Overview

Comprehensive Description

Summary

"A wild relative of the domestic fowl, it is found mostly in peninsular India. Usually seen foraging in mixed or single sex groups."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Peninsular India.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"General effect of the cock streaked grey, with a metallic black sickle-shaped tail. Hen distinguishable at a glance from that of the Red Jungle-fowl by her white (not rufous-brown) breast with blackish streaks."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

That of the village hen or murghi.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Seen singly, pairs or small parties in forest and scrub jungle."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The Grey Jungle-fowl is also a denizen of forest, both deciduous and evergreen, hill and plain. It is especially partial to broken foothills country with bamboo jungle, and to the thick tangles of Lantana and secondary scrub that invariably spring up on old toungya clearings and abandoned plantations. It is usually met with singly or in pairs or small parties, though occasionally large numbers collect to feed in areas such as where bamboos or Strobilanthes are seeding. The habits of the two species are very similar, but this is perhaps even shier and more timid than the Red Jungle-fowl. When emerging into the open to feed in the mornings and evenings it seldom strays far from cover, scuttling headlong into it with outstretched neck and drooping tail on the least suspicion. Where unmolested, however, the birds become quite inured to the presence of Man, feeding in the proximity of villages and in fields under the plough. Its diet comprises of grain, shoots, and berries such as those of Lantana and Zizyphus, gleaned on the ground. It also eats termites and other insects. The crow of this Jungle-fowl has been well described as Kuck-kaya-kaya-kuck ending with a low kyukun-kyukun repeated slowly and softly and audible only at short range. It is heard principally in the early mornings — often long before daybreak—and evenings, sometimes continuing into the dark. It is uttered from the top of an ant-hill, stone or fallen log, or from the nightly roost up in a tree or bamboo clump. The crowing is usually preceded by a loud flapping of wings against the sides, and is answered one by one by all the other cocks in the neighbourhood. It is not definitely known whether this species is monogamous or otherwise."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"Eggs and young may be found practically throughout the year, but the principal laying months are from February to May. The nest and its situation are similar to those of the Red Jungle-fowl. The normal clutch is of 4 to 7 eggs, pale fawn to warm buff in colour, very like those of the domestic fowl in appearance. The hen alone incubates."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gallus sonneratii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGACATTGGCACTCTTTACCTAATTTTCGGCACATGGGCGGGCATAGCCGGCACAGCACTTAGCCTTCTAATCCGCGCAGAACTAGGACAGCCCGGAACTCTCTTAGGAGAC---GACCAAATTTACAATGTAATCGTCACAGCCCATGCTTTCGTCATAATCTTCTTTATAGTTATACCCATCATGATCGGTGGCTTCGGAAACTGACTAGTCCCGCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGCATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCATCTACCGTAGAAGCTGGGGCCGGCACAGGATGGACAGTTTACCCCCCTTTAGCCGGCAACCTAGCCCACGCTGGCGCATCAGTAGACCTAGCCATCTTTTCATTACACTTAGCAGGTGTTTCCTCCATTCTAGGAGCCATCAACTTTATCACTACCATCATCAACATAAAACCCCCCGCACTGTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATTACTGCCATCCTACTACTCCTCTCCTTACCCGTCCTAGCAGCTGGGATTACCATACTACTTACCGACCGCAACCTTAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGTCACCCCGAAGTTTACATCCTCATCCTCCCAGGTTTCGGAATAATTTCCCACGTAGTAGCATACTATGCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTCTGAGCCATACTGTCAATCGGATTCCTTGGCTTCATTGTATGAGCCCACCATATATTCACAGTCGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gallus sonneratii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red List Category & Criteria: Least Concern ver 3.1
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as locally common throughout much of its range (Madge and McGowan 2002).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grey junglefowl

The grey junglefowl (Gallus sonneratii), also known as Sonnerat's junglefowl, is a wild relative of domestic fowl that is endemic to India. This species is found mainly in peninsular India and towards the northern boundary, it sometimes hybridizes in the wild with red junglefowl. They hybridize readily in captivity and sometimes with free-range domestic fowl kept in habitations close to forests. The calls are loud and distinctive and they are hunted for meat and the long neck hackle feathers that are sought after for making fishing lures.

Description[edit]

Painting by John Gould

The male has a black cape with ochre spots and the body plumage on a grey ground colour is finely patterned. The elongated neck feathers are dark and end in a small, hard, yellowish plate; this peculiar structure making them popular for making high-grade artificial flies.[2] The male has red wattles and combs but not as strongly developed as in the red junglefowl. Legs of males are red and have spurs while the yellow legs of females usually lack spurs.[3][4] The central tail feathers are long and sickle shaped. Males have an eclipse plumage in which they moult their colourful neck feathers in summer during or after the breeding season.[5] The female is duller and has black and white streaking on the underparts and yellow legs. They are found in thickets, on the forest floor and open scrub. Their loud calls of Ku-kayak-kyuk-kyuk can be heard in the early mornings and at dusk. Unlike the red junglefowl, the male does not flap its wing before uttering the call.[6] They forage in small mixed or single sex groups. They breed from February to May.[3] They lay 4 to 7 eggs which are pale creamy in a scrape. Eggs hatch in about 21 days. Although mostly seen on the ground, grey junglefowl fly into trees to escape predators and to roost. About this sound Call of male About this sound Other calls About this sound calls  They feed on grains including bamboo seeds, berries, insects and termites.

The populations from the Mt. Abu region of Rajasthan named as subspecies wangyeli is usually not recognized[7] although it is said that the calls of the cock from this region differs from the call of birds from southern India and the plumage is much paler.[8]

The species epithet commemorates the French explorer Pierre Sonnerat. Local names include Komri in Rajasthan, Geera kur or Parda komri in Gondi, Jangli Murghi in Hindi, Raan kombdi in Marathi, Kattu Kozhi in Tamil and Malayalam, Kaadu koli in Kannada and Tella adavi kodi in Telugu.[9]

Distribution[edit]

The species is mainly in the Indian Peninsula but extends into Gujarat, Madhya Pradesh and south Rajasthan. This species and the red junglefowl overlap slightly along the northern boundary of the distribution[3] although the ranges are largely non-overlapping.[8] Grey junglefowl have been bred domestically in England since 1862[10] and their feathers have been commercially supplied from domestic UK stocks for Fly Tying since 1978.[10]

Evolution and status[edit]

Egg

The grey junglefowl is found mostly in Peninsular India, while the red junglefowl is found more along the foothills of the Himalayas. A region of overlap occurs in the Aravalli range. The species has been isolated by a variety of mechanisms including behavioural differences and genic incompatibility but hybridization is not unknown.[11][12] Some phylogenetic studies of junglefowl show that this species is more closely related to the Sri Lankan junglefowl Gallus lafayetii than to the red junglefowl, Gallus gallus[13] but another study shows a more ambiguous position due to hybridization.[14] An endogenous retroviral DNA sequence, of the EAV-HP group noted in domestic fowl is also found in the genome of this species pointing to the early integration of the virus DNA into the genome of Gallus.[15]

A study in southern India found a density of 19.8 groups per square kilometer (but ranging from 1.67 to 34.42 in dry deciduous forests on plains) with an average group size of 1.3. The male to female ratio was 1:1.2 and the preferred habitat was low to moderate canopied forest with low or no grass cover.[16]

They are threatened by hunting for food and habitat loss. Feather use in fly-fishing has also been suggested as a threat.[17]

References[edit]

  1. ^ BirdLife International (2012). "Gallus sonneratii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Identification Notes". US Fish and Wildlife. 
  3. ^ a b c Rasmussen PC & JC Anderton (2005). Birds of South Asia: The Ripley Guide. Volume 2. Smithsonian Institution and Lynx Edicions. p. 132. 
  4. ^ Editors (1954). "Occurrence of spurs in the female junglefowl (Gallus sonnerati)". J. Bombay Nat. Hist. Soc. 52 (2–3): 603–604. 
  5. ^ Morejohn, G. V. (1968). "Study of the plumage of the four species of the genus Gallus". The Condor 70 (1): 56–65. doi:10.2307/1366508. JSTOR 1366508. 
  6. ^ Finn, Frank (1911). The game birds of India and Asia. Thacker, Spink and Co., Calcutta. pp. 21–23. 
  7. ^ Storer, RW (1988). Type Specimens of Birds in the Collections of the University of Michigan Museum of Zoology. University of Michigan, Miscellaneous publications No. 174. 
  8. ^ a b Ali S & SD Ripley. Handbook of the birds of India and Pakistan. Volume 2 (2 ed.). Oxford University Press. pp. 106–109. 
  9. ^ Anonymous (1998). "Vernacular Names of the Birds of the Indian Subcontinent" (PDF). Buceros 3 (1): 53–109. 
  10. ^ a b Bransford Game Fisheries. "Jungle Cock". Bransford Game Fisheries. Fisherman's feathers. Retrieved 28 September 2013. 
  11. ^ Eriksson J, Larson G, Gunnarsson U, Bed'hom B, Tixier-Boichard M, et al. (2008). "Identification of the Yellow Skin Gene Reveals a Hybrid Origin of the Domestic Chicken". In Georges, Michel. PLoS Genetics 4 (2): e1000010. doi:10.1371/journal.pgen.1000010. 
  12. ^ Morejohn, G. Victor (1968). "Breakdown of Isolation Mechanisms in Two Species of Captive Junglefowl (Gallus gallus and Gallus sonneratii)". Evolution 22 (3): 576–582. doi:10.2307/2406881. JSTOR 2406881. 
  13. ^ Fumihito, Akishinonomiya ; Tetsuo Miyake, Masaru Takada, Ryosuke Shingut, Toshinori Endo, Takashi Gojobori, Norio Kondo, And Susumu Ohno (1996). "Monophyletic origin and unique dispersal patterns of domestic fowls". Proc. Natl. Acad. Sci. 93 (13): 6792–6795. doi:10.1073/pnas.93.13.6792. PMC 39106. PMID 8692897. 
  14. ^ Nishibori, M. ; Shimogiri, T. ; Hayashi, T. ; Yasue, H. (2005). "Molecular evidence for hybridization of species in the genus Gallus except for Gallus varius". Animal Genetics 36 (5): 367–375. doi:10.1111/j.1365-2052.2005.01318.x. PMID 16167978. 
  15. ^ Sacci, MA; K Howes & K Venugopal (2001). "Intact EAV-HP Endogenous Retrovirus in Sonnerat's Jungle Fowl". Journal of Virology 75 (4): 2029–2032. doi:10.1128/JVI.75.4.2029-2032.2001. PMC 115153. PMID 11160706. 
  16. ^ Sathyakumar, S (2006). "Habitat use by grey junglefowl Gallus sonneratii Temminck at Mundanthurai Plateau, Tamil Nadu". J. Bombay Nat. Hist. Soc. 103 (1): 57–61. 
  17. ^ Wayre,P (1976). "Sonnerat's - a junglefowl threatened by fishermen". Newsletter for Birdwatchers 16 (5): 1–3. 

Other sources[edit]

  • Tehsin,Raza H (1988) Inducing sleep in birds. J. Bombay Nat. Hist. Soc. 85(2):435-436.
  • Chitampalli,MB (1977) Occurrence of Grey Junglefowl and Red Junglefowl together. J. Bombay Nat. Hist. Soc. 74(3):527.
  • Abdulali,Humayun (1957) The Grey Junglefowl in Salsette. J. Bombay Nat. Hist. Soc. 54(4):946.
  • Tehsin,Raza; Tehsin,Fatema (1990) Jungle Cat Felis chaus and Grey Junglefowl Gallus sonneratii. J. Bombay Nat. Hist. Soc. 87(1):144.
  • Morris,RC (1927) A jungle fowl problem. J. Bombay Nat. Hist. Soc. 32(2):374.
  • Sethna, KR (1969). "Grey Junglefowl in South India". Newsletter for Birdwatchers 9 (11): 10. 
  • Ali,S (1968) The case of the Indian Grey Junglefowl. Newsletter for Birdwatchers . 8(5):5-6.
  • Subramanian,C; Kambarajan,P; Sathyanarayana,MC (2001) Roosting tree preference by Grey Junglefowl, (Gallus sonneratti) at Theni Forest Division, Western Ghats, Tamil Nadu, south India. Mor 4(February), 9:11.
  • Zacharias,VJ (1993) Grey Jungle Fowl in Kerala. WPA-India News 1(1):9-10.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!