Overview

Brief Summary

Taxonomy

The wild budgerigar is a small, streamlined, parrot, with rounded head and small beak, pointed wings and long tail.Head to tail length in wild budgerigars is approximately 180mm. Show standard, captive budgerigars are significantly larger, ideally at least 216mm head to tail.Natural adult plumage has the following characteristics:
  • bright yellow forehead, face and throat
  • round black spots and a prominent violet patch on cheeks
  • a yellow crown and mantle with fine black barring which extends under eyes
  • the barring becomes heavier - scalloping - down the back and on the wing coverts
  • underparts of the lower back and rump are bright light green
  • dark blue tail with a striking yellow band across lateral feathers
  • a white wing bar is also visible in flight
  • immature birds have fine barring on the forehead and dark eyes
  • birds can be sexed by the colour of the fleshy cere at the base of the bill - blue in males and brown in females
Many colour varieties have been bred in captivity - see section on Aviculture.

Discovery
The budgerigar was well known to the native aboriginal peoples of Australia, and already had a number of names by the time colonists became familiar with it in the 1700s. The species was formally described by George Shaw in1805, but specimens were still very rare in museum collections until the late 1830s. John Gould (1804–1881), whilst collecting and exploring in Australia from 1838–1840, was clearly captivated by these small parrots, referring to them as ‘the most animated, cheerful little creatures you can possibly imagine’.He collected a number of specimens, and in 1840 published the first detailed account of budgerigar behaviour in his great work Birds of Australia, where he also changed the scientific name in recognition of the species’ unique characteristics. However, Gould is best remembered by budgerigar enthusiasts for successfully importing the first live birds to Britain, also in 1840. Gould is also remembered as the ornithologist who described the famous finches of the Galapagos discovered by Charles Darwin during the voyage of the Beagle (1831–1836).

Other names
The common name budgerigar comes from one of the native aboriginal names, recorded by Gould as ‘Betcherrygah’, which is widely thought to mean ‘good eating’. A specimen from Gould’s own collection still carries a very early label with the name ‘Budjeregah’. However, early names included:
  • undulated parakeet
  • warbling grass parakeet
  • canary parrot
  • scallop parrot
Now the most familiar name is ‘budgie’.

Evolution
The budgerigar is the only species within its genus - it is monotypic. Molecular studies show that it is most closely related to 2 other unusual monotypic Australian parrots - the ground parrot, Pezoporus wallicus and the night parrot, Geopsittacus occidentalis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Introduction

Budgerigars are one of the world’s best-loved birds. They are hugely popular in captivity for their hardy nature, engaging behaviour and wide range of attractive colours. But behind the diversity of modern captive birds is one species of small Australian parrot, superbly adapted for life in one of the world’s toughest environments. The history of the discovery of the budgerigar and its development in captivity provides fascinating insights into both natural and artificial selection - a modern equivalent to Charles Darwin’s fancy pigeons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Wild budgerigars may breed at any time of year, following good rains. Depending on conditions, 2 separate breeding seasons can occur in a single year.Relatively little effort is put into preparing a nest; it is typically a simple depression with some soft lining material.Clutch size is usually 4–6 eggs, but can be up to 8. The eggs are white and 17–19mm long.Incubation is approximately 18 days.Chicks fledge after about 30 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aviculture

Early budgerigar breeding
John Gould successfully imported the first live budgerigars to Britain in 1840, where they were received with great enthusiasm. In Birds of Australia, Gould wrote about his pair of captive budgerigars, noting how they had survived a hard voyage to Britain, around Cape Horn in winter! This pair had been captive-bred by Gould’s brother-in-law Charles Coxen, in Australia. More imports followed, and the birds became very popular. The earliest known breeding in Britain was in 1848, in the aviaries of the 13th Earl of Derby at Knowsley Hall, near Liverpool. The Earl wrote to Gould in February 1848, telling him “we have been overjoyed here by the fact of a pair of the Melopsittacus undulatus breeding… we can hear the young”. The chicks unfortunately died soon after hatching, but one of them is preserved in the collections of the World Museum, Liverpool (Fisher and Warr, 2003). Regular successful captive breeding developed in the late 1850s. There are several reports from this time and an advert for British birds offered for sale appeared in The Field in April 1859. Budgerigars were well established in captivity by the end of the 1870s, with their own exhibition classes at cage bird shows (Rogers and Blake, 2001).

Colour breeding
One of the reasons for the outstanding popularity of budgerigars is the huge range of colour varieties. Hundreds of varieties have been recorded, combining many different colours, patterns and other features. Like the domestic pigeons studied by Charles Darwin (1809–1882) as he developed his ideas on evolution, captive budgerigars are a fantastic example of artificial selection, showing how many different varieties can be developed from a single ancestral species. The first ‘new’ colour found in budgerigars was yellow, recorded in 1872. There are occasional reports of yellow birds in the wild, but it was only in captivity that the colour could be artificially selected for. Blue budgerigars were the next to appear; blue birds were first exhibited in 1910 and caused a sensation. But there were problems establishing new colours, as no one really understood how to breed them reliably. The next step in captive budgerigar development was therefore enormously important to breeders, but is also an under-recognised great scientific achievement (Birkhead et al, 2003). Budgerigars became the subject of some of the earliest intensive research into the principles of inheritance genetics, first observed by Gregor Mendel in the 1860s. The importance of Mendel’s research in plants showing that certain features - such as colour - are inherited, was not recognised until the early 1900s, when several scientists published work based on Mendel’s ideas. Dr Hans Duncker (1881–1961) of Bremen, Germany realised that the principles could be applied to budgerigars. Working with Vice-Consul Carl Cremer (1858–1938), he carried out a huge number of breeding experiments from 1925 to 1933, to discover how budgerigar colours and patterns were inherited. The detailed results of their research are still vital to budgerigar breeders today (Taylor and Warner, 1986; Elliot and Brooks, 1999).In addition to colours, breeders have also selectively bred for physical characteristics such as size and feather length. Modern show budgerigars are much larger than wild birds, and have much longer feathers, which can give them a big-headed appearance. Features such as different types of crest have also been developed, and new varieties are still appearing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Melopsittacus undulatus, commonly known as the budgerigar, is naturally distributed through Australia except for coastal areas in the far east and the far south-west. This species has also been introduced to many areas around the world including S. Africa, Japan, U.S., Puerto Rico, Switzerland, and New Zealand, however, they have only successfully been established in southwest Florida (Juniper, 1998).

Biogeographic Regions: nearctic (Introduced ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: through most of interior Australia, though nomadic. Introduced and established in west-central Florida, and possibly established as a breeder in Puerto Rico (Raffaele 1989). Recently escaped cage birds can be seen almost anywhere in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread and locally abundant in interior of Australia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Budgerigars are small, streamlined parrots that average 18-20 cm in length. They are unlikely to be mistaken for any other parrot because of their small size, pointed wings and tails, and distinct plumage patterns (Juniper, 1998). Most wild budgerigars have a yellow forehead (juveniles have a barred forehead), a yellow and black striped head with purple and black markings on the cheeks, a pointed bill whose tip of the upper mandible extends over the lower mandible, and a yellow throat. Their lesser and median wing coverts are centered black and outlined in yellow. Both their greater coverts and flight feathers are centered black and outlined with green and yellow, but their flight feathers also have a central yellow bar. Their uppertail coverts are bright green and extend to a blue-green tail. Caged species differ greatly in their plumage color and patterns (Phillips, 2000).

There is slight sexual dimorphism. In breeding females, the cere (the skin at the base of the bill, covering the nostrils) is light brown or beige. Otherwise the cere is blue. (Forshaw 1977)

Range length: 18 to 20 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Average mass: 30 g.

Average basal metabolic rate: 0.3035 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Budgerigars occupy a range of semi-arid and sub-humid habitats mainly in the interior of Australia. However, they sometimes can be found in dry grasslands of the southeast. Although mainly restricted to the interior of the continent, there are occasional coastal interruptions in the northeast and in the central south. They seasonally migrate to the north during the winter in order to have a continuing food source (Juniper, 1998).

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Native range: open woodland, grasslands, and scrubby areas, especially in semiarid habitats. Suburban areas and parks where introduced. Nests in natural cavity or nest box (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Budgerigars are highly successful exploiters of food and water resources whenever available (Kavanau, 1987). They are ground-feeders and thus prefer to take the seeds of grasses and crop plants, particularly spinifex and tall tussock grasses. They first dehull the seed and then swallow it whole or broken. These seeds are extremely energy rich and are equivalent to the caloric content of animal tissue. Therefore, no alternate food source is necessary. Budgerigars are very scheduled in their drinking habits and drink about 5.5% of their body weight daily (Kavanau, 1987). To satisfy this demand, they often locate themselves near water holes.

Plant Foods: seeds, grains, and nuts

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly seeds; ground feeder in native range (Terres 1980). Puerto Rico: generally found singly feeding with flocks of weavers in short grass (Raffaele 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Distribution ecology

The budgerigar is native to the interior of Australia, with an estimated range of nearly 6 million square kilometres. It does not generally occur along coastal regions, and is absent from the Cape York Peninsula.

Habitat
Budgerigars occur in a wide variety of open habitats, including:
  • savanna
  • farmland
  • wooded grasslands
  • open forests
  • dry scrub
  • plains
Although budgerigars are extremely tolerant of arid conditions, they are usually found near a water source.

Nutrition
Budgerigars feed primarily on a wide range of small grass seeds.They may feed on the ground, searching for fallen seeds, and also climb tussocks to strip seed heads. They will sometimes attack cereal crops.Seeds have a high calorific content, making them an ideal food, but must be de-husked before eating to aid digestion. The birds are well designed for the task - their small compressed beaks, with a hinged upper mandible and their chunky, flexible tongues, help them manoeuvre seeds with great precision.Budgerigars are extremely water hardy, an essential adaptation to their arid environment. If a water source is not available, budgerigars can survive by lapping up early morning dew and may bathe by rolling in damp grass.Waterholes are approached with caution, usually in flocks, with birds settling on trees nearby before flying down in groups to drink or bathe for a few seconds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Budgerigars are highly social, and form fast-flying, mobile flocks. Under certain conditions, flocks of hundreds of thousands of birds may develop.Flocks will tend to forage in the early morning, before seeking shade during the hottest part of the day. During this rest period, they often socialise, with continuous chirruping. A very important social behaviour is mutual preening, particularly around the head, which helps birds keep difficult to reach areas in good order and also strengthens social bonds. Captive budgerigars show the same behaviour when enjoying a gentle head scratch or preening their owner’s hair.

Migration
Wild budgerigars are highly nomadic in the arid interior of Australia. Flocks can move significant distances in response to climatic conditions, particularly rainfall, as they search for sources of water and green vegetation.

Conservation
The budgerigar is rated as of least concern, due to its extensive natural range and large population numbers.Populations fluctuate with climate, but overall the trend is thought to be increasing. In particular, artificial water sources for livestock and farming in the outback seem to have benefited budgerigars.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
21 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21 years (captivity) Observations: In captivity these animals have been reported to live up to 21 years (Brouwer et al. 2000). They have been reported to have a high incidence of ovarian cancer (Holmes and Ottinger 2003).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Budgerigars are monogamous and breed in large colonies throughout their range. There has been some record of extra-pair copulations, probably so the female can receive extra help raising the clutch.

Mating System: monogamous ; polygynandrous (promiscuous)

Breeding for Budgerigars can occur during any time of the year but most frequently occur with an abundance of seed. Most grass seeding occurs during the winter in northern Australia and during the spring and summer in southern Australia. This means Budgerigars also breed after heavy rains because grass growth is dependent upon water. In fact, any good rain will set off breeding, even when they are in the costly process of molting (Kavanau, 1987).

Budgerigars make their nest in pre-existing cavities that are available in fence posts, logs, and Eucalyptus trees. Several nests can be found on the same tree branch measuring only 3-5 m apart from one another. They fill their nests with decayed wood dust, droppings, and any other soft material available.

Breeding season: Breeding for Budgerigars can occur during any time of the year but most frequently occur with an abundance of seed.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 18 days.

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

The female chooses the nest site and incubates while the male spends most of the time foraging and feeding all until the chicks are ready to fledge. The parents often have several broods in succession.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Male, Female); pre-independence (Provisioning: Male, Protecting: Male, Female)

  • Kavanau, J. 1987. Behavior and Evolution. Los Angeles, California: Science Software Systems, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lays clutch of usually 4-7 eggs, especially after heavy sporatic rains in native range. Incubation about 18 days, by female. Young tended by both parents, first fly at about 30-36 days (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melopsittacus undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCAACCAACCACAAAGACATCGGCACCCTTTATCTCATCTTCGGTGCATGAGCCGGCATAATCGGCACCGCCCTAAGCCTACTCATTCGAGCAGAACTAGGCCAACCAGGAACCCTACTAGGAGAC---GACCAAATCTATAACGTAATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTCATAATTGGTGCCCCTGACATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTACTAGCCTCATCCACTGTAGAAGCCGGAGCAGGCACAGGATGAACAGTCTACCCACCCCTAGCCGGAAACCTAGCCCACGCCGGAGCCTCTGTAGACCTAGCCATCTTCTCCCTCCACTTAGCCGGAGTATCATCTATCCTCGGAGCAATCAACTTCATCACCACAGCCATCAACATAAAACCACCCGCCTTATCACAATACCAAACCCCACTATTCGTATGATCCGTCCTAATCACCGCCGTACTTCTTCTACTTTCCCTGCCAGTCCTAGCCGCTGGCATCACCATACTCCTCACAGACCGAAACCTAAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCTATCTTATACCAACACCTCTTCTGATTTTTTGGACACCCAGAAGTATACATCCTAATTCTCCCAGGATTTGGAATCATCTCCCATGTCGTAGCTTACTATGCTGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATATTATCAATCGGCTTCCTAGGATTTATCGTATGAGCCCACCACATATTCACCGTAGGAATAGACGTAGATACCCGAGCATACTTTACATCCGCCACTATAATCATCGCCATCCCAACAGGAATTAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGA---ACC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melopsittacus undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

None known.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is reported to be abundant (del Hoyo et al. 1997), while national population sizes have been estimated at < c.100 introduced breeding pairs in Korea and c.100-10,000 introduced breeding pairs in Japan (Brazil 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Their ability to consume a large number of seeds when in groups concerns farmers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Budgerigars are the most widely known pet bird in the world (Phillips, 2000). Their population of about 5,000,000 worldwide has allowed scientists ample opportunity to study them. In fact, more is known of their biology than of any other parrot.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Budgerigar

The budgerigar (Melopsittacus undulatus) /ˈbʌərɨɡɑr/, also known as common pet parakeet or shell parakeet and informally nicknamed the budgie, is a small, long-tailed, seed-eating parrot. Budgerigars are the only species in the Australian genus Melopsittacus, and are found wild throughout the drier parts of Australia where the species has survived harsh inland conditions for the last five million years.[2] Budgerigars are naturally green and yellow with black, scalloped markings on the nape, back, and wings, but have been bred in captivity with colouring in blues, whites, yellows, greys, and even with small crests. Budgerigars are popular pets around the world due to their small size, low cost, and ability to mimic human speech. The origin of the budgerigar's name is unclear. The species was first recorded in 1805, and today is the third most popular pet in the world, after the domesticated dog and cat.[3]

The budgerigar is closely related to the lories and the fig parrots.[4][5][6][7] They are one of the parakeet species, a non-taxonomical term that refers to any of a number of small parrots with long, flat and tapered tails. In both captivity and the wild, budgerigars breed opportunistically and in pairs.

Wild budgerigars are usually found to be mostly green in colour. Selective breeding, by breeders, over the years has caused changes in colour. Cage bred budgerigars are also larger in size than wild budgerigars.

Biology[edit]

Evolutionary history[edit]

Evolutionary history
 
 

Lories and lorikeets


 

Budgerigar



 

Fig parrots, genera (Cyclopsitta and Psittaculirostris)


Phylogenetic chart[4][5][6][7]

The budgerigar has been thought to be the link between the genera Neophema and Pezoporus based on the barred plumage.[8] However, recent phylogenetic studies using DNA sequences place the budgerigar very close to the lories (tribe Loriini) and the fig parrots (tribe Cyclopsittini).[4][5][6][7]

Anatomy and physiology[edit]

The anatomy of a male budgerigar

Wild budgerigars average 18 cm (7 in) long, weigh 30–40 grams (1.1–1.4 oz), and display a light green body colour (abdomen and rumps), while their mantles (back and wing coverts) display pitch-black mantle markings (blackish in fledgelings and immatures) edged in clear yellow undulations. The forehead and face is yellow in adults but with blackish stripes down to the cere (nose) in young individuals until they change into their adult plumage around three to four months of age. They display small, purple cheek patches and a series of three black spots across each side of their throats (called throat spots). The two outermost throat spots are situated at the base of each cheek patch. The tail is cobalt (dark-blue); and outside tail feathers display central yellow flashes. Their wings have greenish-black flight feathers and black coverts with yellow fringes along with central yellow flashes, which only become visible in flight or when the wings are outstretched. Bills are olive grey and legs blueish-grey, with zygodactyl toes.[9]

Budgerigars in their natural habitat in Australia are noticeably smaller than those in captivity. This particular parrot species has been bred in many other colours and shades in captivity (e.g. blue, grey, grey-green, pieds, violet, white, yellow-blue), although they are mostly found in pet stores in blue, green, and yellow. Like most parrot species, budgerigar plumage fluoresces under ultraviolet light. This phenomenon is possibly related to courtship and mate selection.[10]

The upper half of their beaks is much taller than the bottom half and covers the bottom when closed. The beak does not protrude much, due to the thick, fluffy feathers surrounding it, giving the appearance of a downward-pointing beak that lies flat against the face. The upper half acts as a long, smooth cover, while the bottom half is just about a half-sized cup-piece. These beaks allow the birds to eat plants, fruits, and vegetables.

The colour of the cere (the area containing the nostrils) differs between the sexes, being royal blue in males, pale brown to white (nonbreeding) or brown (breeding) in females, and pink in immatures of both sexes (usually of a more even purplish-pink colour in young males). Some female budgerigars develop brown cere only during breeding time, which later returns to the normal colour. Young females can often be identified by a subtle, chalky whiteness that starts around the nostrils. Males that are either Albino, Lutino, Dark-eyed Clear or Recessive Pied (Danishpied or harlequin) always retain the immature purplish-pink cere colour their entire lives.[9][11]

Budgerigar flock in the wild (SW Queensland, Australia)

It is usually easy to tell the sex of a budgerigar over six months old, mainly by the cere colours, but behaviours and head shape also help indicate sex.

A mature male's cere is usually light to dark blue, but can be purplish to pink in some particular colour mutations, such as Dark-eyed Clears, Danish Pieds (Recessive Pieds) and Inos, which usually display much rounder heads. Males are typically cheerful, extroverted, highly flirtatious, peacefully social, and very vocal.[citation needed]

Females' ceres are pinkish as immatures and switch from being beigish or whitish outside breeding condition into brown (often with a 'crusty' texture) in breeding condition and usually display flattened backs of heads (right above the nape region). Females are typically highly dominant and more socially intolerant.[12]
When females get older, their ceres tend to be brown usually, females are often more bossy and rude with their own gender, but with males they get along better; usually when budgies of different gender are put together, they tend to be more kind to each other, some will not even fight or peck at each other for their life time.

Vision[edit]

Like many birds, budgerigars have tetrachromatic colour vision, but all four classes of cone cells operating simultaneously requires the full spectrum provided by sunlight.[13] The ultraviolet spectrum brightens their feathers to attract mates. The throat spots in budgerigars reflect UV and can be used to distinguish individual birds.[10]

Ecology[edit]

Female budgerigar at Alice Springs Desert Park

Budgerigars are nomadic birds found in open habitats, primarily in scrublands, open woodlands, and grasslands of Australia. The birds are normally found in small flocks, but can form very large flocks under favourable conditions. The nomadic movement of the flocks is tied to the availability of food and water.[9] Drought can drive flocks into more wooded habitat or coastal areas. They feed on the seeds of spinifex, grass seeds, and sometimes ripening wheat.[9][14]

Naturalised feral budgerigars have been recorded since the 1940s in the St. Petersburg, Florida, area of the United States, but are much less common now than they were in the early 1980s. Increased competition from European starlings and house sparrows is thought to be the primary cause of the population decline.[15]

Budgerigars and humans[edit]

Etymology[edit]

Budgerigar at Fort Worth Zoo in Texas. The blue cere at the top of the beak shows that this is a male

Alternative common names include shell parrot, warbling grass parakeet, canary parrot, zebra parrot, flight bird, scallop parrot and the alternate spellings budgerygah and betcherrygah.[16] Although more applicable to members of the genus Agapornis, the name lovebird has been applied to them from their habit of mutual preening.[16]

Several possible origins for the English name "budgerigar" have been proposed:

  • A mispronunciation or alteration of Gamilaraay gidjirrigaa [ɡ̊iɟiriɡaː],[17][18] possibly influenced by the Australian slang word "budgery", meaning "good".
  • Similarly, from gijirragaa from the Yuwaalaraay.[19] The nomadic nature of Australia's aboriginals would lend itself to forming common linguistic references, and since none had any written language, differences in pronunciation and the presentation thereof are subjective within the constructs of Western hearing.
  • A compound of "budgery", "good" and gar "cockatoo".[20] The word "budgery", also spelt "boojery", was formerly in use in Australian English slang meaning "good".

The budgerigar was first described by George Shaw in 1805, and given its current binomial name by John Gould in 1840. The genus name Melopsittacus comes from Greek and means "melodious parrot".[21] The species name undulatus is Latin for "undulated" or "wave-patterned".[22] Gould noted the term betcherrygah was used by indigenous people of the Liverpool Plains in New South Wales.[23] While many references mention "good" as part of the meaning, and a few specify "good bird", it is quite possible that reports by those local to the region are more accurate in specifying the direct translation as "good food".[24] There are apocryphal reports that this could also translate as "tasty treat", implying they were eaten by the aboriginals. However, it is more likely the name derived from their migratory nature. With seasonal changes that left parts of the Liverpool Plains barren, they would move to areas with residual water, that still produced the seeds they sought. By following the birds, the aboriginals could locate water, and also other game and food plants. Thus, the birds could lead them to "good food".


Aviculture[edit]

The budgerigar has been bred in captivity since the 1850s. Breeders have worked to produce a variety of colour, pattern, and feather mutations, including albino, blue, cinnamon-ino (lacewinged), clearwinged, crested, dark, greywinged, opaline, pieds, spangled, dilute (suffused), and violet.

English "budgie" (left), as compared to wild-type budgerigars

English or "show" budgerigars are about twice as large as their wild counterparts, and with a larger size and puffier head feathers have a boldly exaggerated look. The eyes and beak can be almost totally obscured by these fluffy head feathers. English budgerigars are typically more expensive than wild-type birds, and have shorter life span of about seven to nine years. Breeders of English budgerigars often exhibit their birds at animal shows. Most captive budgerigars in the pet trade are more similar in size and body conformation to wild budgerigars.

Budgerigars are social animals and require stimulation in the shape of toys and interaction with humans or with other budgerigars. Budgerigars, and especially females, will chew material such as wood. When a budgerigar feels threatened, it will try to perch as high as possible and to bring its feathers close against its body in order to appear thinner.

Tame budgerigars can be taught to speak, whistle, and play with humans. Both males and females sing and can learn to mimic sounds and words and do simple tricks, but singing and mimicry are more pronounced and better perfected in males. Females rarely learn to mimic more than a dozen words. Males can easily acquire vocabularies ranging from a few dozen to a hundred words. Pet males, especially those kept alone, are generally the best speakers.

Budgerigars will chew on anything they can find to keep their beaks trimmed. Mineral blocks (ideally enriched with iodine), cuttlebone, and soft wooden pieces are suitable for this activity. In captivity, budgerigars live an average of five to eight years, but life spans of 15–20 years have been reported.[25] The life span depends on breed, lineage, and health, being highly influenced by exercise and diet. Budgerigars have been known to cause "bird fancier's lung" in sensitive people, a type of hypersensitivity pneumonitis.[26]

Breeding[edit]

Head detail of a male budgerigar

Breeding in the wild generally takes place between June and September in northern Australia and between August and January in the south, although budgerigars are opportunistic breeders and respond to rains when grass seeds become most abundant.[9] They show signs of affection to their flockmates by preening or feeding one another. Budgerigars feed one another by eating the seeds themselves, and then regurgitating it into their flockmate's mouth. Populations in some areas have increased as a result of increased water availability at farms. Nests are made in holes in trees, fence posts, or logs lying on the ground; the four to six eggs are incubated for 18–21 days, with the young fledging about 30 days after hatching.[9][14]

In the wild, virtually all parrot species require a hollow tree or a hollow log as a nest site. Because of this natural behavior, budgerigars most easily breed in captivity when provided with a reasonable-sized nest box. The eggs are typically one to two centimetres long and are pearl white without any colouration if fertile. Female budgerigars can lay eggs without a male partner, but these unfertilised eggs will not hatch. When the female is laying eggs, her cere turns a crusty brown colour. A female budgerigar will lay her eggs on alternate days.[27] After the first one, there is usually a two-day gap until the next. She will usually lay between four and eight eggs, which she will incubate (usually starting after laying her second or third) for about 21 days each.[27] Females only leave their nests for very quick defecations, stretches and quick meals once they have begun incubating and are by then almost exclusively fed by their mate (usually at the nest's entrance). Females will not allow a male to enter the nest, unless he forces his way inside.[27] Depending on the clutch size and the beginning of incubation, the age difference between the first and last hatchling can be anywhere from 9 to 16 days. At times, the parents may begin eating their own eggs due to feeling insecure in the nest box.

Chick health[edit]

Breeding difficulties arise for various reasons. Some chicks may die from diseases and attacks from adults. Other budgerigars (virtually always females) may fight over the nest box, attacking each other or a brood. Sometimes, budgerigars (mainly males) are not interested in the opposite gender, and will not reproduce with them; a flock setting—several pairs housed where they can see and hear each other—is necessary to stimulate breeding. Another problem may be the birds' beaks being under lapped, where the lower mandible is above the upper mandible.

Most health issues and physical abnormalities in budgerigars are genetic. Care should be taken that birds used for breeding are active, healthy, and unrelated. Budgerigars that are related or which have fatty tumours or other potential genetic health problems should not be allowed to breed. Parasites (lice, mites, worms) and pathogens (bacteria, fungi and viruses), are contagious and thus transmitted between individuals through either direct or indirect contact. Nest boxes should be cleaned between uses.

Splay leg is a relatively common problem in baby budgerigars; one the budgerigar's legs is bent outward, which prevents it from being able to stand properly and compete with the other chicks for food, and can also lead to difficulties in reproducing in adulthood. The condition is caused by young budgerigars slipping repeatedly on the floor of a nest box. It is easily avoided by placing a small quantity of a safe bedding or wood shavings in the bottom of the nest box. Alternatively, several pieces of paper may be placed in the box for the female to chew into bedding.

Development[edit]

Eggs take about 18–20 days before they start hatching. The hatchlings are altricial – blind, naked, unable to lift their head, and totally helpless, and their mother feeds them and keeps them warm constantly. Around 10 days of age, the chicks' eyes will open, and they will start to develop feather down. The appearance of down occurs at the age for closed banding of the chicks. Budgerigar's closed band rings must be neither larger nor smaller than 4.0 to 4.2 mm.

They develop feathers around three weeks of age. (One can often easily note the colour mutation of the individual birds at this point.) At this stage of the chicks' development, the male usually has begun to enter the nest to help his female in caring and feeding the chicks. Some budgerigar females, however, totally forbid the male from entering the nest and thus take the full responsibility of rearing the chicks until they fledge.

Depending on the size of the clutch and most particularly in the case of single mothers, it may then be wise to transfer a portion of the hatchlings (or best of the fertile eggs) to another pair. The foster pair must already be in breeding mode and thus either at the laying or incubating stages, or already rearing hatchlings.

As the chicks develop and grow feathers, they are able to be left on their own for longer periods of time. By the fifth week, the chicks are strong enough that both parents will be comfortable in staying out of the nest more. The youngsters will stretch their wings to gain strength before they attempt to fly. They will also help defend the box from enemies, mostly with their loud screeching. Young budgerigars typically fledge (leave the nest) around their fifth week of age and are usually completely weaned between six to eight weeks old. However, the age for fledging, as well as weaning, can vary slightly depending on whether its age and the number of surviving chicks. Generally speaking, the oldest chick is the first to be weaned. Though it is logically the last one to be weaned, the youngest chick is often weaned at a younger age than its older sibling(s). This can be a result of mimicking the actions of older siblings. Lone surviving chicks are often weaned at the youngest possible age as a result of having their parents' full attention and care.

Hand-reared budgies may take slightly longer to wean than parent-raised chicks. Hand feeding is not routinely done with budgerigars, due to their small size, and because young parent raised birds can be readily tamed.

Colour mutations[edit]

Adult females (top) display beige to brown ceres, while adult males (bottom) typically have blue ceres or purplish-pink in albinistic and recessive pied varieties.

All captive budgerigars are divided into two basic series of colours; namely, white-based (blue, grey and white) and yellow-based (green, grey-green and yellow). Presently, at least 32 primary mutations (including violet) occur, enabling hundreds of possible secondary mutations (stable combined primary mutations) and colour varieties (unstable combined mutations).

Mimicry[edit]

Main article: Talking bird

Male specimens of budgerigars are considered to be one of the top five talking champions amongst parrot species, alongside the African grey, the Amazon, and the Eclectus parrots, and the ring-necked parakeet.[citation needed]

Puck, a male budgerigar owned by American Camille Jordan, holds the world record for the largest vocabulary of any bird, at 1,728 words. Puck died in 1994, with the record first appearing in the 1995 edition of Guinness World Records.[28][29]

In 2001, recordings of a budgerigar called Victor got some attention from the media. Victor's owner, Ryan B. Reynolds of Canada, stated Victor was able to engage in contextual conversation and predict the future.[30][31] Though some believe the animal was able to predict his own death as was claimed,[32] further study on the subject is difficult without the bird. The recordings still remain to be verified by scientific analysis.[33] Critics argue Victor's speech in the recordings is not coherent enough to be determined as spoken in context.[34]

Pet budgies have continued to make headlines all over the world for their mimicry, talking ability, and charm. One budgie, named Disco, has become an internet superstar.[35] As of 2013, Disco has been viewed over 6,067,744 times on his YouTube channel.[36] Some of Disco's most popular key phrases include, "I am not a crook" and "Nobody puts baby bird in a corner!"[37]

See also[edit]

References[edit]

  1. ^ BirdLife International (2012). "Melopsittacus undulatus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ "Dr. Marshall's Philosophy on Breeding Exhibition Budgerigars". Bird Health. 2004. Archived from the original on 2004-08-11. Retrieved 4 November 2013. 
  3. ^ Perrins, Christopher, ed. (2003). "Parrots, Lories, and Cockatoos". The New Encyclopedia of Birds (1 ed.). Oxford: Oxford University Press. ISBN 9780198525066. 
  4. ^ a b c Wright, TF; Schirtzinger EE, Matsumoto T, Eberhard JR, Graves GR, Sanchez JJ, Capelli S, Mueller H, Scharpegge J, Chambers GK and Fleischer RC (2008). "A Multilocus Molecular Phylogeny of the Parrots (Psittaciformes): Support for a Gondwanan Origin during the Cretaceous". Molecular Biology and Evolution 25 (10): 2141–2156. doi:10.1093/molbev/msn160. PMC 2727385. PMID 18653733. 
  5. ^ a b c Tokita, M; Kiyoshi T and Armstrong KN (2007). "Evolution of craniofacial novelty in parrots through developmental modularity and heterochrony". Evolution & Development 9 (6): 590–601. doi:10.1111/j.1525-142X.2007.00199.x. PMID 17976055. 
  6. ^ a b c de Kloet, RS; de Kloet SR (2005). "The evolution of the spindlin gene in birds: Sequence analysis of an intron of the spindlin W and Z gene reveals four major divisions of the Psittaciformes". Molecular Phylogenetics and Evolution 36 (3): 706–721. doi:10.1016/j.ympev.2005.03.013. PMID 16099384. 
  7. ^ a b c Schweizer, M.; Seehausen O, Güntert M and Hertwig ST (2009). "The evolutionary diversification of parrots supports a taxon pulse model with multiple trans-oceanic dispersal events and local radiations". Molecular Phylogenetics and Evolution 54 (3): 984–94. doi:10.1016/j.ympev.2009.08.021. PMID 19699808. 
  8. ^ Forshaw, p. 273
  9. ^ a b c d e f Forshaw, Joseph Michael; William T. Cooper (1973 & 1981). Parrots of the World (1st and 2nd ed.). ISBN 0-87666-959-3.  Check date values in: |date= (help)
  10. ^ a b S M Pearn, A T Bennett, and I C Cuthill (2001). "Ultraviolet vision, fluorescence and mate choice in a parrot, the budgerigar Melopsittacus undulatus". Proceedings. Biological sciences / the Royal Society 268 (1482): 2273–9. doi:10.1098/rspb.2001.1813. PMC 1088876. PMID 11674876. 
  11. ^ "Birds Online — How to tell the sex of a budgie". Retrieved 25 April 2006. 
  12. ^ "Talk Budgies FAQ". Retrieved 4 November 2013. 
  13. ^ Color Vision of the Budgerigar (Melopsittacus undulatus): Hue Matches, Tetrachromacy, and Intensity Discrimination.
    Timothy H. Goldsmith and Byron K. Butler in Journal of Comparative Physiology A, Vol. 191, No. 10, pages 933–951; October 2005.
  14. ^ a b "The Wild Budgerigar" (article). Retrieved 25 April 2006. 
  15. ^ Pranty 2001
  16. ^ a b Lendon, Alan H. (1973). Australian Parrots in Field and Aviary (2nd. ed). Sydney: Angus and Robertson. pp. 302–07. ISBN 0-207-12424-8. 
  17. ^ A Reference Dictionary of Gamilaraay
  18. ^ Delbridge, Arthur (1991). The Macquarie Dictionary (2 ed.). Sydney: The Macquarie Library Pty Ltd. p. 2049. ISBN 0-949757-63-2. 
  19. ^ Miriam-Webster Dictionary
  20. ^ Online etymology dictionary
  21. ^ Liddell, Henry George and Robert Scott (1980). A Greek-English Lexicon (Abridged Edition). United Kingdom: Oxford University Press. ISBN 0-19-910207-4. 
  22. ^ Simpson, D.P. (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd. ISBN 0-304-52257-0. 
  23. ^ "Indigenous Bird Names of the Hunter Region of New South Wales". Australian Museum website. Sydney, New South Wales: Australian Museum. 2009. Retrieved 22 February 2010. 
  24. ^ Hamilton & District Budgerigar Society
  25. ^ "Birds Online — Life span of a budgie". Retrieved 26 December 2005. 
  26. ^ "Budgerigar-fancier's lung: the commonest variety of allergic alveolitis in Britain". Br Med J 2 (6130): 81–4. July 1978. doi:10.1136/bmj.2.6130.81. PMC 1605890. PMID 566603. 
  27. ^ a b c "Talk Budgies — Breeding". Retrieved 4 November 2013. 
  28. ^ Claire Folkard (ed.) (ed.). Guinness World Records 2004. Guinness World Records Limited. p. 54. ISBN 0-85112-180-2. 
  29. ^ "The Bird with the Largest Vocabulary in the World". Archived from the original on 2007-09-28. Retrieved 4 November 2013. 
  30. ^ "Budgie Research". Archived from the original on 2003-11-30. Retrieved 4 November 2013. 
  31. ^ "Parakeets". Archived from the original on 2007-11-10. Retrieved 4 November 2013. 
  32. ^ "Talking Budgie Predicts His Own Death". Retrieved 4 November 2013. 
  33. ^ "Parakeets — info and games". Retrieved 4 November 2013. 
  34. ^ "Victor the Talking Budgie". Retrieved 4 November 2013. 
  35. ^ "WATCH: Disco, The Parakeet, Takes On 'Monty Python'". Retrieved 4 November 2013. 
  36. ^ "Disco the Parakeet". Retrieved 4 November 2013. 
  37. ^ "Disco the parakeet will blow your mind with his vintage banter". Retrieved 4 November 2013. 

Bibliography[edit]

  • Pranty, B. 2001. The Budgerigar in Florida: Rise and fall of an exotic psittacid. North American Birds 55: 389-397.
  • Forshaw, Joseph M. & Cooper, William T. (1978): Parrots of the World (2nd ed). Landsdowne Editions, Melbourne Australia ISBN 0-7018-0690-7
  • Collar, N. J. (1997). Budgerigar (Melopsittacus undulatus). Pg. 384 in: del Hoyo, J., Elliott, A. & Sargatal, J. eds. (1997).
    Handbook of the Birds of the World. Vol. 4. Sandgrouse to Cuckoos. Lynx Edicions, Barcelona. ISBN 84-87334-22-9

Further reading[edit]

The dictionary definition of budgerigar at Wiktionary

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!