Eriksson J, Larson G, Gunnarsson U, Bed'hom B, Tixier-Boichard M, et al. (2008). "Identification of the Yellow Skin Gene Reveals a Hybrid Origin of the Domestic Chicken". In Georges, Michel. PLoS Genetics 4 (2): e1000010. doi:10.1371/journal.pgen.1000010. 
  11. ^ Morejohn, G. Victor (1968). "Breakdown of Isolation Mechanisms in Two Species of Captive Junglefowl (Gallus gallus and Gallus sonneratii)". Evolution 22 (3): 576–582. doi:10.2307/2406881. JSTOR 2406881. 
  12. ^ Fumihito, Akishinonomiya ; Tetsuo Miyake, Masaru Takada, Ryosuke Shingut, Toshinori Endo, Takashi Gojobori, Norio Kondo, And Susumu Ohno (1996). "Monophyletic origin and unique dispersal patterns of domestic fowls". Proc. Natl. Acad. Sci. 93 (13): 6792–6795. doi:10.1073/pnas.93.13.6792. PMC 39106. PMID 8692897. 
  13. ^ Nishibori, M. ; Shimogiri, T. ; Hayashi, T. ; Yasue, H. (2005). "Molecular evidence for hybridization of species in the genus Gallus except for Gallus varius". Animal Genetics 36 (5): 367–375. doi:10.1111/j.1365-2052.2005.01318.x. PMID 16167978. 
  14. ^ Sacci, MA; K Howes & K Venugopal (2001). "Intact EAV-HP Endogenous Retrovirus in Sonnerat's Jungle Fowl". Journal of Virology 75 (4): 2029–2032. doi:10.1128/JVI.75.4.2029-2032.2001. PMC 115153. PMID 11160706. 
  15. ^ Sathyakumar, S (2006). "Habitat use by Grey Junglefowl Gallus sonneratii Temminck at Mundanthurai Plateau, Tamil Nadu". J. Bombay Nat. Hist. Soc. 103 (1): 57–61. 
  16. ^ Wayre,P (1976). "Sonnerat's - a junglefowl threatened by fishermen". Newsletter for Birdwatchers 16 (5): 1–3. 

Other sources

  • "Chapter 1". Literature Survey of Grey Junglefowl. p. 1-12. 
  • Tehsin,Raza H (1988) Inducing sleep in birds. J. Bombay Nat. Hist. Soc. 85(2):435-436.
  • Chitampalli,MB (1977) Occurrence of Grey Junglefowl and Red Junglefowl together. J. Bombay Nat. Hist. Soc. 74(3):527.
  • Abdulali,Humayun (1957) The Grey Junglefowl in Salsette. J. Bombay Nat. Hist. Soc. 54(4):946.
  • Tehsin,Raza; Tehsin,Fatema (1990) Jungle Cat Felis chaus and Grey Junglefowl Gallus sonneratii. J. Bombay Nat. Hist. Soc. 87(1):144.
  • Morris,RC (1927) A jungle fowl problem. J. Bombay Nat. Hist. Soc. 32(2):374.
  • Sethna, KR (1969). "Grey Junglefowl in South India". Newsletter for Birdwatchers 9 (11): 10. 
  • Ali,S (1968) The case of the Indian Grey Junglefowl. Newsletter for Birdwatchers. 8(5):5-6.
  • Subramanian,C; Kambarajan,P; Sathyanarayana,MC (2001) Roosting tree preference by Grey Junglefowl, (Gallus sonneratti) at Theni Forest Division, Western Ghats, Tamil Nadu, south India. Mor 4(February), 9:11.
  • Zacharias,VJ (1993) Grey Jungle Fowl in Kerala. WPA-India News 1(1):9-10.
    • Narasimmarajan et al. (2012) population density and group size of the Grey Junglfowl (Gallus sonneratti)in the Melghat tiger reserve, Maharashtra, central India. journal of threatened taxa. 4(7): 2723–2726.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!