Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Brief Summary

Bubo virginianus

A large (18-25 inches) owl, the Great Horned Owl is most easily identified by its brown body, flat disk-shaped face with large yellow eyes, and large brown “ear” tufts. This species may be distinguished from the similarly-sized Barred Owl (Strix varia) by that species’ lack of ear tufts and brown eyes. Male and female Great Horned Owls are similar to one another at all seasons. The Great Horned Owl is the most widely distributed owl species in the Americas. This species occurs from Alaska and northern Canada south to Central America, and South American populations occur from Venezuela south to southern Argentina and Chile. All populations of Barred Owl are non-migratory. Great Horned Owls may be found in a number of woodland habitat types across this species’ wide range, from cold evergreen woodland in the far north and south to humid tropical forest near the equator. Within these habitats, Great Horned Owls prefer open areas along woodland edges, frequently venturing outside the forest into nearby fields and meadows to hunt. Great Horned Owls eat small animals, including rodents, rabbits and hares, and small to medium-sized birds. Great Horned Owls use their excellent hearing to locate prey on the ground in order to fly down and capture it with its talons. Also, like most owls, this species hunts primarily at night, making it difficult to observe. Great Horned Owls are most visible roosting high in trees during the day, and may best be located while producing this species’ characteristic hooting calls between dawn and dusk.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Great Horned Owl is the most common and widespread large owl found in the Americas. Its range spans much of the New World from the Arctic tundra to the tip of South America. A variety of subspecies are recognized based on regional differences in size and color. Throughout its range, this owl has adapted to many different habitats and climates from temperate forests, tropical rainforests, and deserts to agricultural fields and urban parks, but it is generally more common in open, fragmented areas than in dense primary forests.

The Great Horned Owl is characterized by prominent ear tufts or "horns" from which it derives its name. It has large yellow eyes surrounded by a tawny facial disk. A conspicuous, narrow, white patch is often visible on the throat. The adult plumage is mottled and varies in color from reddish brown to light or dark grey. The underside usually has fine dark bars on a lighter background. These owls also have large feet that are feathered down to the strong, heavy talons. Immature owls resemble the adults, but their plumage color is generally lighter or more reddish. Their ear tufts are smaller and the white throat patch is not yet distinctive.

  • Houston, C. S., D. G. Smith, and C. Rohner. 1998. Great Horned Owl (Bubo virginianus). In The Birds of North America, No. 372 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
  • Johnsgard, P. A. 2002. North American Owls: Biology and Natural History. 2nd ed. Smithsonian Institution Press, Washington, DC, 298 pp.
  • König, C., F. Weick, and J.-H. Becking. 2009. Owls of the World. 2nd ed. Yale University Press, New Haven, CT, 528 pp.
  • Lynch, W. 2007. Owls of the United States and Canada: a complete guide to their biology and behavior. JHU Press, 242 pp.
  • Mc Gillivray, W. B. 1989. Geographic variation in size and reverse size dimorphism of the Great Horned Owl in North America. Condor 91:777-786.
  • Newton, I., R. Kavanagh, J. Olsen, and I. Taylor, eds. 2002. Ecology and Conservation of Owl. CSIRO Publishing, 363 pp.
  • Smith, D. G. 2002. Great Horned Owl. Stackpole Books, 106 pp.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The great horned owl breeds from western and central Alaska and central
Yukon east to Labrador and Newfoundland and south throughout North and
South America to Tierra del Fuego. Winter range is essentially the same
except for some migration to the southeast by northern populations,
usually in severe winters [14].
  • 14. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID IL IN IA KS KY LA ME MD MA
MI MN MS MO MT NE NV NH NJ NM
NY NC ND OH OK OR PA RI SC SD
TN TX UT VT VA WA WV WI WY DC


AB BC MB NB NF NT NS ON PE PQ SK YT

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Great Horned Owls have a large geographic range. They are native to both the Nearctic and Neotropical regions. They live throughout the forests of North, Central, and South America, from the Arctic regions in the North to the Straits of Magellan in the South.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The great horned owl has a large geographic range. It is found throughout the forests of North, Central, and South America, from the Arctic regions in the North to the Straits of Magellan in the South.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: western and central Alaska to southern Keewatin and Labrador, south to southern South America. NON-BREEDING: generally throughout breeding range; northernmost populations partially migratory, wintering south to southern Canada and northern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Great Horned Owls are the fiercest and most powerful of the common owls. They are easily recognized by the feather tufts on their head that resemble horns or ears, sometimes called cat owls because of their catlike ears, eyes, shape of head, and appearance when huddled on the nest. The upper parts of the owl's body are sooty brown with gray-brown mottling. They have dark underparts which contrast sharply with their white throat. The coloration makes them well camoflaged and difficult to spot in the forest. They measure about 50 cm in length and have a wingspan of 140 cm from wing tip to wing tip. Males and females are similar in size.

Average length: 50.0 cm.

Average wingspan: 140.0 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 1450 g.

Average basal metabolic rate: 5.2442 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The great horned owl, the fiercest and most powerful of the common owls, is visually stunning. It is sometimes called the cat owl because of its catlike ears, eyes, shape of head, and appearance when huddled up on its nest. The great horned owl is highly recognizable for the feather tufts on its head that resemble horns. The upper parts of the owl's body are sooty brown with gray-brown mottling, and its dark underparts make its white throat standout. The great horned owl measures approximately .5 m. in length and has a wingspan of approximately 1.4 m from tip to tip.

Average mass: 1450 g.

Average basal metabolic rate: 5.2442 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 56 cm

Weight: 1769 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cover Requirements

More info for the term: tree

Nesting: The great horned owl usually uses nests that were built by
other bird species, especially hawks (Buteonidae), herons (Ardeidae),
and crows (Corvus spp.) [14], but also common ravens (C. corax),
ferruginous hawks (Buteo regalis), and red-tailed hawks (B.
jamaicensis). Great horned owls also use nest cavities excavated by
pileated woodpeckers (Drycopus pileatus) [18]. In northeastern Wyoming
great horned owls use nests of golden eagle (Aquila chrysaetos),
ferruginous hawk, red-tailed hawk, and Swainson's hawk (B. swainsonii)
[33]. Great horned owl nests are up to 70 feet (21 m) above ground in
cavities, tree limb crotches, stumps, caves, and rocky crevices, and on
ledges [14,33]. In the Great Basin great horned owls nested in juniper
trees, on cliffs, and in abandoned quarries with steep fronts [18]. The
great horned owl commonly uses the same territory but a different nest
each season. In Wyoming one pair continuously occupied the same
territory for 7 successive years and another pair held a territory for 8
years. Great horned owls occasionally reuse the same nest in successive
breeding seasons [7].

Roosting: Great horned owls usually roost in places that allow maximum
concealment during daylight hours. They often choose trees with dense
foliage that are separated from other trees in the area. Conifers are
favored when present; in deciduous forests great horned owls prefer
trees that hold clusters of dead leaves over the winter (i.e., oaks and
American beech) [24].

In urban settings, great horned owls nest in deserted buildings,
powerline towers, haylofts of abandoned barns, and artificial nests
[10].

Hunting: Great horned owls often hunt from perches adjacent to open
areas. They usually fly below the treetops but occasionally fly
slightly higher [25].
  • 7. Bluhm, Cynthia K.; Ward, E. Kevin. 1979. Great horned owl predation on a short-eared owl. Condor. 81(3): 307-308. [22254]
  • 10. Cringan, Alexander T.; Horak, Gerald C. 1989. Effects of urbanization on raptors in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 219-288. [22381]
  • 14. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 18. Frischknecht, Neil C. 1975. Native faunal relationships within the pinyon-juniper ecosystem. In: The pinyon-juniper ecosystem: a symposium: Proceedings; 1975 May; Logan, UT. Logan, UT: Utah State University, College of Natural Resources, Utah Agricultural Experiment Station: 55-56. [974]
  • 24. Johnsgard, Paul A. 1988. North American owls. Washington, DC: Smithsonian Institute Press. 295 p. [23301]
  • 25. Karalus, Karl E.; Eckert, Allan W. 1974. The owls of North America (north of Mexico). Garden City, NY: Doubleday & Company, Inc. 278 p. [24579]
  • 33. Phillips, Robert L.; Beske, Alan E. 1990. Distribution and abundance of golden eagles and other raptors in Campbell and Converse Counties, Wyoming. Fish and Wildlife Technical Report 27. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 31 p. [15473]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: density, frequency, shrub

Great horned owls occupy more diverse habitats than any other owl;
habitats harboring great horned owls include deep forests (both
coniferous and deciduous), open woodlands, chaparral, desert cliffs,
woodlots, and wooded urban environments [12,32]. Great horned owls
prefer mature successional stages with openings [32]. Great horned owl
habitat usually includes fields and/or wetlands. Recent findings
suggest a lower density of great horned owls in heavily forested tracts
than in more open areas; for example, there is a lower frequency of
great horned owls in the heavily wooded northern third of Wisconsin than
in the more open southern two-thirds [32]. In Utah great horned owls
were found most frequently in thinned stands. They often forage in
slash piles [43]. In Maryland great horned owls are found in forests
and woodlots, adjacent fields, and marshes [38]. In New Jersey great
horned owls avoid close contact with human habitation and prefer to be
near water courses and in upland and lowland hardwoods. In southeastern
Wisconsin, an average of 27 percent of the entire annual home range was
wooded or in marshlands and wet shrub communities; the remainder varied
among open areas and agricultural developments. Actual usage patterns
within home ranges were concentrated in areas with appropriate hunting
and nesting sites (i. e., perches near open areas) [31,32]. The great
horned owl is found from sea level to timberline [13,37].

Home Range: In southeastern Wisconsin the average size of the great
horned owl's annual home range was about 813 acres (329 ha). Home
ranges of successful breeders were larger. Home ranges decreased for
both successful and unsuccessful breeders in spring as prey availability
increased. During summer, home ranges gradually expanded again [31].
Petersen [31] reported a density of one pair per 3 square miles (7.5 sq
km) in southeastern Wisconsin, but an active breeding density of one
pair per 4 square miles (9.3 sq km). Nesting densities of great horned
owls in Michigan ranged from 0.15 to 0.26 bird per square kilometer.
The average home range was 524 acres (212 ha) [9]. In eastern South
Dakota the daily range of great horned owls exceeded observation plot
size of 100 acres (40 ha) [16].

Roosting: Great horned owls usually roost in dense foliage, tree
cavities, old nests, and crevices in rocks [12].

Nesting: Nest sites are often chosen adjacent to open areas suitable
for hunting lagomorphs (Leporidae) and rodents (Rodentia) [13]. In
western grasslands, great horned owls were observed in four habitats:
unbroken grassland, creek bottoms, cliffs, and cultivated land. The
majority of great horned owl observations (80.5%) occurred in creek
bottoms [30]. Riparian areas are preferred for nest sites in the
northeastern states [28]. Supporting substrates for great horned owl
nests included trees (85%), cliffs (9.8%), and creekbanks (4.9%) [30].
In southeastern Wisconsin the number of active breeding pairs of great
horned owls was apparently related to cottontail (Silvilagus spp.)
density; owl productivity (number of young fledged) was positively
related to abundance of staple prey [31].

Hunting: Prey availability in grasslands is a function of prey density,
vegetation structure, and mode of hunting. Raptors tend to hunt in
areas with high capture probability [4]. In northeastern Colorado great
horned owls were observed in grazed bottomlands more often than in
ungrazed bottomlands, possibly because the lower vegetation left prey
more vulnerable [11]. Sympatry with common barn owls (Tyto alba) is
made possible by differing hunting strategies; for example, great horned
owls tend to hunt from perches and common barn owls typically capture
prey during flight [23].
  • 4. Andersen, David E. 1991. Management of North Amercian grasslands for raptors. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symosium and workshop; [Date of conference unknown]
  • 9. Craighead, John J.; Craighead, Frank C., Jr. 1969. Hawks, owls and wildlife. Dover Edition. New York: Dover Publications, Inc. 443 p. [24517]
  • 11. Crouch, Glenn L. 1982. Wildlife on ungrazed and grazed bottomlands on the South Platte River, northeastern Colorado. In: Wildlife and livestock relationships: Proceedings of the symposium; 1981; Coeur D'Alene, ID. Moscow, ID: University of Idaho, Forest, Wildlife, and Range Experiment Station: 186-197. [24056]
  • 12. de la Torre, Julio. 1990. Owls: Their life and behavior. New York: Crown Publishers. 214 p. [24580]
  • 13. DeGraaf, Richard M. 1978. New life from dead trees. National Wildlife. 16(4): 28-31. [13650]
  • 16. Emmerich, John M.; Vohs, Paul A. 1982. Comparative use of four woodland habitats by birds. Journal of Wildlife Management. 46(1): 43-49. [19283]
  • 23. Janes, Stewart W. 1985. Habitat selection in raptorial birds. In: Cody, Martin L., ed. Habitat selection in birds. [Place of publication unknown]
  • 28. Lanier, John W.; Foss, Carol F. 1988. Habitat management for raptors on large forested tracts and shorelines. In: Proceedings of the northeast raptor management symposium and workshop; 1988 May 16-18; [Location of conference unknown]
  • 30. Olendorff, Richard R.; Stoddart, John W., Jr. 1974. The potential for management of raptor populations in western grasslands. In: Hamerstrom, B. E., Jr.; Harrell, W.; Olendorff, R. R., eds. Raptor Research: Report 2: 47-88. [22982]
  • 31. Petersen, LeRoy. 1979. Ecology of great horned owls and red-tailed hawks in southeastern Wisconsin. Tech. Bull. No. 111. Madison, WI: Department of Natural Resources. 63 p. [24967]
  • 32. Petersen, Leroy R. 1991. Mixed woodland owls. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symposium and workshop; [Date of conference unknown]
  • 37. Stebbins, C. A.; Stebbins, R. C. 1954. [Unknown]
  • 38. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]
  • 43. Woyda, Ann L.; Kessler, Winifred B. 1982. The response of selected owl species to silvicultural treatments on the Dixie National Forest, Utah. Final Report on Cooperative Agreement No. INT-81-129-CA. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 46 p. [17159]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the terms: cover, density

Great horned owls occupy a wide variety of forested habitats including
open coniferous and deciduous forests, mixed woods, orchards, second
growth forests, marshes, swamps, riverine forests, partially wooded
slopes, brushy hillsides, farm woodlots, and large city parks [13]. In
the western states great horned owls are often found in oak (Quercus
spp.) and pinyon (Pinus spp.)-juniper (Juniperus spp.) woodland [40].
In Idaho great horned owls are common wherever trees are large enough
for shelter [8]. In west-central Utah great horned owls are permanent
residents in pinyon-juniper woodlands [18]. In the Little Missouri
National Grasslands of western North Dakota, great horned owls were
observed in cottonwood (Populus spp.) woodlands but not in ash (Fraxinus
spp.) or juniper types. In this area, cottonwoods were lower in total
tree density but had higher canopy coverage than other types. In
cottonwood woodlands ground cover was 20 percent, dominated by grasses
[20]. In northeastern Wyoming great horned owls occupy riparian areas
dominated by eastern cottonwood (P. deltoides) and willows (Salix spp.)
surrounded by upland big sagebrush (Artemisia tridendata)-grassland
(primarily Agropyron) communities [33]. In Ohio, great horned owls
occur in virgin American beech (Fagus grandifolia)-maple (Acer spp.)
forests [1]. In the southeastern United States great horned owls are
common in baldcypress (Taxodium distichum) swamps and expansive, dense
cabbage palmetto (Sabal palmetto)-pine woodlands [13].

Andersen [4] listed the great horned owl as a secondary grassland
raptor; it sometimes breeds in grasslands but more typically breeds in
woodlands, edge communities, or partly open habitats.

REFERENCES :
NO-ENTRY
  • 1. Adams, Diana L.; Barrett, Gary W. 1976. Stress effects on bird-species diversity within mature forest ecosystems. American Midland Naturalist. 96(1): 179-194. [16495]
  • 4. Andersen, David E. 1991. Management of North Amercian grasslands for raptors. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symosium and workshop; [Date of conference unknown]
  • 8. Burleigh, Thomas D. 1950. Idaho owls should be pampered, not persecuted; most species aid in controlling small rodents. Idaho Wildlife Review. June/July: 4-5. [21307]
  • 13. DeGraaf, Richard M. 1978. New life from dead trees. National Wildlife. 16(4): 28-31. [13650]
  • 18. Frischknecht, Neil C. 1975. Native faunal relationships within the pinyon-juniper ecosystem. In: The pinyon-juniper ecosystem: a symposium: Proceedings; 1975 May; Logan, UT. Logan, UT: Utah State University, College of Natural Resources, Utah Agricultural Experiment Station: 55-56. [974]
  • 20. Hopkins, Rick B.; Cassel, J. Frank; Bjugstad, Ardell J. 1986. Relationships between breeding birds and vegetation in four woodland types of the Little Missouri National Grasslands. Res. Pap. RM-270. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 12 p. [2758]
  • 33. Phillips, Robert L.; Beske, Alan E. 1990. Distribution and abundance of golden eagles and other raptors in Campbell and Converse Counties, Wyoming. Fish and Wildlife Technical Report 27. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 31 p. [15473]
  • 40. Tyler, Hamilton, A.; Phillips, Don. 1978. Owls by day and night. Happy Camp, CA: Naturegraph Publishers, Inc. 208 p. [24602]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the term: cover

The great horned owl occurs in most SRM cover types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

The great horned owl occurs in all SAF types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

The great horned owl occurs in all Kuchler types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great Horned Owls can be found in dense woodlands of hardwoods and conifers, along cliffs and rocky canyons, and in forest openings.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Within its range the great horned owl can be found in dense woodlands of hardwoods and conifers, along cliffs and rocky canyons, and in forest openings. In general, the great horned owl is solitary and inhabits unsettled places.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Various forested habitats, moist or arid, deciduous or evergreen lowland forest to open temperate woodland, including second-growth forest, swamps, orchards, riverine forest, brushy hillsides, and desert. Very local in tropical lowlands (Hilty and Brown 1986).

Nest sites in different areas include: in trees in old or usurped nests of other birds (e.g., hawk, crow) or squirrel; tree cavities; stumps; rocky ledges; caves; in barns; and on artificial platforms. Usually in heaviest available timber in east; sites more diverse in arid west. Typically does not use same tree nest in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Northern populations partially migratory; some individuals, especially young, found in winter up to a few hundred km south of banding site. Band recoveries indicate that most individuals remain within 80 km of banding site (Johnsgard 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

More info for the term: litter

The great horned owl uses a wide variety of prey and takes animals up to
the size of young wild turkey (Meleagris gallopavo) and common porcupine
(Erethizontidae dorsatum). Small- to medium-sized mammals and birds are
preferred, including hares and rabbits (Leporidae), mice (Muridae),
Virginia opossum (Didelphis virginiana), common muskrat (Ondatra
zibethicus), squirrels (Sciuridae), pocket gophers (Geomyidae), and
voles (Microtus spp.) [12]. Great horned owls also take reptiles
(including snakes), amphibians, large insects, and fish [12,14]. In the
Sierra Nevada 61 percent of great horned owl diet consisted of
cottontails; woodrats (Neotoma spp.) were the second most consumed food
item. Pocket gophers and snakes were minor dietary components. In
Oklahoma 25 percent of great horned owl diet was cottontails, 18 percent
pocket mice (Perognathus spp.), 12 percent kangaroo rats (Dipodomys
spp.), and 10 percent grasshopper mice (Onychomys spp.) [40]. Other
prey items include skunks (Mephitis and Spilogale spp.), ducks and geese
(Anatidae), ring-necked pheasant (Phasianus colchicus), grouse
(Phasianidae), domestic chickens, woodpeckers (Picidae), orioles
(Icterus spp.), and jays (Corvidae) [12]. Large prey can include small
dogs, domestic cats, and young foxes (Vulpes and Urocyon spp.) [10,25].
Predation on songbirds is minimal [12]. In northeastern Wyoming
riparian areas and adjacent big sagebrush-grasslands, the prey base for
great horned owls consists largely of white-tailed jackrabbit (Lepus
townsendii), cottontails, and black-tailed prairie dog (Cynomys
ludovicianus). Other mammals and reptiles are common prey items [33].

Hunting Style: Great horned owls usually hunt from a perch at the edge
of a clearing, making short flights out to capture prey. They also
forage on the wing. On occasion, great horned owls have been observed
walking on the forest floor turning over litter and other materials to
find insects, mice, and shrews (Soricidae). Great horned owls wade into
shallow water for crayfish, fish, frogs, and turtles [24,25].
  • 10. Cringan, Alexander T.; Horak, Gerald C. 1989. Effects of urbanization on raptors in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 219-288. [22381]
  • 12. de la Torre, Julio. 1990. Owls: Their life and behavior. New York: Crown Publishers. 214 p. [24580]
  • 14. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 24. Johnsgard, Paul A. 1988. North American owls. Washington, DC: Smithsonian Institute Press. 295 p. [23301]
  • 25. Karalus, Karl E.; Eckert, Allan W. 1974. The owls of North America (north of Mexico). Garden City, NY: Doubleday & Company, Inc. 278 p. [24579]
  • 33. Phillips, Robert L.; Beske, Alan E. 1990. Distribution and abundance of golden eagles and other raptors in Campbell and Converse Counties, Wyoming. Fish and Wildlife Technical Report 27. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 31 p. [15473]
  • 40. Tyler, Hamilton, A.; Phillips, Don. 1978. Owls by day and night. Happy Camp, CA: Naturegraph Publishers, Inc. 208 p. [24602]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Great horned owls hunt at night and capture a variety of small mammals. Their prey includes Sylvilagus floridanus, Marmota monax, Peromyscus leucopus, Rattus norvegicus, Sciuridae, and Mephitis mephitis. Great horned owls are also known to eat birds such as Anas platyrhynchos, Zenaida macroura and Columba livia, Colinus virginianus, and occasionally Branta canadensis or turkeys.

Owls as a group eat their prey whole and regurgitate the unwanted parts (bones, fur, and feathers) in pellets, called owl pellets. By looking at the contents of owl pellets we can learn about the food habits of particular owl species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic feeder; eats mainly mammals (commonly mouse to rabbit size) and small to large birds (including hawks and waterfowl). Parents provide up to about 300 g of food per day per nestling.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Owls as a group eat their prey whole and regurgitate the unwanted parts (bones, fur, and feathers) in pellets. The food habits of the great horned owl are best ascertained by studying the remains of its prey in these pellets.

The great horned owl is a bird of prey that feeds on a varied assortment of animal life. It does the majority of its hunting at night, preferring to feed on small mammals, such as rabbits, woodchucks, mice, rats, squirrels, and skunks. The great horned owl is also known to feed on birds such as ducks, game birds, quails, and occasionally geese or turkeys.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Associations

Predators

More info for the term: natural

Adult great horned owls have no natural routine predators. Antagonistic
interactions with red-tailed hawks and crows are common [25]. Crows mob
and harass great horned owls during the day; great horned owls attack
roosting groups of crows at night, killing many at a time [12].
  • 12. de la Torre, Julio. 1990. Owls: Their life and behavior. New York: Crown Publishers. 214 p. [24580]
  • 25. Karalus, Karl E.; Eckert, Allan W. 1974. The owls of North America (north of Mexico). Garden City, NY: Doubleday & Company, Inc. 278 p. [24579]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Great Horned Owls are top predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Very few animals hunt adult great horned owls. As young in the nest they may be preyed on by large nest predators, such as Procyon lotor. Young owls may be taken by other large, predatory birds, such as Buteo jamaicensis and Accipiter cooperi.

Known Predators:

  • Accipiter cooperii
  • Buteo jamaicensis
  • Procyon lotor

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, density

The effects of fire on prey species are probably the most important
habitat related fire effects on great horned owls. Prey availability is
often enhanced by removal of surface cover. Decreases in prey
populations after fire probably result in lowered nesting success or
even a change in residency for great horned owls. In California, great
horned owl density was high following a fire in chaparral, but
reproductive success decreased later, possibly because loss of habitat
concentrated raptors into a smaller area and led to increased
competition for prey [42].
  • 42. Wirtz, W. O., II. 1982. Postfire community structure of birds and rodents in southern California chaparral. In: Conrad, C. Eugene; Oechel, Walter C., technical coordinators. Proceedings of the symposium on dynamics and management of Mediterranean-type ecosystems; 1981 June 22-26; San Diego, CA. Gen. Tech. Rep. PSW-58. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station: 241-246. [6025]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: altricial, formation

Migration: Great horned owls are resident in most parts of their range
in North America [32]. Most (93%) banded birds from a wide range of
study sites have been recovered within 48 miles (80 km) of the banding
location. Great horned owls banded in the South had traveled shorter
distances than great horned owls banded in the North [24]. Great horned
owls migrate away from conifer bogs and forests in the northern parts of
their range in severe winters. It is also common for great horned owls
to move from Canada to the northern Great Lakes States in winter [32].

Pair Formation: Great horned owls are usually the earliest nesting
raptors. Pair formation occurs in early winter; the male chooses a nest
site and attempts to attract a female by copious vocalizations [24].

Nesting: In Maryland and the District of Columbia great horned owls
nest from late January to late May; extreme egg dates are January 27 and
April 12 [38]. The typical great horned owl clutch is two or three
eggs; clutch sizes range from one to six eggs. The male feeds the
female while she incubates the eggs. Incubation time is 25 to 30 days
[12].

Development of Young: Hatching dates usually occurs in mid-February.
The altricial young are downy, with eyes closed. Their eyes usually
open by 7 days. Hatchlings are brooded almost constantly by the female
for up to 3 weeks. The male parent guards the nest closely. Nestlings
often edge out of the nest by about 32 days but remain near the nest and
continue to be cared for by the parents until after full flight is
achieved. At about 6 weeks of age nestlings begin flapping and learning
to fly; first flight may occur by 9 weeks but sustained flight is
usually not achieved until about 12 weeks. Fledglings may spend up to
14 days on the ground prior to achieving full flight capability [12,25].

Age at First Breeding: The great horned owl usually first breeds at
2 years of age [25].

Diurnal Activity: In Manitoba juvenile great horned owls were observed
hunting between 8 p.m. and 12 a.m. in July and August [7].

Longevity: The oldest banded great horned owl recovered in the wild was
13 years old. Captive birds may live more than 20 years [25].
  • 7. Bluhm, Cynthia K.; Ward, E. Kevin. 1979. Great horned owl predation on a short-eared owl. Condor. 81(3): 307-308. [22254]
  • 12. de la Torre, Julio. 1990. Owls: Their life and behavior. New York: Crown Publishers. 214 p. [24580]
  • 24. Johnsgard, Paul A. 1988. North American owls. Washington, DC: Smithsonian Institute Press. 295 p. [23301]
  • 25. Karalus, Karl E.; Eckert, Allan W. 1974. The owls of North America (north of Mexico). Garden City, NY: Doubleday & Company, Inc. 278 p. [24579]
  • 32. Petersen, Leroy R. 1991. Mixed woodland owls. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symposium and workshop; [Date of conference unknown]
  • 38. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Saskatchewan, productivity (number of young per nest and number of breeders) peaked with peak in snowshoe hare population (Houston 1987); declines in hare density resulted in increased owl dispersal and mortality (Houston and Francis 1995). Home range size varies seasonally and geographically. Breeding territories in southwest Yukon ranged from 230-883 hectares, averaging 483 hectares; home ranges of nonterritorial floaters overlapped the territorial pairs and averaged 725 hectares (Rohner 1997). Density varies in different areas, usually about 1 pair per 5-20 sq km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Great Horned Owls communicate with sounds and body movements, such as hooting, hissing, calling, fluffing feathers, posture, and bill snapping. They have extraordinarily good eyesight in low light conditions and can hear very well. Their ears are not located exactly opposite each other on the head of these owls. This allows Great Horned Owls to better pinpoint the location of sounds, such as the sound of a mouse running.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

A Great Horned Owl banded in the United States lived at least 27 years and 7 months. Most Great Horned Owls live much shorter lives, probably around 13-15 years in the wild.

Range lifespan

Status: wild:
27.0 (high) years.

Average lifespan

Status: wild:
13.0 years.

Average lifespan

Status: wild:
333 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Range lifespan

Status: wild:
29 (high) years.

Average lifespan

Status: wild:
333 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29 years (wild) Observations: Though sexual maturity may be reached at earlier ages, breeding normally does not occur before age 2. The record longevity in the wild is 13 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating System: monogamous

The courtship of Great Horned Owls usually begins in late January or early February. After mating these owls will use the abandoned nest of another bird, usually a hawk or crow. One female usually lays 2 or 3 eggs, and rarely as many as 5. The male and the female will both incubate the eggs, which means both parents take turns sitting on the nest to keep the eggs warm until they hatch. The chicks hatch in about 4 weeks.

Breeding interval: Great Horned Owls raise one family each year.

Breeding season: Great Horned Owls breed from early spring through summer.

Range eggs per season: 2.0 to 5.0.

Average eggs per season: 2.0.

Average time to hatching: 4.0 weeks.

Average fledging age: 7.0 weeks.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average time to hatching: 27 days.

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Both parents incubate and feed the chicks. Great Horned Owls are protective parents, guarding the young until they are fully grown. The young are old enough to leave the family (fledge) about 7 weeks after they hatch.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The courtship of the great horned owl usually begins in late January or early February. The mating rituals of the owl include the singing of love songs between the female and male. After mating the owls will use the abandoned nest of another bird, usually a hawk or crow. The eggs usually number 2-3, and rarely as many as 5. The great horned owl raises one family each year. The male and the female will both incubate the eggs, which will hatch in approximately 4 weeks. The great horned owl is also known to be a very protective parent, guarding the young until they mature fully and can leave the family (at approx. 1-2 months old).

Average time to hatching: 27 days.

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size averages 2-3. Incubation lasts 26-35 days, mostly by female (male supplies food). Young leave nest at 4-5 weeks, fly well at 9-10 weeks, dependent on parents for several weeks. Most yearling females do not nest. Lost clutch may be replaced. Longevity record in the wild is at least 28 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nesting

Great Horned Owls are opportunistic nesters building their crude nests on a variety of substrates including trees, cliffs, stream banks, columnar cacti, and human-made structures. They often take over abandoned nests of other large birds such as hawks, raven, or crows.

  • Houston, C. S., D. G. Smith, and C. Rohner. 1998. Great Horned Owl (Bubo virginianus). In The Birds of North America, No. 372 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
  • Johnsgard, P. A. 2002. North American Owls: Biology and Natural History. 2nd ed. Smithsonian Institution Press, Washington, DC, 298 pp.
  • König, C., F. Weick, and J.-H. Becking. 2009. Owls of the World. 2nd ed. Yale University Press, New Haven, CT, 528 pp.
  • Lynch, W. 2007. Owls of the United States and Canada: a complete guide to their biology and behavior. JHU Press, 242 pp.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bubo virginianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATCGGCACCCTCTACCTAATCTTCGGGGCATGAGCAGGCATAGTTGGCACTGCCCTCAGCCTACTCATCCGAGCCGAGCTCGGGCAACCCGGGACCCTTCTTGGCGAT---GACCAAATCTACAACGTAGTTGTCACCGCCCATGCCTTTGTAATAATCTTTTTTATAGTCATACCCATCATGATCGGAGGATTTGGAAACTGATTAGTCCCACTAATAATTGGAGCCCCAGACATAGCCTTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCACCCTCACTCCTACTCCTACTAGCCTCCTCCACTGTAGAAGCCGGAGCAGGCACCGGATGGACCGTCTACCCCCCATTAGCTGGCAACCTAGCCCATGCCGGCGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACTTGGCTGGAGTATCATCTATCCTGGGGGCAATTAACTTCATCACCACTGCCATTAACATAAAACCCCCAGCACTCTCACAATACCAAACCCCCCTATTCGTATGATCTGTCCTCATCACCGCCATTCTCCTCCTACTATCTCTCCCAGTCCTCGCCGCCGGAATTACCATACTACTAACCGACCGCAACTTAAACACCACATTCTTCGACCCCGCCGGAGGAGGCGACCCAATCCTATATCAACACCTCTTCTGATTCTTGGGCCACCCAGAAGTCTACATCCTAATCCTCCCCGGCTTTTGGATTATCTCCCACGTAGTCGCCTACTACGCAGGCAAAAAAGGACCATTCGGTTACATTGGCATAGTCTGGGCCATACTGTCAATCGGATTCCTAGGCTTTATTGTATGAGCCCACCATATATTTACAGTAGGCATAGATGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bubo virginianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Great Horned Owls are fairly common throughout their range. They are protected under the U.S. Migratory Bird Act.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Despite the reputation that the great horned owl has gotten from angry poultry raisers, they are not as harmful as thought in the past. That they control pest populations has been recognized. Now, the great horned owl and other birds of prey are given complete protection in most states throughout the United States.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the terms: fire-free interval, prescribed fire

Great horned owls use but are not limited to the following fire
dependent ecosystems:

Presettlement Fire Regime
______________________________________________________________
Habitat Average Fire-Free Interval

grasslands 1-5 years
semidesert grass-shrub up to 10 years
sagebrush (Artemisia spp.)-grass 20-100 years
chaparral 20-40 years
pinyon-juniper 10-30 years
ponderosa pine (Pinus ponderosa) 5-10 years
Douglas-fir (Pseudotsuga menziesii) 100-500 years
redwood (Sequoia sempervirens) 17-82 years
giant sequoia (Sequoiadendron gigantea) 5-10 years

Fire exclusion has had more detrimental effects than benefits on raptor
habitat. Prescribed fire in raptor habitats usually does not conflict
with raptor habitat objectives and can in many cases be beneficial [29].
  • 29. Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire exclusion and fire management on raptor habitats in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 236-244. [22324]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the terms: cover, density, presence, tree

Population Stability: The great horned owl is a widespread and common
raptor. All the midwestern states report great horned owls as common to
abundant, and they are common to abundant in the Great Plains. Most
great horned owl populations are currently stable or increasing. Only
on the High Plains Border and the Unglaciated Missouri Plateau
physiographic provinces did Breeding Bird Survey data suggest declining
populations [32]. Nesting densities and territory sizes fluctuate
annually, probably due to changes in food supply. In Wyoming a
particularly small nesting population was observed in the same year that
cottontail populations were unusually low. Temporary declines in prey
base are unlikely to cause any long-term great horned owl population
perturbations since great horned owl pairs unsuccessful breeders one
year are often successful in other years [34]. Only the most general
raptor management considerations need to be made for great horned owls,
such as retention of cavity trees, protection of riparian woods within
grasslands, and protection from human harassment [30,33].

Forest Composition: In the northeastern United States, woods consisting
of hardwoods and pines are good habitat for great horned owl and other
raptors (barred owl [Strix varia], northern goshawk [Accipiter
gentilis], broad-winged hawk [Buteo platypterus], and red-tailed hawk).
Forest unit management guidelines should be set in relationship to
selected home range size; since the great horned owl has a very large
home range, managers should consider forest composition objectives in
groups of units rather than individual units. All cavity trees and at
least 10 percent of remaining forest cover should be mature and/or
decadent trees. Silviculture treatments favoring raptors in the White
Mountain National Forest, New Hampshire, included one 0.25- to 0.5-acre
(0.1-0.2 ha) plot left uncut for every 10 acres (4 ha) cut in
regeneration plots. Uncut areas contained at least one living tree 18
inches (45.7 cm) or more in diameter with at least two major defects.
Wherever possible, uncut areas included existing raptor nests (any
species, since great horned owls use old nests of other raptors) [28].
Similarly, in Utah wildlife management considerations included leaving
large old trees for cavity nesters. Woyda and Kessler [43] were of the
opinion that harvest patterns that result in even-aged regeneration
would only be appropriate for great horned owl and other species that do
not require a variety of tree age classes.

Young [44] lists the great horned owl as capable of persisting in
agricultural areas; nesting densities are strongly influenced by
intensity of land use, agricultural practices, and human activity.
Winter use of agricultural areas by great horned owls is common [44].

Artificial Nests: Great horned owls use artificial nests when more
suitable nest sites are unavailable. However, adding artificial nest
and perch sites in grasslands may encourage the use of grasslands by
woodland and edge species at the expense of raptors that primary use
grasslands [4].

Urban Settings: Wintering great horned owl density reflects
availability of medium-sized prey such as skunks, domestic cats, etc. [10].

Mortality: Major causes of death for great horned owls include
collisions with vehicles, shooting, and starvation [24,32]. The highest
mortality rates are among juveniles, largely due to cannibalism and
severe weather; annual mortality rate was 15 percent for nestlings, 58
percent for juveniles, 44 percent for 1- to 2-year-olds, and 28 percent
for adults over 2 years old [24,25]. At least 52 percent of banded and
recovered great horned owls had been shot and 12 percent had been
trapped; perhaps as many as 96 percent had been killed intentionally
[24]. Mortality due to pesticides during 1946 to 1968 was minimal [32];
however, poisoning of great horned owls due to pesticides used in urban
and suburban environments has been increasing [12].

Nuisance: The majority of respondents to a raptor nuisance survey
(33/54) reported great horned owl nuisance, damage, or safety problems.
Most reported problems involved predation at poultry and game farms, and
at beagle clubs (preying on domestic rabbits kept for club activities).
Other nuisance problems involved predation on pets including exotic
animals and birds [21].

Raptor Reintroduction Projects: Great horned owl presence at peregrine
falcon (Falco peregrinus) release sites is detrimental to the survival
of nestling and juvenile peregrine falcons. Great horned owls occupy
suitable peregrine falcon nest sites (which are usually scarce) and prey
on juvenile great horned owls. Much debate has occurred over the
feasibility and necessity for great horned owl removal during peregrine
falcon reestablishment. The intent of most great horned owl removal
have been to reduce the threat to young peregrine falcons immediately
after release. Personnel at the U.S. Fish and Wildlife Service have
stated that great horned owl control is unnecessary once falcons are
established and reproducing (with naturally fledged peregrine falcons
present). They do, however, support localized great horned owl control
for a few months after peregrine falcon release and/or fledging [22].
Similar problems pertain to prairie falcon (F. mexicanus) management;
most nest sites large enough for prairie falcons are also suitable for
great horned owls, and young prairie lafcons are vulnerable to predation
by great horned owls [30].

REFERENCES :
NO-ENTRY
  • 4. Andersen, David E. 1991. Management of North Amercian grasslands for raptors. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symosium and workshop; [Date of conference unknown]
  • 10. Cringan, Alexander T.; Horak, Gerald C. 1989. Effects of urbanization on raptors in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 219-288. [22381]
  • 12. de la Torre, Julio. 1990. Owls: Their life and behavior. New York: Crown Publishers. 214 p. [24580]
  • 21. Hygnstrom, Scott E.; Craven, Scott R. 1991. Raptor damage and nuisance problems in the United States. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symposium and workshop; [Date of conference unknown]
  • 22. James, Daniel L. 1991. Midwest raptor restoration--the federal perspective. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symposium and workshop; [Date of conference unknown]
  • 24. Johnsgard, Paul A. 1988. North American owls. Washington, DC: Smithsonian Institute Press. 295 p. [23301]
  • 25. Karalus, Karl E.; Eckert, Allan W. 1974. The owls of North America (north of Mexico). Garden City, NY: Doubleday & Company, Inc. 278 p. [24579]
  • 28. Lanier, John W.; Foss, Carol F. 1988. Habitat management for raptors on large forested tracts and shorelines. In: Proceedings of the northeast raptor management symposium and workshop; 1988 May 16-18; [Location of conference unknown]
  • 30. Olendorff, Richard R.; Stoddart, John W., Jr. 1974. The potential for management of raptor populations in western grasslands. In: Hamerstrom, B. E., Jr.; Harrell, W.; Olendorff, R. R., eds. Raptor Research: Report 2: 47-88. [22982]
  • 32. Petersen, Leroy R. 1991. Mixed woodland owls. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symposium and workshop; [Date of conference unknown]
  • 33. Phillips, Robert L.; Beske, Alan E. 1990. Distribution and abundance of golden eagles and other raptors in Campbell and Converse Counties, Wyoming. Fish and Wildlife Technical Report 27. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 31 p. [15473]
  • 34. Phillips, Robert L.; Wheeler, Anne H.; Lockhart, J. Michael; [and others]
  • 43. Woyda, Ann L.; Kessler, Winifred B. 1982. The response of selected owl species to silvicultural treatments on the Dixie National Forest, Utah. Final Report on Cooperative Agreement No. INT-81-129-CA. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 46 p. [17159]
  • 44. Young, Leonard S. 1989. Effects of agriculture on raptors in the western United States: an overview. In: Proceedings of the western raptor symposium and workshop; 1987 October 26-28; Boise, ID. NWF Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 209-218. [22649]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Great Horned Owls occasionally prey on domestic poultry, such as ducks and chickens. They are also known to sometimes take domestic cats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Great Horned Owls control harmful rodent populations throughout their range.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The great horned owl is capable of destroying game birds and animals. Poultry is also a favorite of the owls because they are easily captured. The occasional domestic cat can also fall victim to the great horned owl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The great horned owl controls harmful rat and mice populations throughout the United States. They kill domestic cats which in turn would have killed wild birds that humans value.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great Horned Owl

The Great Horned Owl, (Bubo virginianus), also known as the Tiger Owl, is a large owl native to the Americas. It is an adaptable bird with a vast range and is the most widely distributed true owl in the Americas.[2]

Contents

Description [edit]

The Great Horned Owl is the heaviest extant owl in Central and South America and is the second heaviest owl in North America, after the closely related but very different looking Snowy Owl (B. scandiacus). It ranges in length from 43–64 cm (17–25 in) and has a wingspan of 91–153 cm (36–60 in).[2][3] Females are invariably somewhat larger than males. An average adult is around 55 cm (22 in) long with a 124 cm (49 in) wingspan and weighing about 1.4 kg (3.1 lb).[4] Depending on subspecies, the Great Horned Owl can weigh from 0.6 to 2.6 kg (1.3 to 5.7 lb).[5] Among standard measurements, the tail measures 17.5–25 cm (6.9–9.8 in) long, the wing chord measures 31.3–40 cm (12.3–16 in), the tarsal length is 5.4–8 cm (2.1–3.1 in) and the bill is 3.3–5.2 cm (1.3–2.0 in).[6]

There is considerable variation in plumage coloration but not in body shape. This is a heavily built, barrel-shaped species that has a large head and broad wings. Adults have large ear tufts and it is the only very large owl in its range to have them.[6][3] The facial disc is reddish, brown or gray in color and there is a variable sized white patch on the throat. The iris is yellow, except the amber-eyed South American Great Horned Owl (B. V. nacurutu). Its "horns" are neither ears nor horns, simply tufts of feathers. The underparts are usually light with some brown barring; the upper parts are generally mottled brown. Most subspecies are barred along the sides as well. The legs and feet are covered in feathers up to the talons, with some black skin peaking out from around the talons. The feet and talons are distinctly large and powerful and only other Bubo owls have comparably formidable feet. There are individual and regional variations in color; birds from the subarctic are a washed-out, light-buff color, while those from Central America can be a dark chocolate brown.[6]

Its call is a low-pitched but loud ho-ho-hoo hoo hoo; sometimes it is only four syllables instead of five. The female's call is higher and rises in pitch at the end of the call. Young owls still in the care of their parents make loud, persistent hissing or screeching sounds that are often confused with the calls of the Barn Owl (Tyto alba).[6]

The combination of the species' bulk, prominent ear-tufts and barred plumage distinguishes it through much of the range. However, the Great Horned Owl can be easily confused with the Lesser or Magellanic Horned Owl (B. magellanicus), with which it may have limited overlap in southernmost South America. The Magellanic was once considered a subspecies of the Great Horned, but it is markedly smaller with smaller feet and a smaller head and is generally more lightly barred on the underside.[6] Other eagle-owls may superficially be somewhat similar, but the species is allopatric with the exception of the Magellanic species. In North America, the Long-eared Owl (Asio otus) can be somewhat similarly marked and shares the feature of prominent ear tufts, but it is considerably smaller and more slender, with a grayish line running down the middle of the facial disc and with ear tufts located more closely to each other on the top of the head.[7]

Subspecies [edit]

Coastal Great Horned Owl at Grouse Mountain (Vancouver, BC)
South American Great Horned Owl, B. v. nacurutu (note dark eyes)
Northern Great Horned Owl (B. v. subarcticus) in Manitoba
Californian Great Horned Owl (B. v. pacificus) stretching itself, Bernal Hill Park, San Francisco

A large number of subspecies have been named. As indicated above, many of these are only examples of individual or clinal variation. Subspecies differences are mainly in color and size and generally follow Gloger's and Bergmann's Rules:[8]

USA eastwards from Minnesota to Texas; northeastwards to Nova Scotia and Prince Edward Island. Resident all-year.
A brown form, tinged rufous and barred distinctly blackish-brown below. Feet tawny to buff, often barred black.
A lowland form occurring in disjunct populations from eastern Colombia to the Guyanas; also from Bolivia and Brazil south of the Amazonas basin to northern Argentina; resident all-year. Includes the proposed subspecies scotinus, elutus, and deserti.[9] The status of this form, especially the relationships between the subpopulations and with ssp. nigrescens and the Magellanic Horned Owl, deserves more study.
Dull brownish with long bill; birds from the semiarid interior of Brazil often have much white on uppertail- and ear-coverts. It is the only subspecies where the iris is amber, not yellow.
Breeding range from Mackenzie, British Columbia region east to Hudson Bay; southern limit unclear but at least reaches to Montana and North Dakota. Non-breeding birds are regularly found south to latitude 45°S, occasionally beyond. Includes the birds described as occidentalis (based on a wintering individual, as was the original subarcticus) and sclariventris. The older name wapacuthu was occasionally used for this subspecies, but it cannot with certainty be assigned to a recognizable taxon and is thus considered a nomen dubium. The population described as algistus is probably based on wandering individuals and/or intergrades of subarcticus, saturatus and lagophonus.[10]
A pale form, ground color essentially whitish with faint buff tinge above; black underside barring variable from indistinct to pronounced. Very pale birds are similar to a young female Snowy Owl from a distance. Feet whitish to buff, with little or no pattern. The largest-bodied subspecies.[11]
Central and southern California west of the Sierra Nevada except San Joaquin Valley, south to NW Baja California, Mexico. Intergrades with pallescens in San Diego County, California (see also below). Resident all-year.
Very rich brown, dark underside barring distinct but less pronounced than in saturatus. Humeral area black. Feet mottled dark.
Pacific coast from southeastern Alaska to northern California. Resident all-year.
A dark, dull and somewhat greyish form with heavily barred underside. Feet fairly dusky overall.
Andes; arid temperate and puna zones from Colombia to northwestern Peru. Resident all-year round.
A dark, cold gray-brown form with heavy fuscous blotching.
San Joaquin Valley southeastwards through arid regions of southeastern California and southern Utah eastwards to western Kansas and southwards to Guerrero and western Veracruz in Mexico; intergrades with pacificus in San Diego County; vagrant individuals of lagophonus and the Rocky Mountains population, which look similar to intergrades, also seem to occur in its range. Resident all-year.
A small, pale dusky buff form with indistinct barring, especially on the underside. Humeral area umber. Feet white and usually unmarked.
Yucatán Peninsula. Resident all-year.
A small and medium-pale form.
Southern Baja California, Mexico. Resident all-year.
Similar in color to pacificus, but considerably (5–10%) smaller; some overlap though. Overall, it is the smallest subspecies.[6]
Breeds in eastern Canada (northern Quebec, Labrador, Newfoundland). In winter, disperses southwards to Ontario to northeastern USA. Doubtfully distinct from saturatus.[verification needed][9]
A fairly dark and grey, heavily barred form. Feet pale with dusky mottling.
Breeds from inland Alaska south through mountainous areas of British Columbia to Oregon, the Snake River, and northwestern Montana. Reported in winter as far south as Colorado and Texas. Doubtfully distinct from saturatus.[9]
Greyer than saturatus, but similar overall. Feet with dusky barring.
  • Central American Great Horned Owl, Bubo virginianus mesembrinus (Oberholser, 1904)
Isthmus of Tehuantepec to W Panama. Resident all-year.
A mid-sized form; darker than mayensis.
  • Rocky Mountains Great Horned Owl, Bubo virginianus pinorum Dickerman & Johnson, 2008
The Rocky Mountains population breeds south of the Snake River south to Arizona, New Mexico, and the Guadalupe Mountains. Westwards, it is presumed to occur to the Modoc Plateau and Mono Lake. They were included in the presumed subspecies occidentalis, but recently described as distinct subspecies.[12]
A medium gray form, intermediate between lagophonus and pallescens. Moderately barred and tinged buff or ochraceous on the underside. Feet mottled.

The Pleistocene Sinclair Owl from California, Bubo sinclairi, may have been a paleosubspecies of the Great Horned Owl; if so, it was presumably the ancestor of the pacificus/pallescens group of subspecies.[13]

Distribution and ecology [edit]

Video of a Great Horned Owl at Disney's Animal Kingdom

The breeding habitat of the Great Horned Owl extends from subarctic North America throughout most of North and Central America and then down into South America south to Tierra del Fuego, the southern tip of the continent. It is absent from southern Guatemala, El Salvador and Nicaragua to Panama in Central, and Amazonia and the southwest in South America, as well as from the West Indies and most off-shore islands.[14] They are the most widely distributed owl in the Americas.[6]

It is among the world's most adaptable owls in terms of habitat. The Great Horned Owl can take up residence in trees that include deciduous, coniferous, and mixed forests, tropical rainforests, pampas, prairie, mountainous areas, deserts, subarctic tundra, rocky coasts, mangrove swamp forests, and some urban areas.[6] It is less common in the more extreme areas (i.e., the heart of the deserts, extremely dense rainforests and in mountainous areas above the tree line), generally absent from non-tidal wetland habitat,[15] and missing from the high Arctic tundra.[6] It prefers areas where open habitats, which it often hunts in, and woods, where it tends to roost and nest, are juxtaposed. [16] [17] [18] Thus lightly populated rural regions can be ideal. This species can occasionally be found in urban or suburban areas. However, it seems to prefer areas with less human activity and is most likely to be found in park-like settings in such developed areas, unlike Eastern and Western Screech Owls (Megascops asio & M. kennicottii) which are regular in suburban settings. All mated Great Horned Owls are permanent residents of their territories, but unmated and younger birds move freely in search of company and a territory, and leave regions with little food in winter.[6][19]

Physiology and feeding behavior [edit]

Composite photo of Great Horned Owl flight phases

Like most owls, the Great Horned Owl makes great use of secrecy and stealth. Due to its natural-colored plumage, it is well camouflaged both while active at night and while roosting during the day. Despite this, it can still sometimes be spotted on its daytime roosts, which are usually in large trees but may occasionally be on rocks. This regularly leads to their being mobbed by other birds, especially American Crows (Corvus brachyrhynchos). Since owls are, next to Red-tailed Hawks, perhaps the main predator of crows and their young, crows sometimes congregate from considerable distances to mob owls and caw angrily at them for hours on end. When the owls try to fly off to avoid this harassment, they are often followed by the corvids.

Owls have spectacular binocular vision, allowing them to pinpoint prey and see in low light. The eyes of a Great Horned Owl are nearly as large as those of a human being and are immobile within their circular bone sockets. As a result, instead of turning its eyes, an owl must turn its whole head, the neck capable of rotating a full 270 degrees, in order to see in various directions without moving its entire body.[3]

An owl's hearing is as good as, if not better than, its vision. Owls have better depth perception[citation needed] and better perception of sound elevation (up-down direction) than human beings. This is due to the asymmetrical positions of owl ears on either side of the head. The right ear is typically set higher in the skull and at a slightly different angle. By tilting or turning its head until the sound is the same in both ears, an owl can pinpoint both the horizontal and vertical direction of the sound's source.[6]

Owls also have approximately 300 pounds per square inch (PSI) of crushing power in their talons, a PSI greater than the human hand is capable of exerting. In some cases the gripping power of the Great Horned Owl may be comparable to much larger raptor species such as the Golden Eagle.[20]

Owls hunt mainly by watching from a snag, pole or other high perch, sometimes completely concealed by the dusky night and/or partially hidden by foliage. From such vantage points, owls dive down to the ground, often with wings folded, to ambush their prey.[6] They also hunt by flying low over openings on the ground, scanning below for prey activity. On occasion owls may actually walk on the ground in pursuit of small prey or, rarely, inside a chicken coop to prey on the fowl within.[3] They have even been known to wade into shallow water for aquatic prey, although this has been only rarely reported. Owls can snatch birds and some arboreal mammals directly from tree branches as well. The stiff feathering of their wings allows owls to produce minimal sound in flight while hunting.[2][6][3]

Almost all prey is killed with the owl's talons, often instantly, though some may be bitten about the face as well. Prey is swallowed whole when possible. However an owl will also fly with prey to a perch and tear off pieces with its bill. Very large prey, any that is notably heavier than the owl, must be eaten where it is killed for it is too heavy to fly with. In northern regions where such large prey is prevalent, an owl may let uneaten food freeze and then thaw it out later using its own body heat. When prey is swallowed whole, owls regurgitate pellets of bone and other non-digestible bits about 6 to 10 hours later, usually in the same location where the prey was consumed.[6] Great Horned Owl pellets are dark gray or brown in color and very large, 7.6 to 10.2 cm (3.0 to 4.0 in) long and 3.8 cm (1.5 in) thick, and have been known to contain skulls up to 3 cm (1.2 in) wide inside them.[3]

Great Horned Owls kill Snowshoe Hares more often in open than in closed forest types, and they avoid or have less hunting success in habitat with dense shrub cover. [21]

Prey [edit]

Closeup of Great Horned Owl toes and talons

Prey can vary greatly based on opportunity. According to one author, "Almost any living creature that walks, crawls, flies, or swims, except the large mammals, is the great horned owl's legitimate prey".[20] The predominant prey group are small to medium-sized mammals such as hares and rabbits, which are statistically the most regular prey,[3] as well as any small to moderately sized rodent such as rats, squirrels, flying squirrels, mice, lemmings and voles. Other mammals eaten regularly can include shrews, bats, armadillos, muskrats, martens and weasels.[6][3] Studies have unsurprisingly indicated that mammals that are primarily nocturnal in activity, such as rabbits, shrews or muroid rodents, are generally preferred. Red-tailed Hawks (Buteo jamaicensis), sometimes considered a potential competitor to the Great Horned due to their overlapping range (in North America), habitat preferences and broadly similar (and similarly broad) prey selection, often focus their diet largely on the diurnally active squirrels.[22]

The Great Horned is also a natural predator of prey two to three times heavier than itself[3] such as porcupines,[23] marmots[24] and skunks.[25] According to the Cornell Lab of Ornithology, the Great Horned Owl is the only regular avian predator of skunks.[2] In one case, the remains of 57 striped skunks were found in a single owl nest.[26]

Birds also compose a large portion of a Great Horned Owl's diet, ranging in size from kinglets to Great Blue Herons (Ardea herodias) and young swans. Regular avian prey includes woodpeckers, grouse, crows, pigeons, herons, gulls, quail, turkey and various passerines.[3][6][22] Waterbirds, especially coots and ducks, are hunted fairly often; even raptors, up to the size of Red-tailed Hawks and Snowy Owls, are sometimes taken.[6] [27]Other birds, being primarily diurnal, are often snatched from their nocturnal perches as they sleep.[22] The Great Horned Owl is a potential predator of any other owl species found in the Americas, of which there are several dozen. Bird prey are often plucked before eaten and the legs and much of the wings are torn off and discarded.[3]

Reptiles (to the size of young American alligators (Alligator mississippiensis)[3]), amphibians, fish, crustaceans and even insects,[28] centipedes, scorpions and earthworms are occasional supplemental prey. In addition, the Great Horned Owl will prey on on domesticated animals, including cats[29][30] and small or young dogs (Canis lupus familiaris).[31][32] Carrion is eaten with some regularity, including road-kills.[3] It is common for people to deal with troublesome wildlife by placing plastic replicas of Great Horned Owls on their property, since many small animals will actively avoid areas inhabited by them.[33]

Reproduction [edit]

Nestlings of the Rocky Mountains Great Horned Owl (B. v. pinorum) in New Mexico
Juveniles near Tule Lake National Wildlife Refuge, Oregon, USA

Great Horned Owls are some of the earliest-breeding birds in North America, seemingly in part because of the lengthy nightfall at this time of year.[6] They breed in late January or early February and are often heard calling to each other regularly as early in the fall as October. They choose a mate by December and are often heard duetting before this time. For owls found in more tropical climates, the dates of the breeding season are somewhat undefined.

The male attracts the attention of his mate by hooting emphatically while leaning over (with the tail folded back) and puffing up his white throat to look like a ball. The female hoots back when the pair meet but is more subdued in both her hoot and display.[6] Pairs typically breed together year after year and may mate for life, although they associate with each other more loosely when their young become mostly independent. Like all owls, Great Horned Owls do not build their own nest. They often take over a nest used by some other large bird, sometimes adding feathers to line the nest but usually not much more. Old crow and raven (Corvus), Red-tailed Hawk or large squirrel nests are often favored in North America. However, they are far from dependent on the old nests of others and may use cavities in trees and snags, deserted buildings, and artificial platforms. Other nest sites have included a large gap in a tree trunk, sheltered depressions on rocks and even a heron's nest in the midst of a heronry. Males select nesting sites and bring the females' attention to them by flying to them and then stomping on them.[6]

There are usually 2 eggs per clutch, but clutches range in size from 1 to 6 eggs (over 4 is very rare), depending on environmental conditions. The average egg width is 1.8 in (46.5 mm), the average length is 2.2 in (55.2 mm) and the average weight is 1.8 oz (51 g). The incubation period ranges from 28 to 37 days, averaging 33 days. The female alone does all the incubation and rarely moves from the nest, while the male owl captures food and brings it to her. Brooding is almost continuous until the offspring are about 2 weeks old, after which it decreases; during this time the male feeds both the female and the young.[6] Young owls move onto nearby branches at 6 weeks and start to fly about a week later. However, the young are not usually competent fliers until they are about 10 to 12 weeks old. The offspring have been seen still begging for food in late October (5 months after leaving the nest) and most do not separate from their parents until right before they start to reproduce for the next clutch (usually December). Birds may not breed for another year or two, and are often vagrants ("floaters") until they establish their own territories.[19]

Mortality [edit]

Great Horned Owl eggs, nestlings and fledgings may be preyed on by foxes, coyotes (Canis latrans), or wild or feral cats. There are almost no predators of adults, but they may be killed in confrontations with large eagles, Northern Goshawks, Snowy Owls and, mostly, other Great Horned Owls. Peregrine Falcons may harass them while defending their own young and themselves, but have not been known to kill adults.[3] A rarely observed case of predation on an adult Great Horned Owl was photographed in Parksville, British Columbia when a Bald Eagle caught and killed one adjacent to a golf course.[34] Wild owls have a maximum recorded lifespan of 13 years, whereas owls kept in captivity may live for up to 38 years.[3]

Most mortality in modern times is human-related. Great Horned Owls will occasionally fly into man-made objects, and may be killed on impact by buildings or cars or electrocuted by contact with power lines. Most states and provinces have historically considered the species a pest due to the perceived threat it posed to small domestic fowl and potentially small game. Thus, small bounties were offered in trade for owl bodies. However, this owl only rarely attacks domestic animals or animals preferred by human hunters and performs a key role in naturally controlling the populations of its prey.[23] Hunting and trapping may continue on a small scale but is now illegal in most countries. Education has largely changed public opinion of the Great Horned Owl and conservation efforts have assured the populations of the great predator are stable.[3][35] Occasionally, these owls may inadvertently prey on threatened species. Following the devastation to its populations from DDT, the reintroduction of the Peregrine Falcon was locally hampered due to predation on nestlings and adults by the Great Horned Owl.[2] Far-ranging as it is, the Great Horned Owl is not considered a globally threatened species by the IUCN.[1]

Footnotes [edit]

  1. ^ a b BirdLife International (2012). "Bubo virginianus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e "Great Horned Owl". The Cornell Lab of Ornithology. Retrieved 21 March 2013. 
  3. ^ a b c d e f g h i j k l m n o p "Great Horned Owl – Bubo virginianus – Information, Pictures, Sounds". Owlpages.com. Retrieved 2012-02-09. 
  4. ^ Dietrich, Drew. "Bubo virginianus, Great Horned Owl". University of Michigan, Museum of Zoology. Retrieved 21 March 2013. 
  5. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  6. ^ a b c d e f g h i j k l m n o p q r s t u König, Claus; Weick, Friedhelm (2008). Owls of the World (2nd ed.). London: Christopher Helm. ISBN 9781408108840. 
  7. ^ "Long-eared Owl". The Cornell Lab of Ornithology. Retrieved 21 March 2013. 
  8. ^ Houston et al. (1998), Holt et al. (1999)
  9. ^ a b c Holt et al. (1999)
  10. ^ Holt et al. (1999), Dickerman (2002, 2004).
  11. ^ Bendire, Charles (1892). Smithsonian Contributions to Knowledge: Life Histories of North American Birds. The Smithsonian Institution. p. 383. Retrieved 2012-02-09. 
  12. ^ Holt et al. (1999), Dickerman (2002).
  13. ^ Howard (1947)
  14. ^ Holt et al. (1999), Banks et al. (2000)
  15. ^ Accordi & Barcellos (2006)
  16. ^ Johnson (1993)
  17. ^ Rohner and Krebs (1996)
  18. ^ Ganey et al. (1997)
  19. ^ a b Rohner (1997)
  20. ^ a b Lee, Carol (March 26, 2006). "Powerful feet and talons help birds of prey make their living". Lubbock Avalanche-Journal. Retrieved 21 March 2013. 
  21. ^ Rohner and Krebs (1996)
  22. ^ a b c Springer, Mark A.; Kirkley, John S. (November 1978). "Inter and Intraspecific Interactions Between Red-Tailed Hawks and Great Horned Owls in Central Ohio". Ohio Journal of Science 78 (6): 323–328. Retrieved 21 March 2013. 
  23. ^ a b Smith, Dwight G. (2002). Great Horned Owl (1st ed.). Mechanicsburg, PA: Stackpole Books. pp. 33; 80–81. ISBN 0811726894. Retrieved 2013-03-21. 
  24. ^ "Great Horned Owl Menu". Birdnote.org. 2008-08-29. Retrieved 2012-02-09. 
  25. ^ "Oregon Zoo Animals: Great Horned Owl". Oregonzoo.org. Retrieved 2012-02-09. 
  26. ^ Hunter, Luke (2011). Carnivores of the World. Princeton, NJ: Princeton University Press. ISBN 9780691152288. 
  27. ^ Rohner and Doyle (1992)
  28. ^ C.Michael Hogan, ed. 2010. American Kestrel. Encyclopedia of Earth, U.S. National Council for Science and the Environment, Ed-in-chief C.Cleveland
  29. ^ "Beware of the Great Horned Owl". Help Find Lost Pets. May 27, 2010. Retrieved 21 March 2013. 
  30. ^ "Great Horned Owl – Bubo virginianus". Raptor Education Center. Retrieved 21 March 2013. 
  31. ^ Olson, Karen (January 19, 2011). "Chihuahua survives owl attack in Illinois". CNN. Retrieved 21 March 2013. 
  32. ^ Johansson, Tait. "The Great Horned Owl". Bedford Audubon Society. Retrieved 2012-02-09. 
  33. ^ Daly, M. Allan; Flory, Joel. "The Great Horned Owl: Rodents and Rabbits Beware" (PDF). Maryland Cooperative Extension, University of Maryland. Retrieved 21 March 2013. 
  34. ^ Bald eagle kills great horned owl at Parksville golf course. bclocalnews.com (2012-06-12). Retrieved on 2012-06-12.
  35. ^ Verbyla, Elsa Cooke (April 6, 2011). "Owls bounce back from bounty-hunting days". Gloucester-Mathews Gazette-Journal. Retrieved 21 March 2013. 

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See McGillivray (1989) for information on geographic variation in size (in North America) and its subspecific taxonomic implications. Dickerman (1991) determined that B. v. occidentalis is a synonym of B. v. subarcticus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!