Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range

High Andean lakes of sw Bolivia to n Chile and nw Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Fulica cornuta is known from a few high altitude Andean lakes in south-west Bolivia (Oruro in 1903, Potosí), north Chile (Tarapacá, Antofagasta, Atacama), and north-west Argentina (Jujuy, Salta, Catamarca in 1918, Tucumán, San Juan)3. Large concentrations have been recorded only occasionally, most notably 8,988 in the Vilama and Pululos area of Argentina in October 19956, and 2,800 birds on Laguna Pelada, Bolivia, in November 19891. It normally occurs at low densities, with 1-10 nesting pairs at most sites, and up to 70-90 at a few5,6. The Chilean population is estimated at 620 birds2, and Bolivia seems to hold a healthy population4. The global population is likely to be in the range of 10,000-19,999 individuals. There is no definite evidence of a recent decline5, but local populations are believed to fluctuate greatly between periods of drought and inundation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits high altitude Andean lakes, with dense submerged aquatic plants, primarily at 3,000-5,200 m but as low as 2,000 m in harsh weather.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fulica cornuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCTACTTAATTTTCGGAGCCTGAGCCGGCATAATCGGCACCGCCCTCAGCCTGCTTATCCGAGCAGAATTAGGACAACCCGGCACCCTCCTAGGAGATGACCAAATTTACAATGTAATTGTCACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGCTTCGGCAACTGACTAGTACCTCTCATAATCGGAGCCCCAGACATAGCATTTCCCCGCATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTACTACTCCTAGCATCATCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACAGTTTACCCCCCACTAGCCGGCAACCTAGCACATGCAGGCGCCTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGCGTCTCATCTATCCTAGGCGCCATTAATTTTATTACAACTGCCATCAACATAAAACCACCCGCTCTATCCCAATATCAAACTCCCCTATTCGTATGATCTGTCCTCATCACCGCTGTTCTACTACTACTATCCCTTCCTGTCCTTGCCGCCGGCATTACCATACTACTAACTGACCGAAACCTAAATACCACATTCTTCGACCCAGCTGGAGGAGGTGACCCTATCCTGTACCAACACCTCTTCTGATTTTTCGGACACCCAGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Fulica cornuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Symes, A., Butchart, S.

Contributor/s

Justification
This species has a moderately small global population which may be declining owing to habitat degradation and hunting. It is consequently classifed as Near Threatened.

History
  • 2006
    Near Threatened
  • 2004
    Near Threatened
  • 1996
    Vulnerable
  • 1994
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
8,988 were counted in Argentina in 1995 (Anon.1996), 2,800 in Bolivia in 1982 (Cabot and Serrano 1982) and 620 are estimated in Chile (Glade (1988). The total is probabaly in the range of 10,000-19,999 individuals, and probably fluctuates greatly.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Its fresh and brackish lakes are susceptible to contamination and vegetation trampling by cattle, and water is pumped from some to coastal towns and mines. It also suffers from hunting, egg-harvesting, and some predation by Andean Gull Larus serranus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Laguna Pelada has some protection.

Conservation Actions Proposed
Research threats. Carry out population census and continue to regularly monitor the population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Horned Coot

The Horned Coot (Fulica cornuta) is a species of bird found at lakes in the altiplano of north-western Argentina, south-western Bolivia, and north-eastern Chile. It is almost entirely restricted to altitudes of 3000-5200 m.a.s.l., but has occasionally been recorded at lower altitudes.[2] It is among the largest members of the Rallidae family.[3]

This species of coot was described by Bonaparte in 1853 based on a specimen collected in the Andes of Bolivia. For long it was known only from this type specimen. It is generally a low-density species and the total population has been estimated at 10.000-20.000, with as few as 620 in the Chilean part of its range.[2] Consequently, it is considered to be near threatened by BirdLife International and IUCN.[2]

Horned Coot males average a little larger than the female. With a total length of 46–62 cm (18–24 in) and a reported body mass from 1.6–2.29 kg (3.5–5.0 lb), it averages slightly smaller than the related Giant Coot as the second largest coot and the third largest extant species of rail.[1][4][5]

While most coots have a horny shield on the forehead, the Horned Coot has three wattles in both sexes. The central wattle is large and may possibly be erectile. The three wattles terminate in tufts of filoplumes. At the base of the beak and below the wattle is a fleshy caruncle which is whitish. The bill is olive yellow, brightening to dull orange towards the base. Unlike the Giant Coot, the legs of the Horned Coot are dull greenish.[1]

Lake with two nests in the water close to the shoreline

The Horned Coot is monogamous, and sometimes breeds in colonies of up to 80 pairs.[3] The huge nest is typically located about 40 metres from the shore in the waters of the high altitude lakes where it breeds. Pebbles are piled by the birds to form an artificial island that reaches the water surface. This island is then covered with algae to form the nest. It has been estimated that the pebble mounds may weigh as much as 1.5 tons and they are refurbished in each season. They breed from November to January.[6]

References

  1. ^ a b c Jaramillo, A. Burke, P., & Beadle, D. (2003). Birds of Chile. Christopher Helm. ISBN 0-7136-4688-8
  2. ^ a b c d BirdLife International (2012). "Fulica cornuta". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106002953. Retrieved 16 July 2012.
  3. ^ a b Taylor, P. B. (1996). Horned Coot (Fulica cornuta). pp. 209 in: del Hoyo, J., Elliott, A. & Sargatal, J. eds. (1996). Handbook of the Birds of the World. Vol. 3. Hoatzins to Auks. Lynx Edicions, Barcelona. ISBN 84-87334-20-2
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  5. ^ Taylor, Barry, Rails: A Guide to the Rails, Crakes, Gallinules and Coots of the World. Yale University Press (1998), ISBN 978-0-300-07758-2.
  6. ^ Ripley, S. Dillon (1957) Notes on the horned coot, Fulica cornuta Bonaparte. Postilla 30:1-8 scan
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!