Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Range

Tropical s US to Brazil, n Argentina and West Indies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: central and southern Florida; from the Bahamas south throughout the Antilles; on islands off Quintana Roo, Honduras, and Nicaragua; in southwestern Costa Rica, Panama, and South America from Colombia, Venezuela, and the Guianas south (west of the Andes) to western Ecuador and (east of the Andes) to northern Argentina (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 37 cm

Weight: 119 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: ALL SEASONS: Open situations with brush or scrub, plantations, gardens, farmlands, and forest clearings. BREEDING: Nests in tree or shrub.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Home range of one group in Brazil reported to be 26 hectares (Souza 1995). In Florida, territoriality may break down at end of rainy season , and some groups form large nomadic flocks (Quinn and Startek-Foote 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly insects and small fruits; often forages on ground near cattle (Bent 1940).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Lives in small flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Clutch size 4-7; several females may lay eggs in single nest. Incubation 12-15 days, by both sexes and all group members. Eggs at nest bottom may not hatch. Young tended by group, leave nest at 10-11 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crotophaga ani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACTTGATCTTTGGCGCNTGAGCCGGTATAATTGGAACCGCCCTAAGCCTACTTATCCGTGCAGAACTAGGCCAACCAGGGACTCTCCTAGGAGATGACCAGATTTATAACGTTATTGTCACGGCACATGCCTTCGTAATAATCTTCTTTATAGTCATGCCTATTATAATTGGAGGATTCGGAAACTGACTAGTCCCCCTTATAATTGGTGCCCCAGACATAGCATTTCCACGTATAAATAACATAAGCTTCTGACTTCTCCCCCCATCTTTCCTACTACTACTAGCATCCTCCACAGTAGAAGCCGGAGCAGGAACAGGATGAACAGTATATCCCCCACTGGCCGGAAACCTCGCTCACGCTGGAGCATCCGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGTGTGTCATCAATCCTAGGAGCAATCAACTTTATCACAACCGCCATTAACATAAAACCACCAGCTCTCTCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTCATCACTGCCATTCTACTACTTCTATCTCTCCCAGTACTTGCCGCAGGAATTACTATACTCTTAACAGACCGCAACCTAAACACTACATTCTTTGACCCAGCTGGAGGAGGTGACCCCGTATTATACCAACACCTATTCTGATTCTTTGGGCACCCAGAAGTATATATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crotophaga ani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Smooth-billed Ani

The Smooth-billed Ani (Crotophaga ani) is a large near passerine bird in the cuckoo family. It is a resident breeding species from southern Florida, the Bahamas, the Caribbean, parts of Central America, south to western Ecuador, Brazil, and northern Argentina.

This ani is found in open and semi-open country and areas under cultivation. The nest, built communally by several pairs, is a deep cup lined with leaves and placed usually 2–6 m (6.6–20 ft) high in a tree. A number of females lay their chalky blue eggs in the nest and then share incubation and feeding.

Each female is capable of laying up to seven eggs, and nests have been found containing up to 29 eggs, but it is rare for more than ten to hatch. Incubation is 13–15 days, with another 10 days to fledging. Up to three broods may be raised in a season, with the young of earlier broods helping to feed more recent chicks.

Crotophaga aniAPP048CB.jpg

The Smooth-billed Ani is a mid-sized species, larger on average than the Groove-billed Ani but smaller than the Greater Ani. It measures 30–36 cm (12–14 in) in length and weighs 71–133 g (2.5–4.7 oz).[2][3] The adult is mainly flat black, with a long tail, deep ridged black bill and a brown iris. The flight is weak and wobbly, but the bird runs well and usually feeds on the ground.

This is a very gregarious species, always found in noisy groups. The calls include a whining ooo-leeek. The Smooth-billed Ani feeds on termites, large insects and even lizards and frogs. They will occasionally remove ticks and other parasites from grazing animals.

This common and conspicuous species has greatly benefited from deforestation.

This species is called "el pijul" in Venezuelan folklore. It is mentioned in the popular Veracruz song "El Pijul".

References

  1. ^ BirdLife International (2012). "Crotophaga ani". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106001321. Retrieved 16 July 2012.
  2. ^ [1] (2011).
  3. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd edition ed.). Comstock Publishing. ISBN 0-8014-9792-2.
  • Hilty, Steven L (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!