Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Range

West Indes, southeastern Mexico (Quintana Roo), and Costa Rica south to western Ecuador and northern Argentina, also the Galápagos Islands; formerly southeastern United States (Florida.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: central and southern Florida; from the Bahamas south throughout the Antilles; on islands off Quintana Roo, Honduras, and Nicaragua; in southwestern Costa Rica, Panama, and South America from Colombia, Venezuela, and the Guianas south (west of the Andes) to western Ecuador and (east of the Andes) to northern Argentina (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 37 cm

Weight: 119 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: ALL SEASONS: Open situations with brush or scrub, plantations, gardens, farmlands, and forest clearings. BREEDING: Nests in tree or shrub.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Home range of one group in Brazil reported to be 26 hectares (Souza 1995). In Florida, territoriality may break down at end of rainy season , and some groups form large nomadic flocks (Quinn and Startek-Foote 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly insects and small fruits; often forages on ground near cattle (Bent 1940).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Lives in small flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Clutch size 4-7; several females may lay eggs in single nest. Incubation 12-15 days, by both sexes and all group members. Eggs at nest bottom may not hatch. Young tended by group, leave nest at 10-11 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crotophaga ani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACTTGATCTTTGGCGCNTGAGCCGGTATAATTGGAACCGCCCTAAGCCTACTTATCCGTGCAGAACTAGGCCAACCAGGGACTCTCCTAGGAGATGACCAGATTTATAACGTTATTGTCACGGCACATGCCTTCGTAATAATCTTCTTTATAGTCATGCCTATTATAATTGGAGGATTCGGAAACTGACTAGTCCCCCTTATAATTGGTGCCCCAGACATAGCATTTCCACGTATAAATAACATAAGCTTCTGACTTCTCCCCCCATCTTTCCTACTACTACTAGCATCCTCCACAGTAGAAGCCGGAGCAGGAACAGGATGAACAGTATATCCCCCACTGGCCGGAAACCTCGCTCACGCTGGAGCATCCGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGTGTGTCATCAATCCTAGGAGCAATCAACTTTATCACAACCGCCATTAACATAAAACCACCAGCTCTCTCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTCATCACTGCCATTCTACTACTTCTATCTCTCCCAGTACTTGCCGCAGGAATTACTATACTCTTAACAGACCGCAACCTAAACACTACATTCTTTGACCCAGCTGGAGGAGGTGACCCCGTATTATACCAACACCTATTCTGATTCTTTGGGCACCCAGAAGTATATATCCTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crotophaga ani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5