Overview

Brief Summary

The Greater Roadrunner (Geococcyx californianus), one of two roadrunner species, is found in Mexico and the southwestern and southcentral United States. It is a large, ground-dwelling member of the cuckoo family. The Greater Roadrunner walks and runs on the ground, flying only when necessary. It can run 15 mph (24 kph) and probably sprints briefly at much higher speeds in pursuit of prey. Greater Roadrunners are common in scrub desert and mesquite groves, less common in chaparral and open woodland.

The diet of the Greater Roadrunner consists of insects and other arthropods, lizards, snakes, rodents, small birds, and sometimes snails. Some fruits (especially cactus fruit) and seeds are also eaten. In addition to making rapid dashes to grab a prey item with its bill, the Greater Roadrunner may leap straight up from the ground to catch insects or small birds flying over (roadrunners have been observed capturing hummingbirds this way).

Greater Roadrunners may mate for life, with a pair defending its territory all year. Courtship includes chases on foot, with frequent pauses to rest. One member of the pair approaches the other with a stick or blade of grass and drops it on the ground or gives to the other bird. In other displays, the male runs away from the female with his tail and wings raised over his back and gradually lowers his wings; the male wags his tail from side to side while slowly bowing.

The nest is constructed in a dense bush, low tree, or cactus, usually around 1 to 4 m above the ground (rarely on the ground itself). The nest is a platform of sticks lined with grass, leaves, and feathers and sometimes with pieces of snakeskin or cow manure. The 3 to 5 eggs (sometimes 2 or 6) are white to pale yellowish and are incubated by both parents (but especially the male) for around 20 days. Both parents feed the young, which leave the nest after around 18 to 21 days after hatching. Although young birds may begin capturing their own food shortly after leaving the nest, they are still fed by the parents for another 30 to 40 days.

Greater Roadrunners are permanent (i.e., year-round) residents across their range, but some individuals may wander considerable distances. Although the range of the Greater Roadrunner periodically expands to the north and east, it is pushed back by severe winters. This species may be in long-term decline in California.

The Greater Roadrunner, with its long tail, expressive crest, and speedy gait, provided inspiration for a popular cartoon character who not only entertains, but also provides opportunities for meaningful discussions of the laws of physics and literary analysis.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Greater roadrunners are primarily a species of the southwestern United States, but their full range includes other areas as well. They occur in California, Arizona, Nevada, Utah, Colorado, Texas, New Mexico, Kansas, Oklahoma, Louisiana, and Arkansas. Their range continues into southern Mexico, where their closest relative the lesser roadrunner (Geococcyx velox) becomes the dominant species.

Biogeographic Regions: nearctic (Native )

  • Baughman, G. 2003. Reference Atlas to the Birds of North America. Washington, D.C.: National Geographic.
  • Stokes, D., L. Stokes. 1996. Stokes Field Guide to Birds. New York: Little Brown and Company.
  • Youth, H. 1997. "Meet the Real Roadrunner" (On-line). Smithsonian National Zoological Park. Accessed October 24, 2004 at http://nationalzoo.si.edu/publications/zoogoer/1997/3/meetrealroadrunner.cfm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: RESIDENT: from northern California, western and central Nevada, southern Utah, Colorado, southern Kansas, central and eastern Oklahoma, southwestern Missouri, western Arizona, and north-central Louisiana south to southern Baja California and the central mainland of Mexico to the Gulf coast of Texas (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Arid sw US to s Mexico.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The head, neck, back, and wings of greater roadrunners are dark brown-black and heavily streaked with white, while the breast is mostly white. The eyes are bright yellow and there is a postocular streak of bare blue and red skin. A particularly notable feature is the crest of black feathers, which is raised or lowered at will. Overall, the body has a streamlined appearance, with a long tail that may be carried at an upward angle. The legs and beak are blue. The feet are zygodactylous, with two toes pointed forward and two toes pointed backward. The sexes are similar in appearance. Immature greater roadrunners lack the colorful postocular streaks and are more bronze in color.

Greater roadrunners are medium-sized birds, weighing 227 to 341 g. An adult’s length is between 50 and 62 cm and the height is between 25 and 30 cm. Greater roadrunners have a wingspan of 43 to 61 cm.

Range mass: 227 to 341 g.

Range length: 50 to 62 cm.

Range wingspan: 43 to 61 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 1.4661 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 58 cm

Weight: 376 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Geococcyx californianus
Catalog Number: USNM 140803
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male;
Preparation: Skin: Whole
Collector(s): J. Loring
Year Collected: 1894
Locality: Brownsville, Cameron, Texas, United States, North America
  • Type: Oberholser. September 23, 1974. Bird Life Of Texas. i: 437, 439.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Sonoran Desert Habitat

This taxon is found in the Sonoran Desert, which comprises much of the state of Sonora, Mexico, most of the southern half of the USA states of Arizona, southeastern California, most of the Baja California peninsula, and the numerous islands of the Gulf of California. Its southern third straddles 30° north latitude and is a horse latitude desert; the rest is rainshadow desert. It is lush in comparison to most other deserts. There is a moderate diversity of faunal organisms present, with 550 distinct vertebrate species having been recorded here.

The visually dominant elements of the landscape are two lifeforms that distinguish the Sonoran Desert from the other North American deserts: legume trees and large columnar cacti. This desert also supports many other organisms, encompassing a rich spectrum of some 2000 species of plants, 550 species of vertebrates, and untolled thousands of invertebrate species.

The Sonoran Desert prominently differs from the other three deserts of North America in having mild winters. Most of the area rarely experiences frost, and the biota are partly tropical in origin. Many of the perennial plants and animals are derived from ancestors in the tropical thorn-scrub to the south, their life cycles attuned to the brief summer rainy season. The winter rains, when ample, support great populations of annuals (which make up nearly half of the plant species). Some of the plants and animals are opportunistic, growing or reproducing after significant rainfall in any season.

Creosote Bush (Larrea divaricata) and White Bursage (Ambrosia dumosa) vegetation characterize the lower Colorado River Valley section of the Sonoran. The Arizona upland section to the north and east is more mesic, resulting in greater species diversity and richness. Lower elevation areas are dominated by dense communities of Creosote Bush and White Bursage, but on slopes and higher portions of bajadas, subtrees such as palo verde (Cercidium floridum, C. microphyllum) and Ironwood (Olneya tesota), saguaros (Carnegiea gigantia), and other tall cacti are abundant. Cresosote Bush (Larrea tridentata) and White Bursage (Ambrosia dumosa) form the scrub that dominates the northwest part of the Sonoran Desert. This association thrives on deep, sandy soils in the flatlands. Where the dunes allow for slight inclination of the slope, species of Mesquite (Prosopis), Cercidium, Ironwood (Olneya tesota), Candalia, Lycium, Prickly-pear (Opuntia), Fouquieria, Burrobush (Hymenoclea) and Acacia are favored. The coastal plains of Sonora are composed of an almost pure Larrea scrub. Away from the Gulf influence in the area surrounding the Pinacate, Encelia farinosa, Larrea tridentataOlneya, Cercidium, Prosopis, Fouquieria and various cacti species dominate the desert.

Many wildlife species, such as Sonoran Pronghorn Antelope (Antilocapra sonoriensis EN), Desert Bighorn Sheep (Ovis canadensis nelsoni) and the endemic Bailey's Pocket Mouse (Chaetodipus baileyi) use ironwood, cacti species and other vegetation as both shelter from the harsh climate as well as a water supply. Other mammals include predators such as Puma (Felis concolor), Coyote (Canis latrans) and prey such as Black-tailed Jackrabbit (Lepus californicus), and the Round-tailed Ground Squirrel (Spermophilus tereticaudus). Other mammals able to withstand the extreme desert climate of this ecoregion include California Leaf-nosed Bat (Macrotus californicus) and Ring-tailed Cat (Bassariscus astutus).

Three endemic lizards to the Sonoran Desert are: the Coachella Fringe-toed Lizard (Uma inornata EN); the Flat-tail Horned Lizard (Phrynosoma mcallii NT); and the Colorado Desert Fringe-toed Lizard (Uma notata NT); an endemic whiptail is the San Esteban Island Whiptail (Cnemidophorus estebanensis). Non-endemic special status reptiles in the ecoregion include the Desert Tortoise (Gopherus agassizii VU) and the Gila Monster (Heloderma suspectum NT).

There are twenty-four  anuran species occurring in the Sonoran Desert, one of which is endemic, the Sonoran Green Toad (Anaxyrus retiformis). Other anurans in the ecoregion are: California Treefrog (Pseudacris cadaverina); Canyon Treefrog (Hyla arenicolor); Lowland Burrowing Frog (Smilisca fodiens); Mexican Treefrog (Smilisca baudinii); Madrean Treefrog (Hyla eximia); Sabinal Frog (Leptodactylus melanonotus); Northwest Mexico Leopard Frog (Lithobates magnaocularis); Brown's Leopard Frog (Lithobates brownorum); Yavapai Leopard Frog (Lithobates yavapaiensis); Mexican Cascade Frog (Lithobates pustulosus); Mexican Leaf Frog (Pachymedusa dacnicolor); Red Spotted Toad (Anaxyrus punctatus); Sinaloa Toad (Incilius mazatlanensis); Sonoran Desert Toad (Incilius alvarius); Eastern Green Toad  (Anaxyrus debilis); New Mexico Spadefoot (Spea multiplicata); Great Plains Toad (Anaxyrus cognatus); Couch's Spadefoot Toad (Scaphiopus couchii); Cane Toad (Rhinella marina); Elegant Narrowmouth Toad (Gastrophryne elegans);  Little Mexican Toad (Anaxyrus kelloggi); Great Plains Narrowmouth Toad (Gastrophryne olivacea); and Woodhouse's Toad (Anaxyrus woodhousii).

The Sonoran Desert is recognized as an exceptional birding area. Forty-one percent (261 of 622) of all terrestrial bird species found in the USA can be seen here during some season of the year. The Sonoran Desert, together with its eastern neighbor the Chihuahuan Desert, is the richest area in in the USA for birds, particularly hummingbirds. Among the bird species found in the Sonoran Desert are the saguaro-inhabiting Costa's Hummingbird (Calypte costae), Black-tailed Gnatcatcher (Polioptila melanura), Phainopepla (Phainopepla nitens) and Gila Woodpecker (Melanerpes uropygualis). Perhaps the most well-known Sonoran bird is the Greater Roadrunner (Geococcyx californianus), distinguished by its preference for running rather than flying, as it hunts scorpions, tarantulas, rattlesnakes, lizards, and other prey. The Sonoran Desert exhibits two endemic bird species, the highest level of bird endemism in the USA. The Rufous-winged Sparrow (Aimophila carpalis) is rather common in most parts of the Sonoran, but only along the central portion of the Arizona-Mexico border, seen in desert grasses admixed with brush. Rare in extreme southern Arizona along the Mexican border, the endemic Five-striped Sparrow (Aimophila quinquestriata) is predominantly found in canyons on hillsides and slopes among tall, dense scrub.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan, Mark Dimmitt, Arizona-Sonora Desert Museum, World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Chihuahuan Desert Habitat

This taxon is found in the Chihuahuan Desert, which is one of the most biologically diverse arid regions on Earth. This ecoregion extends from within the United States south into Mexico. This desert is sheltered from the influence of other arid regions such as the Sonoran Desert by the large mountain ranges of the Sierra Madres. This isolation has allowed the evolution of many endemic species; most notable is the high number of endemic plants; in fact, there are a total of 653 vertebrate taxa recorded in the Chihuahuan Desert.  Moreover, this ecoregion also sustains some of the last extant populations of Mexican Prairie Dog, wild American Bison and Pronghorn Antelope.

The dominant plant species throughout the Chihuahuan Desert is Creosote Bush (Larrea tridentata). Depending on diverse factors such as type of soil, altitude, and degree of slope, L. tridentata can occur in association with other species. More generally, an association between L. tridentata, American Tarbush (Flourensia cernua) and Viscid Acacia (Acacia neovernicosa) dominates the northernmost portion of the Chihuahuan Desert. The meridional portion is abundant in Yucca and Opuntia, and the southernmost portion is inhabited by Mexican Fire-barrel Cactus (Ferocactus pilosus) and Mojave Mound Cactus (Echinocereus polyacanthus). Herbaceous elements such as Gypsum Grama (Chondrosum ramosa), Blue Grama (Bouteloua gracilis) and Hairy Grama (Chondrosum hirsuta), among others, become dominant near the Sierra Madre Occidental. In western Coahuila State, Lecheguilla Agave (Agave lechuguilla), Honey Mesquite (Prosopis glandulosa), Purple Prickly-pear (Opuntia macrocentra) and Rainbow Cactus (Echinocereus pectinatus) are the dominant vascular plants.

Because of its recent origin, few warm-blooded vertebrates are restricted to the Chihuahuan Desert scrub. However, the Chihuahuan Desert supports a large number of wide-ranging mammals, such as the Pronghorn Antelope (Antilocapra americana), Robust Cottontail (Sylvilagus robustus EN); Mule Deer (Odocoileus hemionus), Grey Fox (Unocyon cineroargentinus), Jaguar (Panthera onca), Collared Peccary or Javelina (Pecari tajacu), Desert Cottontail (Sylvilagus auduboni), Black-tailed Jackrabbit (Lepus californicus), Kangaroo Rats (Dipodomys sp.), pocket mice (Perognathus spp.), Woodrats (Neotoma spp.) and Deer Mice (Peromyscus spp). With only 24 individuals recorded in the state of Chihuahua Antilocapra americana is one of the most highly endangered taxa that inhabits this desert. The ecoregion also contains a small wild population of the highly endangered American Bison (Bison bison) and scattered populations of the highly endangered Mexican Prairie Dog (Cynomys mexicanus), as well as the Black-tailed Prairie Dog (Cynomys ludovicianus).

The Chihuahuan Desert herpetofauna typifies this ecoregion.Several lizard species are centered in the Chihuahuan Desert, and include the Texas Horned Lizard (Phrynosoma cornutum); Texas Banded Gecko (Coleonyx brevis), often found under rocks in limestone foothills; Reticulate Gecko (C. reticulatus); Greater Earless Lizard (Cophosaurus texanus); several species of spiny lizards (Scelopoprus spp.); and the Western Marbled Whiptail (Cnemidophorus tigris marmoratus). Two other whiptails, the New Mexico Whiptail (C. neomexicanus) and the Common Checkered Whiptail (C. tesselatus) occur as all-female parthenogenic clone populations in select disturbed habitats.

Representative snakes include the Trans-Pecos Rat Snake (Bogertophis subocularis), Texas Blackhead Snake (Tantilla atriceps), and Sr (Masticophis taeniatus) and Neotropical Whipsnake (M. flagellum lineatus). Endemic turtles include the Bolsón Tortoise (Gopherus flavomarginatus), Coahuilan Box Turtle (Terrapene coahuila) and several species of softshell turtles. Some reptiles and amphibians restricted to the Madrean sky island habitats include the Ridgenose Rattlesnake (Crotalus willardi), Twin-spotted Rattlesnake (C. pricei), Northern Cat-eyed Snake (Leptodeira septentrionalis), Yarrow’s Spiny Lizard (Sceloporus jarrovii), and Canyon Spotted Whiptail (Cnemidophorus burti).

There are thirty anuran species occurring in the Chihuahuan Desert: Chiricahua Leopard Frog (Rana chircahuaensis); Red Spotted Toad (Anaxyrus punctatus); American Bullfrog (Lithobates catesbeianus); Canyon Treefrog (Hyla arenicolor); Northern Cricket Frog (Acris crepitans); Rio Grande Chirping Frog (Eleutherodactylus cystignathoides); Cliff Chirping Frog (Eleutherodactylus marnockii); Spotted Chirping Frog (Eleutherodactylus guttilatus); Tarahumara Barking Frog (Craugastor tarahumaraensis); Mexican Treefrog (Smilisca baudinii); Madrean Treefrog (Hyla eximia); Montezuma Leopard Frog (Lithobates montezumae); Brown's Leopard Frog (Lithobates brownorum); Yavapai Leopard Frog (Lithobates yavapaiensis); Western Barking Frog (Craugastor augusti); Mexican Cascade Frog (Lithobates pustulosus); Lowland Burrowing Frog (Smilisca fodiens); New Mexico Spadefoot (Spea multiplicata); Plains Spadefoot (Spea bombifrons); Pine Toad (Incilius occidentalis); Woodhouse's Toad (Anaxyrus woodhousii); Couch's Spadefoot Toad (Scaphiopus couchii); Plateau Toad (Anaxyrus compactilis); Texas Toad (Anaxyrus speciosus); Dwarf Toad (Incilius canaliferus); Great Plains Narrowmouth Toad (Gastrophryne olivacea); Great Plains Toad (Anaxyrus cognatus); Eastern Green Toad (Anaxyrus debilis); Gulf Coast Toad (Incilius valliceps); and Longfoot Chirping Toad (Eleutherodactylus longipes VU). The sole salamander occurring in the Chihuahuan Desert is the Tiger Salamander (Ambystoma tigrinum).

Common bird species include the Greater Roadrunner (Geococcyx californianus), Burrowing Owl (Athene cunicularia), Merlin (Falco columbarius), Red-tailed Hawk (Buteo jamaicensis), and the rare Zone-tailed Hawk (Buteo albonotatus). Geococcyx californianus), Curve-billed Thrasher (Toxostoma curvirostra), Scaled Quail (Callipepla squamata), Scott’s Oriole (Icterus parisorum), Black-throated Sparrow (Amphispiza bilineata), Phainopepla (Phainopepla nitens), Worthen’s Sparrow (Spizella wortheni), and Cactus Wren (Campylorhynchus brunneicapillus). In addition, numerous raptors inhabit the Chihuahuan Desert and include the Great Horned Owl (Bubo virginianus) and the Elf Owl (Micrathene whitneyi).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: ALL SEASONS: Desert scrub, chaparral, edges of cultivated lands, and arid open situations with scattered brush, locally in cedar glades and pine-oak woodland (Tropical and Subtropical zones) (AOU 1983). BREEDING: Usually nests low (3-15 ft from ground) in tree, shrub or clump of cactus. Rarely nests on ground. The nest is made of sticks lined with leaves grasses, feathers, snakeskin, dry pieces of livestock manure, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species prefers arid deserts and other regions with a mix of scattered brush for cover and open grassy areas for foraging. For breeding, they require coastal sage scrub or chaparral habitat. In the outer limits of their range they may be found in grasslands and at the edges of woodlands.

Habitat Regions: terrestrial

Terrestrial Biomes: desert or dune ; chaparral ; scrub forest

  • Crooks, K., A. Suarez, D. Bolger, M. Soule. 2001. Extinction and Colonization of Birds on Habitat Islands. Conservation Biology, 15: 159-172.
  • Kaufman, K. 1996. Lives of North American Birds. Boston: Houghton Mifflin.
  • Soule, M., D. Bolger, A. Alberts, J. Wright, M. Sorice, S. Hill. 1988. Reconstructed dynamics of rapid extinctions of chaparral-requiring birds in urban habitat islands. Conservation Biology, 2: 75-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on insects, lizards, small snakes, gophers, mice, spiders, centipedes, millipedes, and a variety of fruit. Forages on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The diet of G. californianus is omnivorous and varied, a good strategy for survival in the typically harsh environments of the southwest. They eat large insects, scorpions, tarantulas, centipedes, lizards, snakes, and mice. They have even been known to eat rattlesnakes, although this is rare. Greater roadrunners are potential predators of quail, adult sparrows, hummingbirds such as Anna's hummingbird, and the golden-cheeked warbler. Feeding on netted birds has also been reported. They feed on prickly pear cactus where available. When hunting they walk rapidly, scanning for prey, and then dash forward to make the catch. They may also jump into the air to catch passing insects. To kill small creatures such as rodents, greater roadrunners smash the prey's body and head against a rock and then swallow it whole. Often part of the animal is left hanging out of the mouth while it is being digested.

Animal Foods: birds; mammals; reptiles; eggs; insects; terrestrial non-insect arthropods

Plant Foods: wood, bark, or stems

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Geococcyx californianus plays both predator and prey roles. It eats, and therefore potentially reduces the populations of, many small vertebrates such as lizards, mice, and other birds. It also consumes insects and other invertebrates. Greater roadrunners provide food for predators such as coyotes, hawks, skunks, and raccoons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Hawks, house cats, skunks, coyotes, and raccoons prey upon greater roadrunners. Coyotes also eat their eggs. This species relies largely on its swiftness to outrun predators. It also uses patches of brush for hiding, and it places its nest above ground to deter predation on the eggs.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Geococcyx californianus (fish (roach, bleak, et al.)) preys on:
detritus
Insecta
Crustacea
Gastropoda
Porifera
Mollusca
Plumatella
Chironomidae
zooplankton
invertebrate predators

Based on studies in:
England, River Thames (River)

This list may not be complete but is based on published studies.
  • K. H. Mann, Case history: The River Thames. In: River Ecology and Man (R. T. Oglesby, C. A. Carlson, J. A. McCann, Eds.), Academic Press, New York and London, pp. 215-232 (1972), from p. 224.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Pairs are year-round residents in their territory. Average diameter of territories in California (Bryant 1916), Arizona (Calder 1967), and west Texas (Hughes 1996) was 800 meters. Territories up to 1 km wide along longest dimension in southern Texas (Folse 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Greater roadrunners have a wide range of vocalizations. The song of G. californianus is a series of six slow, low coos in descending pitch. During the mating season males will also attract females with a whirring call. The alarm call is a clackety noise produced by clicking the mandibles together in a sharp and rapid manner. The chicks give a buzzing begging call.

Communication Channels: acoustic

  • Bent, A. 1964. Life Histories of North American Cuckoos, Goatsuckers, Hummingbirds and their Allies. New York: Dover Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of G. californianus is 7 to 8 years. Factors that may limit their survival include predation by hawks, house cats, skunks, coyotes, or raccoons. Further, since greater roadrunners are a nonmigratory species, they may succumb to icy weather in a particularly cold year.

Range lifespan

Status: wild:
7 to 8 years.

Average lifespan

Status: wild:
45 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years (captivity) Observations: Oldest banded individual recovered was 7 years old. One specimen lived 9 years in captivity (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Clutch size typically 3-5, sometimes 2-6. Incubation 17-18 days. Both parents tend young. Young fledge 17-19 days after hatching. Pair bond apparently permanent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Courtship behavior involves the male’s foot pursuit of the female, with frequent rests. Food is an important component of the mating ritual. The male will tempt the female with a morsel such as a lizard or snake dangling from its beak. If the female accepts the offered food, the pair will probably mate. In another display, the male wags his tail in front of the female while bowing and making a whirring or cooing sound; he then jumps into the air and onto his mate. Greater roadrunner pairs may mate for life.

Mating System: monogamous

The breeding and nesting seasons vary geographically. In regions where there is one rainy season they nest only in the spring. Where there are two rainy seasons and thus more food resources, they will nest again in August and September. Brood size ranges from 2 to 8 eggs, which are white or pale yellow. Incubation lasts about 20 days and begins after the first few eggs are laid. Hatching is therefore asynchronous. Young are altricial and their development is quite rapid; they can run and catch their own prey at 3 weeks. Sexual maturity is reached at 2 to 3 years of age.

Breeding interval: Greater roadrunners breed either once or twice a year, depending on available food resources.

Breeding season: May-September

Range eggs per season: 2 to 8.

Average time to hatching: 20 days.

Average fledging age: 18 days.

Range time to independence: 30 to 40 days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average time to hatching: 20 days.

Average eggs per season: 4.

Both parents help build the nest; while the male collects the materials, the female does most of the construction. The nest site is almost always a few feet above the ground in a bush, cactus, or low tree. It is made with sticks, grass, feathers, and sometimes snakeskin or cow manure. Both parents incubate the eggs and feed the chicks once they hatch. Although the young leave the nest within 18 to 21 days, the parents continue to feed them for up to 30 to 40 days.

Greater roadrunners occasionally engage in brood parasitism. For example, roadrunner eggs have been observed in the nests of the common raven and the northern mockingbird.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Baughman, G. 2003. Reference Atlas to the Birds of North America. Washington, D.C.: National Geographic.
  • Aragon, , Moller, Soler, Soler. 1999. Molecular phylogeny of cuckoos supports a polyphyletic origin of brood parasitism. Journal of Evolutionary Biology, 12: 495-506.
  • Bull, J. 1978. Simon and Schuster's Guide to Birds. New York: Simon and Schuster.
  • Kaufman, K. 1996. Lives of North American Birds. Boston: Houghton Mifflin.
  • Stokes, D., L. Stokes. 1996. Stokes Field Guide to Birds. New York: Little Brown and Company.
  • Gough, G., J. Sauer, M. Iliff. 1998. "USGS Patuxent Bird Identification InfoCenter" (On-line). Life History Groupings. Accessed December 28, 2004 at http://www.mbr-pwrc.usgs.gov/id/framlst/Lifehistory/lh3850.html.
  • Youth, H. 1997. "Meet the Real Roadrunner" (On-line). Smithsonian National Zoological Park. Accessed October 24, 2004 at http://nationalzoo.si.edu/publications/zoogoer/1997/3/meetrealroadrunner.cfm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Geococcyx californianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATTACTCGATGATTATTCTCAACCAACCACAAAGACATCGGCACCCTATACCTAATCTTTGGTGCCTGAGCTGGCATAGTCGGAACCGCCCTAAGCCTTCTCATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGTGACGATCAAATCTACAATGTAGTTGTCACCGCACATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATCATGATCGGAGGATTTGGAAACTGACTAGTCCCACTTATAATCGGCGCCCCTGACATAGCATTCCCTCGCATAAACAACATAAGCTTCTGACTCCTTCCTCCATCCTTCCTTTTACTACTAGCCTCATCCACAGTAGAAGCAGGCGCAGGGACAGGGTGAACAGTATATCCCCCCCTAGCCGGAAACCTAGCCCACGCCGGCGCATCCGTAGATTTAGCCATCTTTTCCCTCCACCTAGCAGGAGTCTCATCAATTTTAGGGGCTATCAATTTCATCACAACCGCCATCAACATAAAACCACCAGCTCTCTCACAATACCAAACCCCCCTGTTTGTCTGATCAGTCCTCATCACAGCCGTCTTACTACTCCTATCCCTACCCGTACTTGCTGCCGGCATTACCATACTACTAACTGACCGTAACCTAAACACCACCTTCTTCGACCCCGCCGGAGGTGGAGACCCTATTCTATACCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTAGTCGCATATTATGCAGGAAAAAAAGAACCCTTCGGCTATATAGGAATAGTCTGAGCCATACTATCCATCGGATTCCTAGGATTTATCGTATGAGCCCACCACATATTCACAGTTGGAATAGACGTAGACACCCGAGCATACTTTACATCCGCTACCATAATCATTGCCATCCCCACTGGAATCAAAGTATTCAGCTGACTAGCCACACTCCATGGAGGAAATATCAAATGAGACCCCCCCATACTATGAGCCATAGGATTCATCTTCCTATTTACTATCGGGGGACTTACAGGAATTATCCTCGCAAATTCCTCCCTAGATATCGCCTTACATGATACTTACTACGTAGTTGCCCATTTCCACTATGTCCTCTCAATAGGAGCAGTATTCGCAATCATAGCAGGATTCACTCACTGATTCCCCCTATTCACCGGATACACACTACACCCCACATGAACTAAAGCCCACTTCGGAGTAATATTTACTGGTGTAAACTTAACATTCTTCCCTCAACACTTCCTAGGCTTAGCCGGCATACCACGCCGATACTCAGACTACCCAGACGCATACACCCTATGAAACACTATATCATCTATCGGCTCACTAATTTCACTCACAGCCGTAATCATAATAACATTCATTATCTGAGAAGCCTTTACATCAAAACGAAAAATCGTACAACCAGAACTTTCCACCACCAACATTGAATGAATCCACGGCTGCCCACCCCCATATCATACTTTCGAAGAACCAGCCTTTGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Geococcyx californianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat loss and urban sprawl are the major threats to greater roadrunners. The construction of roads causes fragmentation of habitat as well as mortality from cars. Greater roadrunners are also illegally shot in response to predation on quail. Further, agricultural pesticides can adversely affect the species if bioaccumulated through their prey.

Research shows that Geococcyx californianus has little chance of persisting in coastal southern California, where sage scrub areas occur only in highly populated areas. Development has reduced this potential habitat to patches too small for greater roadrunners’ large territorial requirement.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Bolger, D., A. Scott, J. Rotenberry. 1997. Breeding bird abundance in urbanizing landscape in coastal southern California. Conservation Biology, 11: 406-421.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Geococcyx californianus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Greater roadrunners help eliminate pests such as mice and various insects. Humans are frequently captivated by the odd behavior of the species.

Positive Impacts: ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Greater Roadrunner

The Greater Roadrunner (Geococcyx californianus) is a long-legged bird in the cuckoo family, Cuculidae. The latin name means "Californian Earth-cuckoo". Along with the Lesser Roadrunner, it is one of two species in the roadrunner genus Geococcyx. This roadrunner is also known as the chaparral cock, ground cuckoo, and snake killer.[3]

Description[edit]

Roadrunner on ground

The roadrunner is about 52–62 cm (20–24 in) long, has a 43–61 cm (17–24 in) wingspan and weighs 221–538 g (7.8–19.0 oz). It stands around 25–30 cm (9.8–11.8 in) tall and is the largest North American cuckoo.[4][5][6] The adult has a bushy crest and long, thick, dark bill. It has a long, dark tail, a dark head and back, and is blue on the front of the neck and on the belly. Roadrunners have 4 toes on each zygodactyl foot; two face forward, and two face backward.

They are brown in color and have pale gold spots.

Habitat[edit]

The breeding habitat is desert and shrubby country in the southwestern United States and northern Mexico. It can be seen regularly in the US states of California, Arizona, New Mexico, Texas, Nevada, Utah, Colorado, Oklahoma, and less frequently in Kansas, Louisiana, Arkansas and Missouri,[3] as well as the Mexican states of Baja California, Baja California Sur, Sonora, Sinaloa, Chihuahua, Durango, Jalisco, Coahuila, Zacatecas, Aguascalientes, Guanajuato, Michoacán, Querétaro, México, Puebla, Nuevo León, Tamaulipas, and San Luis Potosí.[7]

Behavior[edit]

Greater Roadrunner on the run

The Greater Roadrunner nests on a platform of sticks low in a cactus or a bush and lays 3–6 eggs, which hatch in 20 days. The chicks fledge in another 18 days. Pairs may occasionally rear a second brood.

Greater Roadrunners measure 61 cm (2.00 ft) in length, about half of which is tail. They have long, wobbly legs and a slender, pointed bill. The upper body is mostly brown with black streaks and sometimes pink spots. The neck and upper breast are white or pale brown with dark brown streaks, and the belly is white. A crest of brown feathers sticks up on the head, and a bare patch of orange and blue skin lies behind each eye;[8] the blue is replaced by white in adult males (except the blue adjacent to the eye), and the orange (to the rear) is often hidden by feathers.[3]

This bird walks around rapidly, running down prey. It mainly feeds on insects, fruit and seeds with the addition of small reptiles, small rodents,tarantula hawks, spiders, scorpions, centipedes, millipedes, small birds, their eggs, and carrion, including roadkills. It kills larger prey with a blow from the beak—hitting the base of the neck of small mammals—or by holding it in the beak and beating it against a rock. Two roadrunners sometimes attack a relatively big snake cooperatively.

Although capable of weak flight, it spends most of its time on the ground, and can run at speeds of up to 20 mph (32 km/h).[8] Cases where roadrunners have run as fast as 26 mph (42 km/h) have been reported.[9] This is the fastest running speed ever clocked for a flying bird, although it is not as fast as the flightless Ostrich.[10]

Cultural references[edit]

Some Pueblo Indian tribes, such as the Hopi, believed that the Roadrunner provided protection against evil spirits. In Mexico, some said it brought babies, as the White Stork was said to in Europe. Some Anglo frontier people believed roadrunners led lost people to trails.[3]

The Greater Roadrunner is the basis for the cartoon character Road Runner,[11] a bird who uses his speed and cunning to outmaneuver his enemy, Wile E. Coyote, though real coyotes are faster than roadrunners.

The roadrunner appeared in a 1982 sheet of 20-cent United States stamps showing 50 state birds and flowers, the roadrunner being the state bird of New Mexico.[11]

References[edit]

  1. ^ BirdLife International (2012). "Geococcyx californianus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Geococcyx californianus (Lesson, 1829)". Integrated Taxonomic Information System. Retrieved 9 February 2006. 
  3. ^ a b c d Hughes, Janice M. (1996). "Greater Roadrunner (Geococcyx californianus)". In Poole, A. The Birds of North America Online. Ithaca: Cornell Lab of Ornithology. doi:10.2173/bna.244. Retrieved 28 May 2010.  (Subscription required.)
  4. ^ "Greater Roadrunner". All About Birds. Cornell Lab of Ornithology. 
  5. ^ "Greater Roadrunner". 2011. 
  6. ^ [1] (2011).[dead link]
  7. ^ Howell, Steve N. G.; Webb, Sophie (1995). A Guide to the Birds of Mexico and Northern Central America. Oxford University Press. p. 350. ISBN 0-19-854012-4. 
  8. ^ a b Lockwood, Mark W. (2007). Basic Texas Birds: A Field Guide. University of Texas Press. p. 168. ISBN 978-0-292-71349-9. 
  9. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  10. ^ "Amazing Bird Records". Trails.com. Retrieved 2 June 2011. 
  11. ^ a b Young, William (2014). The Fascination of Birds: From the Albatross to the Yellowthroat. Courier Dover. p. 251. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!