Overview

Brief Summary

Taxonomy

The wild budgerigar is a small, streamlined, parrot, with rounded head and small beak, pointed wings and long tail.Head to tail length in wild budgerigars is approximately 180mm. Show standard, captive budgerigars are significantly larger, ideally at least 216mm head to tail.Natural adult plumage has the following characteristics:
  • bright yellow forehead, face and throat
  • round black spots and a prominent violet patch on cheeks
  • a yellow crown and mantle with fine black barring which extends under eyes
  • the barring becomes heavier - scalloping - down the back and on the wing coverts
  • underparts of the lower back and rump are bright light green
  • dark blue tail with a striking yellow band across lateral feathers
  • a white wing bar is also visible in flight
  • immature birds have fine barring on the forehead and dark eyes
  • birds can be sexed by the colour of the fleshy cere at the base of the bill - blue in males and brown in females
Many colour varieties have been bred in captivity - see section on Aviculture.

Discovery
The budgerigar was well known to the native aboriginal peoples of Australia, and already had a number of names by the time colonists became familiar with it in the 1700s. The species was formally described by George Shaw in1805, but specimens were still very rare in museum collections until the late 1830s. John Gould (1804–1881), whilst collecting and exploring in Australia from 1838–1840, was clearly captivated by these small parrots, referring to them as ‘the most animated, cheerful little creatures you can possibly imagine’.He collected a number of specimens, and in 1840 published the first detailed account of budgerigar behaviour in his great work Birds of Australia, where he also changed the scientific name in recognition of the species’ unique characteristics. However, Gould is best remembered by budgerigar enthusiasts for successfully importing the first live birds to Britain, also in 1840. Gould is also remembered as the ornithologist who described the famous finches of the Galapagos discovered by Charles Darwin during the voyage of the Beagle (1831–1836).

Other names
The common name budgerigar comes from one of the native aboriginal names, recorded by Gould as ‘Betcherrygah’, which is widely thought to mean ‘good eating’. A specimen from Gould’s own collection still carries a very early label with the name ‘Budjeregah’. However, early names included:
  • undulated parakeet
  • warbling grass parakeet
  • canary parrot
  • scallop parrot
Now the most familiar name is ‘budgie’.

Evolution
The budgerigar is the only species within its genus - it is monotypic. Molecular studies show that it is most closely related to 2 other unusual monotypic Australian parrots - the ground parrot, Pezoporus wallicus and the night parrot, Geopsittacus occidentalis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Introduction

Budgerigars are one of the world’s best-loved birds. They are hugely popular in captivity for their hardy nature, engaging behaviour and wide range of attractive colours. But behind the diversity of modern captive birds is one species of small Australian parrot, superbly adapted for life in one of the world’s toughest environments. The history of the discovery of the budgerigar and its development in captivity provides fascinating insights into both natural and artificial selection - a modern equivalent to Charles Darwin’s fancy pigeons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Wild budgerigars may breed at any time of year, following good rains. Depending on conditions, 2 separate breeding seasons can occur in a single year.Relatively little effort is put into preparing a nest; it is typically a simple depression with some soft lining material.Clutch size is usually 4–6 eggs, but can be up to 8. The eggs are white and 17–19mm long.Incubation is approximately 18 days.Chicks fledge after about 30 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aviculture

Early budgerigar breeding
John Gould successfully imported the first live budgerigars to Britain in 1840, where they were received with great enthusiasm. In Birds of Australia, Gould wrote about his pair of captive budgerigars, noting how they had survived a hard voyage to Britain, around Cape Horn in winter! This pair had been captive-bred by Gould’s brother-in-law Charles Coxen, in Australia. More imports followed, and the birds became very popular. The earliest known breeding in Britain was in 1848, in the aviaries of the 13th Earl of Derby at Knowsley Hall, near Liverpool. The Earl wrote to Gould in February 1848, telling him “we have been overjoyed here by the fact of a pair of the Melopsittacus undulatus breeding… we can hear the young”. The chicks unfortunately died soon after hatching, but one of them is preserved in the collections of the World Museum, Liverpool (Fisher and Warr, 2003). Regular successful captive breeding developed in the late 1850s. There are several reports from this time and an advert for British birds offered for sale appeared in The Field in April 1859. Budgerigars were well established in captivity by the end of the 1870s, with their own exhibition classes at cage bird shows (Rogers and Blake, 2001).

Colour breeding
One of the reasons for the outstanding popularity of budgerigars is the huge range of colour varieties. Hundreds of varieties have been recorded, combining many different colours, patterns and other features. Like the domestic pigeons studied by Charles Darwin (1809–1882) as he developed his ideas on evolution, captive budgerigars are a fantastic example of artificial selection, showing how many different varieties can be developed from a single ancestral species. The first ‘new’ colour found in budgerigars was yellow, recorded in 1872. There are occasional reports of yellow birds in the wild, but it was only in captivity that the colour could be artificially selected for. Blue budgerigars were the next to appear; blue birds were first exhibited in 1910 and caused a sensation. But there were problems establishing new colours, as no one really understood how to breed them reliably. The next step in captive budgerigar development was therefore enormously important to breeders, but is also an under-recognised great scientific achievement (Birkhead et al, 2003). Budgerigars became the subject of some of the earliest intensive research into the principles of inheritance genetics, first observed by Gregor Mendel in the 1860s. The importance of Mendel’s research in plants showing that certain features - such as colour - are inherited, was not recognised until the early 1900s, when several scientists published work based on Mendel’s ideas. Dr Hans Duncker (1881–1961) of Bremen, Germany realised that the principles could be applied to budgerigars. Working with Vice-Consul Carl Cremer (1858–1938), he carried out a huge number of breeding experiments from 1925 to 1933, to discover how budgerigar colours and patterns were inherited. The detailed results of their research are still vital to budgerigar breeders today (Taylor and Warner, 1986; Elliot and Brooks, 1999).In addition to colours, breeders have also selectively bred for physical characteristics such as size and feather length. Modern show budgerigars are much larger than wild birds, and have much longer feathers, which can give them a big-headed appearance. Features such as different types of crest have also been developed, and new varieties are still appearing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Melopsittacus undulatus, commonly known as the budgerigar, is naturally distributed through Australia except for coastal areas in the far east and the far south-west. This species has also been introduced to many areas around the world including S. Africa, Japan, U.S., Puerto Rico, Switzerland, and New Zealand, however, they have only successfully been established in southwest Florida (Juniper, 1998).

Biogeographic Regions: nearctic (Introduced ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: through most of interior Australia, though nomadic. Introduced and established in west-central Florida, and possibly established as a breeder in Puerto Rico (Raffaele 1989). Recently escaped cage birds can be seen almost anywhere in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread and locally abundant in interior of Australia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Budgerigars are small, streamlined parrots that average 18-20 cm in length. They are unlikely to be mistaken for any other parrot because of their small size, pointed wings and tails, and distinct plumage patterns (Juniper, 1998). Most wild budgerigars have a yellow forehead (juveniles have a barred forehead), a yellow and black striped head with purple and black markings on the cheeks, a pointed bill whose tip of the upper mandible extends over the lower mandible, and a yellow throat. Their lesser and median wing coverts are centered black and outlined in yellow. Both their greater coverts and flight feathers are centered black and outlined with green and yellow, but their flight feathers also have a central yellow bar. Their uppertail coverts are bright green and extend to a blue-green tail. Caged species differ greatly in their plumage color and patterns (Phillips, 2000).

There is slight sexual dimorphism. In breeding females, the cere (the skin at the base of the bill, covering the nostrils) is light brown or beige. Otherwise the cere is blue. (Forshaw 1977)

Range length: 18 to 20 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Average mass: 30 g.

Average basal metabolic rate: 0.3035 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Budgerigars occupy a range of semi-arid and sub-humid habitats mainly in the interior of Australia. However, they sometimes can be found in dry grasslands of the southeast. Although mainly restricted to the interior of the continent, there are occasional coastal interruptions in the northeast and in the central south. They seasonally migrate to the north during the winter in order to have a continuing food source (Juniper, 1998).

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Native range: open woodland, grasslands, and scrubby areas, especially in semiarid habitats. Suburban areas and parks where introduced. Nests in natural cavity or nest box (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Budgerigars are highly successful exploiters of food and water resources whenever available (Kavanau, 1987). They are ground-feeders and thus prefer to take the seeds of grasses and crop plants, particularly spinifex and tall tussock grasses. They first dehull the seed and then swallow it whole or broken. These seeds are extremely energy rich and are equivalent to the caloric content of animal tissue. Therefore, no alternate food source is necessary. Budgerigars are very scheduled in their drinking habits and drink about 5.5% of their body weight daily (Kavanau, 1987). To satisfy this demand, they often locate themselves near water holes.

Plant Foods: seeds, grains, and nuts

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly seeds; ground feeder in native range (Terres 1980). Puerto Rico: generally found singly feeding with flocks of weavers in short grass (Raffaele 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Distribution ecology

The budgerigar is native to the interior of Australia, with an estimated range of nearly 6 million square kilometres. It does not generally occur along coastal regions, and is absent from the Cape York Peninsula.

Habitat
Budgerigars occur in a wide variety of open habitats, including:
  • savanna
  • farmland
  • wooded grasslands
  • open forests
  • dry scrub
  • plains
Although budgerigars are extremely tolerant of arid conditions, they are usually found near a water source.

Nutrition
Budgerigars feed primarily on a wide range of small grass seeds.They may feed on the ground, searching for fallen seeds, and also climb tussocks to strip seed heads. They will sometimes attack cereal crops.Seeds have a high calorific content, making them an ideal food, but must be de-husked before eating to aid digestion. The birds are well designed for the task - their small compressed beaks, with a hinged upper mandible and their chunky, flexible tongues, help them manoeuvre seeds with great precision.Budgerigars are extremely water hardy, an essential adaptation to their arid environment. If a water source is not available, budgerigars can survive by lapping up early morning dew and may bathe by rolling in damp grass.Waterholes are approached with caution, usually in flocks, with birds settling on trees nearby before flying down in groups to drink or bathe for a few seconds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Budgerigars are highly social, and form fast-flying, mobile flocks. Under certain conditions, flocks of hundreds of thousands of birds may develop.Flocks will tend to forage in the early morning, before seeking shade during the hottest part of the day. During this rest period, they often socialise, with continuous chirruping. A very important social behaviour is mutual preening, particularly around the head, which helps birds keep difficult to reach areas in good order and also strengthens social bonds. Captive budgerigars show the same behaviour when enjoying a gentle head scratch or preening their owner’s hair.

Migration
Wild budgerigars are highly nomadic in the arid interior of Australia. Flocks can move significant distances in response to climatic conditions, particularly rainfall, as they search for sources of water and green vegetation.

Conservation
The budgerigar is rated as of least concern, due to its extensive natural range and large population numbers.Populations fluctuate with climate, but overall the trend is thought to be increasing. In particular, artificial water sources for livestock and farming in the outback seem to have benefited budgerigars.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
21 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21 years (captivity) Observations: In captivity these animals have been reported to live up to 21 years (Brouwer et al. 2000). They have been reported to have a high incidence of ovarian cancer (Holmes and Ottinger 2003).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Budgerigars are monogamous and breed in large colonies throughout their range. There has been some record of extra-pair copulations, probably so the female can receive extra help raising the clutch.

Mating System: monogamous ; polygynandrous (promiscuous)

Breeding for Budgerigars can occur during any time of the year but most frequently occur with an abundance of seed. Most grass seeding occurs during the winter in northern Australia and during the spring and summer in southern Australia. This means Budgerigars also breed after heavy rains because grass growth is dependent upon water. In fact, any good rain will set off breeding, even when they are in the costly process of molting (Kavanau, 1987).

Budgerigars make their nest in pre-existing cavities that are available in fence posts, logs, and Eucalyptus trees. Several nests can be found on the same tree branch measuring only 3-5 m apart from one another. They fill their nests with decayed wood dust, droppings, and any other soft material available.

Breeding season: Breeding for Budgerigars can occur during any time of the year but most frequently occur with an abundance of seed.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 18 days.

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

The female chooses the nest site and incubates while the male spends most of the time foraging and feeding all until the chicks are ready to fledge. The parents often have several broods in succession.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Male, Female); pre-independence (Provisioning: Male, Protecting: Male, Female)

  • Kavanau, J. 1987. Behavior and Evolution. Los Angeles, California: Science Software Systems, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lays clutch of usually 4-7 eggs, especially after heavy sporatic rains in native range. Incubation about 18 days, by female. Young tended by both parents, first fly at about 30-36 days (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melopsittacus undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCAACCAACCACAAAGACATCGGCACCCTTTATCTCATCTTCGGTGCATGAGCCGGCATAATCGGCACCGCCCTAAGCCTACTCATTCGAGCAGAACTAGGCCAACCAGGAACCCTACTAGGAGAC---GACCAAATCTATAACGTAATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTCATAATTGGTGCCCCTGACATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTACTAGCCTCATCCACTGTAGAAGCCGGAGCAGGCACAGGATGAACAGTCTACCCACCCCTAGCCGGAAACCTAGCCCACGCCGGAGCCTCTGTAGACCTAGCCATCTTCTCCCTCCACTTAGCCGGAGTATCATCTATCCTCGGAGCAATCAACTTCATCACCACAGCCATCAACATAAAACCACCCGCCTTATCACAATACCAAACCCCACTATTCGTATGATCCGTCCTAATCACCGCCGTACTTCTTCTACTTTCCCTGCCAGTCCTAGCCGCTGGCATCACCATACTCCTCACAGACCGAAACCTAAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCTATCTTATACCAACACCTCTTCTGATTTTTTGGACACCCAGAAGTATACATCCTAATTCTCCCAGGATTTGGAATCATCTCCCATGTCGTAGCTTACTATGCTGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATATTATCAATCGGCTTCCTAGGATTTATCGTATGAGCCCACCACATATTCACCGTAGGAATAGACGTAGATACCCGAGCATACTTTACATCCGCCACTATAATCATCGCCATCCCAACAGGAATTAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGA---ACC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melopsittacus undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5