Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Coccyzus americanus

More often heard than seen, the Yellow-billed Cuckoo (11-13 inches) is most easily separated from the similar Black-billed Cuckoo (Coccyzus erythropthalmus) by its reddish-brown wing patches, white-and-black under-tail pattern, and the yellow on its bill. Other field marks include a long tail, thin body, and black legs. Male and female Yellow-billed Cuckoos are similar at all seasons. The Yellow-billed Cuckoo breeds across much of the eastern U.S.and southern Canada. Smaller numbers breed west of the Great Plains, in Mexico, and in the West Indies. All Yellow-billed Cuckoos spend the winter in South America. Yellow-billed Cuckoos breed in forests with plentiful undergrowth and clearings, particularly those near water. On migration, this species may be found in habitat similar to that inhabited during the summer months. Wintering Yellow-billed Cuckoos inhabit humid tropical forest. The diet of this species is composed primarily of large insects, including grasshoppers, cicadas, and caterpillars. Like many cuckoos, the Yellow-billed Cuckoo spends much of its time hidden in thick vegetation, where it is not easily seen. Lucky birdwatchers may observe this species slinking through the branches of tall trees while foraging for insect prey. Yellow-billed Cuckoos are primarily active during the day, but like many migratory birds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Canada to Mexico and West Indies; winters to n Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Yellow-billed cuckoos are found in the Nearctic and Neotropical regions. They breed throughout eastern North America, in southeast Canada, northern Mexico and the Greater Antilles. They winter primarily in South America (Peru, Bolivia and northern Argentina).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Yellow-billed cuckoos are found in the Nearctic and Neotropical regions. They breed throughout eastern North America, in southeast Canada, northern Mexico and the Greater Antilles. They winter primarily in South America (Peru, Bolivia and northern Argentina).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The breeding range extends from interior California to southern Idaho, southeastern Montana, the Dakotas, southern Manitoba (rarely), Minnesota, and New Brunswick, and south to southern Baja California, southern Arizona, Coahuila, Chihuahua, Nuevo Leon, Tamaulipas, the U.S. Gulf Coast, and the Florida Keys; sporadically farther south in Mexico and in the Greater Antilles (AOU 1998). The species is uncommon on Cuba, Hispaniola, and Puerto Rico; rare in the Virgin Islands, Jamaica, and northern Lesser Antilles (Saint Martin)m and possibly occurs in the Bahamas and Lesser Antilles (Raffaele et al. 1998). Yellow-billed cuckoos formerly nested in British Columbia, Washington, and Oregon. Based on Breeding Bird Survey data (Sauer et al. 2008), this species is most abundant in the south-central United States (Kansas and Missouri southward to Texas and Mississippi). During the nonbreeding season, yellow-billed cuckoos occur from southern Central America (rare and local in Costa Rica) and northern South America (and Trinidad and Tobago) south to eastern Peru, Bolivia, and northern Argentina (AOU 1998) and occur rarely in the West Indies (Raffaele et al. 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Yellow-billed cuckoos are medium birds with long tails. They are 26 to 30 cm long and weigh 55 to 65 g. They have grayish brown heads and backs and dull white underparts. Their tails are long and have two rows of large white circles on the underside. Yellow-billed cuckoos have a curved bill with a black upper mandible and a yellow or orange lower mandible. On each foot, two toes point forward, and two toes point backward. This is called zygodactylous feet.

Female yellow-billed cuckoos are a little bit bigger than males. Young cuckoos look like adults, but are more reddish-brown on their wings. Also, the tail spots on young cuckoos are less clear.

Range mass: 55 to 65 g.

Range length: 26 to 30 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Yellow-billed cuckoos are medium birds (26 to 30 cm long; 55 to 65 g) with long tails. They have uniform grayish-brown plumage on their head and back, and dull white underparts. Their tails are long with two rows of four to six large white circles on the underside. The bill of yellow-billed cuckoos is short to medium in length and curved downward with a black upper mandible and a yellow or orange lower mandible. Yellow-billed cuckoos have zygodactylous feet, meaning that of the four toes, the middle two point forward and the outer two point backward. (Parker)

Female yellow-billed cuckoos are slightly larger than males. Juveniles are similar in appearance to adults, but have a less distinct undertail pattern, and have cinnamon brown wing coverts.

There are two recognized subspecies of Coccyzus americanus; Coccyzus americanus americanus (the eastern version) and its western counterpart, Coccyzus americanus occidentalis. These two subspecies are differentiated by tail, wing and bill length.

Range mass: 55 to 65 g.

Range length: 26 to 30 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 31 cm

Weight: 64 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Yellow-billed cuckoos live in open areas with some trees and dense shrubs. They are often found near streams, rivers or lakes. In North America, they live in habitats such as old farms and fruit orchards, shrubby fields and thickets. In winter, yellow-billed cuckoos live in tropical habitats with dense shrubs, such as scrub forest and mangroves.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow-billed cuckoos prefer open woodlands with clearings and a dense shrub layer. They are often found in woodlands near streams, rivers or lakes. In North America, their preferred habitats include abandoned farmland, old fruit orchards, successional shrubland and dense thickets. In winter, yellow-billed cuckoos can be found in tropical habitats with similar structure, such as scrub forest and mangroves.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Open woodland (especially where undergrowth is thick), parks, deciduous riparian woodland; in the West, nests in tall cottonwood and willow riparian woodland. Nests in deciduous woodlands, moist thickets, orchards, overgrown pastures; in tree, shrub, or vine, an average of 1-3 meters above ground (Harrison 1979). Subspecies OCCIDENTALIS requires patches of at least 10 hectares (25 acres) of dense riparian forest with a canopy cover of at least 50 percent in both the understory and overstory; nests typically in mature willows (Biosystems Analysis 1989).

NONBREEDING: forest, woodland, and scrub. Also mangroves in Puerto Rico (Raffaele 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates regularly through the southern U.S., Middle America, and West Indies (sometimes large numbers in fall in Puerto Rico, Raffaele 1983). Birds from North America may migrate through Puerto Rico, but a small breeding population may be resident all year (Kepler and Kepler 1978). Migrants noted in April-May in Jamaica (Lack 1976). Migrates through Costa Rica mid-August to early November and late April-early June (Stiles and Skutch 1989). Arrives in California breeding grounds usually in early June (Biosystems Analysis 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Yellow-billed cuckoos primarily eat large insects including caterpillars (order Lepidoptera), Orchelimum vulgare, cicadas (family Cicadidae), grasshoppers and crickets (order Orthoptera). They also occasionally eat bird eggs, snails, small vertebrates such as frogs (Order Anura) and lizards (suborder Sauria) and some fruits and seeds. Parents feed their chicks regurgitated insects (Ehrlich et al.).

Animal Foods: amphibians; reptiles; eggs; insects; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Yellow-billed cuckoos primarily eat large insects including caterpillars (order Lepidoptera), katydids, cicadas (family Cicadidae), grasshoppers and crickets (order Orthoptera). They also occasionally eat bird eggs, snails, small vertebrates such as frogs (Order Anura) and lizards (suborder Sauria) and some fruits and seeds. Parents feed their chicks regurgitated insects (Ehrlich et al.).

Animal Foods: amphibians; reptiles; eggs; insects; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly caterpillars; also other insects, some fruits, sometimes small lizards and frogs and bird eggs (Terres 1980). Gleans food from branches or foliage, or sallies from a perch to catch prey on the wing (Ehrlich et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Yellow-billed cuckoos affect the insect species that they eat. They provide habitat for many different species of parasites.

Yellow-billed cuckoos are nest parasites. Sometimes they lay their eggs in other birds’ nests. When this happens, the other birds’ chicks may suffer because there are too many chicks in the nest.

Ecosystem Impact: parasite

Species Used as Host:

  • Turdus americanus
  • Dumetella carolinensis
  • Hylocichla mustelina
  • Coccyzus erythropthalmus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult yellow-billed cuckoos are killed by raptors, including Aplomado falcons (Falco_femoralis) and red-shouldered hawks (Buteo_lineatus). They have also been eaten by a tiger shark (Galeocerdo_cuvier). Nestlings and eggs are eaten by Serpentes such as the black racer (Coluber_constrictor), small mammals such as eastern chipmunks (Tamias_striatus), and birds such as blue jays (Cyanocitta_cristata) and common grackles (Quiscalus_quiscula).

When a predator is nearby, yellow-billed cuckoos hide themselves among vegetation and stand very still. If a predator is near their nest, parents either attack the predator or try to get the predator away from the nest by flying away and performing a distracting display and calling.

Known Predators:

  • red-shouldered hawks (Buteo_lineatus)
  • tiger sharks (Galeocerdo_cuvier)
  • snakes (Serpentes)
  • black racers (Coluber_constrictor)
  • eastern chipmunks (Tamias_striatus)
  • blue jays (Cyanocitta_cristata)
  • common grackles (Quiscalus_quiscula)
  • Aplomado falcons (Falco_femoralis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Yellow-billed cuckoos affect the populations of the species they prey on. They are also host to internal and external parasites.

Yellow-billed cuckoos are also nest parasites, and may affect the reproductive success of species that they parasitize. Some yellow-billed cuckoos parasitize other birds by laying eggs in their nests. They may lay eggs in the nest of other yellow-billed cuckoos, or in the nests of other bird species, including black-billed cuckoos, American robins, gray catbirds and wood thrushes. If the parasitized parents raise the foreign young, their own chicks may be less likely to survive or flourish.

Ecosystem Impact: parasite

Species Used as Host:

  • American robins
  • gray catbirds
  • wood thrushes
  • black-billed cuckoos

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult yellow-billed cuckoos are killed by raptors, including Aplomado falcons (Falco femoralis) and red-shouldered hawks (Buteo lineatus). Remains of adults have also been found in the stomach of a tiger shark (Galeocerdo cuvier). Nestlings and eggs are vulnerable to predation by snakes such as the black racer (Coluber constrictor), small mammals such as eastern chipmunks (Tamias striatus), and birds such as blue jays (Cyanocitta cristata) and common grackles (Quiscalus quiscula).

When threatened by a predator, yellow-billed cuckoos often hide themselves among vegetation and remain motionless. If a nest is threatened, parents will either attack the predator or try to lure the predator away from the nest by flying away and performing a distracting display and vocalizations.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by hundreds of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but is likely to be considerably more than 10,000 pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Territory size averages 20-24 hectares (S. Laymon, in Riparian Habitat Joint Venture 2000).

Known predators of adults include Aplomado Falcon (Falco femoralis), Red-shouldered Hawk (Buteo lineatus), and other raptors; of eggs and young include Blue Jay (Cyanocitta cristata), Common Grackle (Quiscalus quiscula), Black Racer (Coluber constrictor) and Eastern Chipmunk (Tamias striatus) (Hughes 1999). Occasional host for Brown-headed Cowbird (Molothrus ater), Bronzed Cowbird (Molothrus aeneus), and Black-billed Cuckoo (Coccyzus erythropthalmus) (Hughes 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Yellow-billed cuckoos use calls to communicate. They are usually silent birds during the winter and migration. However, during the breeding season, they call often to communicate with their mate and their chicks. These birds are able to make at least 6 sounds, which they use to communicate many different things.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Yellow-billed cuckoos primarily use vocalizations to communicate. They are generally silent birds during the winter and migration, but vocalize regularly during the early breeding season before the chicks fledge. These birds are able to make at least 6 vocal sounds, which are used for a wide variety of social situations. Few physical displays have been noted in this species.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Yellow-billed cuckoos can live to be at least 4 years old in the wild.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: wild:
60 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

There is little information available about the lifespan and survivorship of yellow-billed cuckoos. The oldest re-captured banded yellow-billed cuckoos were 4 years old at re-capture.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: wild:
60 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Rohwer et al. (2009) provided evidence that Yellow-billed Cuckoos and four other species of Neotropical migrants are what they term "migratory double breeders". These four species are all known to breed in the United States and Canada and to winter in the New World tropics. The new data from Rohwer et al suggest that, following their northern breeding season, these species have a second breeding season in mid-summer in western Mexico before continuing their southward migration to wintering grounds in Central and South America. Only a very few other bird species are known to consistently breed in two different regions in a single year, and the Yellow-billed Cuckoo and the other species discussed by Rohwer et al. are the first known examples from the New World and the first known to have a second breeding season after a southward migration following a first bout of breeding. It is unknown what proportion of Yellow-billed Cuckoo individuals in northern breeding populations attempt a second round of breeding hundreds or thousands of kilometers to the south in Mexico, but the phenomenon may be quite common. This second bout of breeding could be especially important to the viability of western Yellow-billed Cuckoo populations (which have declined dramatically during the last century) because dry conditions west of the Rocky Mountains dramatically reduce primary productivity in midsummer, precisely when food becomes abundant in west Mexico (Rohwer et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Yellow-billed cuckoos are probably monogamous (one male with one female). Breeding pairs form in May or June. A pair may visit many locations together before deciding where to build their nest. Males try to attract a female by offering her food or sticks and other nest materials.

Mating System: monogamous

Yellow-billed cuckoos begin breeding in mid- to late-May. Most cuckoos breed once per year, though some may raise two broods in one breeding season. The male and female parents work together to build the nest, which is made of twigs, roots, dried leaves and pine needles. The female may begin laying eggs before the nest is complete. She lays 1 to 5 (usually 2 or 3) light blue eggs, and begins incubating after the first egg is laid. Both parents incubate the eggs, which hatch after 9 to 11 days.

Yellow-billed cuckoo chicks are helpless when they hatch. The parents must brood them for the first week or so. Both parents also feed the chicks. The chicks begin to leave the nest after 7 to 9 days. They begin to fly when they are about 21 days old. The male parent usually takes care of the first chick that fledges, and the female parent takes care of the rest of the chicks (Ehrlich et al.). We do not know when yellow-billed cuckoo chicks become independent from their parents. Most yellow-billed cuckoos begin breeding when they are 1 year old.

Some yellow-billed cuckoos may parasitize other birds by laying eggs in the nest of other parents. They may lay eggs in the nest of other yellow-billed cuckoos, or in the nests of other bird species, including Coccyzus erythropthalmus, Turdus americanus, Dumetella carolinensis and Hylocichla mustelina.

Breeding interval: Most populations breed once per year, though some eastern populations may lay two broods in one breeding season.

Breeding season: Yellow-billed cuckoos begin breeding in mid- to late-May

Range eggs per season: 1 to 5.

Average eggs per season: 2 to 3.

Range time to hatching: 9 to 11 days.

Range fledging age: 7 to 9 days.

Average age at sexual or reproductive maturity (female): 1 minutes.

Average age at sexual or reproductive maturity (male): 1 minutes.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 3.

Male and female yellow-billed cuckoo parents incubate the eggs, brood and feed the chicks and protect the nest from predators. They also keep the nest clean by removing the fecal sacs from the chicks. After chicks have left the nest, the parents keep feeding them until they are able to hunt for themselves.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow-billed cuckoos are probably monogamous, though their breeding system has not been well studied. Breeding pairs form in May or June, and pairs may visit prospective nest sites together before choosing a location. Males may attempt to procure or keep a mate by offering sticks and other nest materials to their mate as well as feeding them (Eaton, Erlich et al).

Mating System: monogamous

Yellow-billed cuckoos begin breeding in mid- to late-May. Most populations breed once per year, though some eastern populations may raise two broods in one breeding season. The male and female build the nest, which is made of twigs, lined with roots and dried leaves, and rimmed with pine needles. The female may begin laying eggs before nest construction is complete. She lays 1 to 5 (usually 2 or 3) light blue eggs, and begins incubating after the first egg is laid. Incubation is done by both parents, and lasts 9 to 11 days.

Yellow-billed cuckoo chicks are altricial at hatching, and are brooded often by the parents for the first week or so. Both parents feed the chicks, which begin to leave the nest 7 to 9 days after hatching. They begin to fly about 21 days after hatching. Soon thereafter they leave the nest for good. The male will usually take care of the first fledgling, and the female will care for the rest (Ehrlich et al.). There is little information available on when yellow-billed cuckoo chicks become independent from their parents. Most yellow-billed cuckoos begin breeding at age 1.

Some yellow-billed cuckoos may parasitize other birds by laying eggs in the nest of other parents. They may lay eggs in the nest of other yellow-billed cuckoos, or in the nests of other bird species, including black-billed cuckoos, American robins, gray catbirds and wood thrushes.

Breeding interval: Most populations breed once per year, though some eastern populations may lay two broods in one breeding season.

Breeding season: Yellow-billed cuckoos begin breeding in mid- to late-May

Range eggs per season: 1 to 5.

Average eggs per season: 2 to 3.

Range time to hatching: 9 to 11 days.

Range fledging age: 7 to 9 days.

Average age at sexual or reproductive maturity (female): 1 minutes.

Average age at sexual or reproductive maturity (male): 1 minutes.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 3.

Male and female yellow-billed cuckoos incubate eggs, brood and feed chicks and protect the nest from predators. They also keep the nest clean by removing the fecal sacs of the chicks. After chicks have left the nest, the parents continue to feed them until they are able to care for themselves. The length of this period is unknown.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding often coincides with the appearance of massive numbers of cicadas, caterpillars, or other large insects (Ehrlich et al. 1992). Clutch size is one to five (commonly two to three), largest when prey is abundant. Clutch sizes greater than six attributable to more than one female laying in nest (Hughes 1999). Incubation lasts 9-11, shared by male and female during day; male incubates at night (Hamilton and Hamilton 1965, Potter 1980, Potter 1981). Young are tended by both parents, climb in branches at seven-nine days. Sometimes lays eggs in the nests of Black-billed Cuckoo (Coccyzus erythropthalmus) or (rarely) other species (Ehrlich et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coccyzus americanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATTACCCGATGACTATTCTCCACTAACCACAAAGATATCGGTACCCTATATCTTATCTTCGGTGCTTGAGCAGGCATAGTCGGCACAGCCCTAAGCCTACTCATCCGCGCAGAGCTCGGACAACCAGGAACCCTACTAGGAGACGACCAAATCTACAATGTAATTGTTACCGCACATGCCTTCGTAATAATCTTCTTCATGGTCATACCAATTATAATCGGAGGGTTCGGCAACTGACTTGTCCCTCTCATAATTGGTGCCCCAGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTCCTTCCCCCCTCCTTCCTTCTCTTACTAGCATCCTCCACAGTAGAGGCAGGAGCAGGAACTGGATGAACCGTGTACCCCCCTCTAGCTGGCAACCTAGCCCACGCCGGAGCTTCAGTAGACCTCGCCATCTTCTCCCTCCACCTAGCAGGTATTTCATCAATCCTAGGGGCAATTAATTTCATTACAACAGCCATTAACATAAAACCCCCAGCCTTATCTCAATACCAAACACCCTTATTCGTATGGTCAGTACTCATTACCGCCGTCCTACTCTTACTTTCCCTACCAGTTCTCGCTGCTGGCATTACTATATTACTAACAGATCGCAACCTAAACACCACATTCTTTGATCCCGCTGGAGGGGGCGACCCAGTACTATACAAACACCTATTCTGATTCTTCGGCCATCCAGAAGTTTACATC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coccyzus americanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Yellow-billed cuckoos are protected under the U.S. Migratory Bird Act. They are threatened or endangered in many states. Yellow-billed cuckoos are common in some areas. However, in many areas they are becoming less common because the shrubby habitats that they like are being destroyed or changed. Some cuckoos also die by being poisoned by pesticides or by crashing into towers or tall buildings during migration.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow-billed cuckoos are protected under the U.S. Migratory Bird Act. They are considered threatened or endangered in several states, and are a candidate for protection under the U.S. Endangered Species Act. Yellow-billed cuckoos are common in parts of their range, but populations have been declining in recent years throughout much of the range. This decline is most likely due to habitat loss and fragmentation. Other threats to cuckoo populations include poisoning from pesticides and other environmental contaminants and collision with towers and tall buildings during their nocturnal migration.

US Migratory Bird Act: protected

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and common in core of range. Causes of declines in eastern and central North America unclear, thus it is not certain what actions should be taken to reverse them. Western populations deserve special attention.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   California/Nevada Region (Region 8) 
Where Listed: Western U.S. DPS


For most current information and documents related to the conservation status and management of Coccyzus americanus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: BBS survey-wide data for 1998-2007 indicate a decline of -0.92 percent per year (Sauer et al. 2008).

Global Long Term Trend: Decline of 30-70%

Comments: North American Breeding Bird Survey (BBS) data indicate a significant abundance decline of 1.7 percent per year in North America, 1966-2007 (Sauer et al. 2008). The decline was 2.1 percent per year for the period 1980-2007, but the species increased 3.4 percent per year during 1966-1979, indicating that the decline is mostly recent. See also the information for subspecies occidentalis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: In western North America, large declines in distribution and abundance have occurred as a result of loss, degradation, and fragmentation of riparian habitat (see information for subspecies occidentalis). Causes of decline in central and eastern North America are uncertain.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: May recolonize if suitable habitat is restored. On experimentally replanted sites (11 hectares) in southern California, foraged in second year and nested in third year following replanting, provided that cottonwood growth averaged 3 meters per year. Sites with growth of 2 meters per year or less not used for foraging or nesting by third year (Anderson and Laymon 1989).

Preserve Selection and Design Considerations: In California, Gaines (1974) defined habitat as willow and cottonwood forests below 1300 meters elevation, greater than 10 hectares in extent, and wider than 100 meters. Laymon and Halterman (1989) concluded that sites greater than 80 hectares (200 acres) in extent and wider than 600 meters (1950 feet) were optimal (100 percent occupancy), sites 41-80 hectares (101-200 acres) in extent and wider than 200 meters (650 feet) were suitable (58.8 percent), sites 20-40 hectares (50-100 acres) in extent and 100-200 meters (325-650 feet) in width were marginal (9.5 percent), and sites less than 15 hectares (38 acres) in extent and less than 100 meters (325 feet) in width were unsuitable. During a four-year study on the Sacramento River, Halterman (1991) found that habitat patch area, the extent of habitat in a 8 kilometer (5 mile) section of river, and presence of low woody vegetation were the most important variables in explaining the distribution of cuckoos. These variables combined explained 46 percent of the variation observed in the distribution of breeding pairs.

Microhabitat requirements are also important. Nesting groves at the South Fork Kern River are characterized by higher canopy closure, higher foliage volume, intermediate basal area, and intermediate tree height when compared to random sites (Laymon et al. 1997). Sites with less than 40 percent canopy closure are unsuitable, those with 40 - 65 percent are marginal to suitable, and those with greater than 65 percent are optimal (Laymon 1998). Lower nesting success for open-cup nesting birds near edges in large habitats and in smaller habitat fragments (Chasko and Gates 1982, Gates and Gysel 1978), and increased nest predation reaching up to 600 meters into forest interior (Wilcove 1985) indicate that reserves less than 100 hectares are less valuable than larger reserves (Wilcove et al. 1986). Simulation modeling demonstrates that populations of fewer than 10 pairs are very unstable and always become extinct in a short period of time (Richter-Dyn and Goel 1972, Roth 1974); a minimum number of 25 pairs in a subpopulation with interchange to other subpopulation should be reasonably safe from extinction by stochastic events (Hughes 1999).

In the northeast and central U.S., and southern Canada, preserves should include woodland, abandoned farmland, overgrown fruit orchards, successional shrubland, dense thickets along streams and marshes(Johnsgard 1979, Peck and James 1983, Eaton 1988, Jauvin 1996), shade trees, gardens (Oberholser 1974). In midwest U.S., also uses willow-dogwood shrub wetlands, and successional hardwood forest with dense stands of small trees 1-7 meters in height; e.g., American Elm and or continuous stands of dense Hawthorn (Nolan 1963, Eastman 1991). In southeastern U.S. occupies hammocks and hardwood forest, particularly those crossed by streams, thickets, swamps, and fencerows (Stevenson and Anderson 1994).

Management Requirements: See California Department of Fish and Game (1990) for a listing of management needs in California. In the west, conservation recommendations summarized in Laymon (1980) include: determine numbers and locations of remnant populations; improve existing, and acquire new riparian habitats; eliminate pesticide spraying in orchards adjacent to riparian areas; and investigate feasibility of captive breeding and reintroduction to naturally regenerated or reforested habitat. Riparian vegetation propagation and site management techniques are outlined in Anderson and Laymon (1989). Grazing should be removed to allow natural regeneration and encourage increased density of cottonwoods and willows.

Management Research Needs: Many aspects of life history require further study, including spacing and site tenacity, fecundity and mortality, mating systems, population structure and regulation. Habitat and ecological requirements on migratory routes and wintering grounds in Central and South America should be investigated. (Hughes 1999). Wintering grounds for western subspecies has not yet been located (Laymon and Halterman 1987). Pesticide load and source should be investigated; significant eggshell thinning and low to moderate levels of DDT and DDE have been detected (Laymon, pers. comm). Detailed censuses of declining western populations must continue in order to determine effective population sizes necessary for future conservation programs. Unoccupied suitable habitat still remains in the northwest U.S., and feasibility of a captive breeding and reintroduction program should be examined. Baseline population estimates are required in Mexico as this population may represent the largest remaining reserve for recolonization. It is imperative that western population receive both federal and state protection status so that conservation measures such as habitat protection and restoration can be implemented (Hughes 1999).

Biological Research Needs: Cause(s) of declines in eastern and central populations need to be determined.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Needs: Habitat protection, particularly western riparian systems, is a priority on breeding and nonbreeding grounds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of yellow-billed cuckoos on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Yellow-billed cuckoos may help to control populations of pest insects.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse affects of yellow-billed cuckoos on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Yellow-billed cuckoos may help to control populations of pest insects.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Summer distribution throughout much of the eastern and Midwestern United States. Once common in the west, now rare and local, extirpated from British Columbia, Washington, Oregon, possibly Nevada. Winters primarily in South America east of the Andes, may breed in the tropics. Blue listed by Tate (1981). Western population currently under review for federal listing by USFWS; does not yet receive adequate federal due primarily to controversy surrounding the validity of its subspecies status. Listed as endangered in California, listed as threatened or endangered in every western state in which it occurs. From 1980 to 1994 eastern populations declined in all states except Louisiana and South Carolina. Highly significant declines in Alabama, Georgia, Illinois, Indiana, Michigan, New Jersey, New York, Ohio, Pennsylvania, Texas and Wisconsin, with the greatest decline in Connecticut. Main threats are habitat fragmentation, degradation of riparian woodland due to agricultural and residential development (Dobkin 1994), stochastic extinctions and low colonization rates, flood control (Laymon and Halterman 1987, 1989), riparian habitats invaded by less desirable salt cedar (Tamarix spp.; Hughes 1999). Highly vulnerable to continued tropical deforestation (Morton 1992), but direct effects on population numbers not quantified. Preserves in the west should include riparian areas with dense stands of cottonwood and willow with an average tree height of 10-15 meters (Anderson and Laymon 1989). Preserves in the east should have open woodlands with clearings and low, dense, shrubby vegetation, associated with watercourses. Management should focus on acquiring and improving riparian habitats, and eliminating pesticide spraying near habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow-billed Cuckoo

The Yellow-billed Cuckoo (Coccyzus americanus) is a cuckoo. Pronounced cuck-coo Common folk-names for this bird in the southern United States are Rain Crow and Storm Crow. These likely refer to the bird's habit of calling on hot days, often presaging thunderstorms.

Description

Comparison of Black-billed Cuckoo and Yellow-billed Cuckoo

Adults have a long tail, brown above and black-and-white below, and a black curved bill with yellow especially on the lower mandible. The head and upper parts are brown and the underparts are white. There is a yellow ring around the eye. It shows cinnamon on the wings in flight. Juveniles are similar, but the black on the undertail is replaced by gray.

This bird has a number of calls; the most common is a rapid ka ka ka ka ka kow kow kow.

There is an ongoing debate regarding the taxonomic status of the western race and if it is distinct from those birds in the east. This question is significant to the conservation status of this species in the west, where it has declined to a tiny fraction of its population a century ago.[2][3] Populations of this species in western North America are in steep decline. The bird disappeared from British Columbia, Washington, and Oregon during the first half of the twentieth century. Eastern populations have declined as well, though not as precipitously.

Ecology

Their breeding habitat is deciduous woods from southern Canada to Mexico. They migrate to Central America and as far south as northern Argentina. This bird is a rare vagrant to western Europe.

These birds forage in dense shrubs and trees, also may catch insects in flight. They mainly eat insects, especially tent caterpillars and cicadas, but also some lizards, eggs of other birds and berries.

They nest in a tree or shrub, usually up to 2–12 feet (1–4 meters) above the ground. The nest is a flimsy platform of short twigs placed on a horizontal branch. The 3-4 eggs are incubated for 14 days or less. The chicks are able to climb about with agility at 7–9 days of age. At about this same time, the feathers of the chicks burst out of their sheaths and the young are able to fly. The entire time from egg-laying to fledging may be as little as 17 days.

Yellow-billed Cuckoos occasionally lay eggs in the nests of other birds (most often the closely related Black-billed Cuckoo), but they are not obligate brood parasites of other birds as is the Common Cuckoo of Eurasia.

References

  1. ^ BirdLife International (2012). "Coccyzus americanus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106001304. Retrieved 16 July 2012.
  2. ^ Yellow-Billed Cuckoo Species Account, Sacramento Fish & Wildlife Office
  3. ^ Biogeography of Western Yellow Billed Cuckoo
  • John K. Terres (1980), Audubon Society Encyclopedia of North American Birds, Knopf, ISBN 0-394-46651-9
  • David Gaines Review of the Status of the Yellow-Billed Cuckoo in California: Sacramento Valley Populations The Condor, Vol. 76, No. 2 (Summer, 1974), pp. 204–209
  • Laymon, S.A., and M.D. Halterman. 1987. Can the western subspecies of Yellow-billed Cuckoo be saved from extinction? Western Birds 18:19-25.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Banks (1988) concluded that morphological differences among geographic samples were inadequate to justify the recognition of the eastern (C. a. americanus) and western (C. a. occidentalis) subspecies. Franzreb and Laymon (1993, cited in USFWS 2000) found small but statistically significant differences between the two groups and, while stating that the evidence for recognition of the two subspecies was equivocal, recommended retaining them until further studies provided more information. California Department of Fish and Game evidently disagrees with this conclusion and believes that C. a. occidentalis is worthy of recognition and deserves federal protection as an Endangered species (California Department of Fish and Game 1990). May form a superspecies with C. euleri (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!