Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Piaya cayana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATTACTCGATGATTATTTTCCACTAACCACAAAGACATCGGCACCCTATACCTTATCTTCGGTGCTTGAGCCGGCATGGTAGGAACAGCCCTAAGCCTACTCATCCGTGCAGAACTCGGACAGCCAGGAACCCTACTAGGAGACGACCAAATCTACAATGTAATCGTCACCGCACATGCCTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGATTCGGAAACTGACTTGTCCCACTTATAATTGGAGCCCCCGACATAGCATTCCCACGTATAAATAACATGAGCTTTTGACTCCTTCCCCCTTCCTTTCTCCTACTACTAGCATCATCTACAGTAGAAGCAGGGGCAGGAACCGGATGAACCGTATACCCACCACTAGCTGGAAACTTAGCCCATGCCGGAGCTTCAGTAGACCTCGCTATTTTTTCACTTCACCTAGCAGGTATCTCATCAATCCTCGGGGCAATCAACTTCATTACAACAGCTATTAACATAAAACCCCCAGCCCTATCCCAATACCAAACTCCTCTGTTCGTGTGATCAGTACTCATTACCGCTGTCCTACTTTTATTATCCCTACCAGTCCTCGCCGCCGGTATTACTATGCTACTAACAGACCGCAACCTAAATACCACATTCTTCGACCCTGCTGGAGGAGGTGACCCAGTTCTATATCAACACCTATTCTGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Piaya cayana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimated the total population (prior to the split of P. mexicanus) to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Squirrel cuckoo

The squirrel cuckoo (Piaya cayana) is a large and active species of cuckoo found in wooded habitats from northwestern Mexico to northern Argentina and Uruguay, and on Trinidad. Some authorities have split off the western Mexican form as the Mexican squirrel-cuckoo (piaya mexicana).[2]

Description[edit]

The contrasting undertail plumage. Note the red eye-ring, typical of squirrel cuckoos in most of South America

This large and extremely long-tailed cuckoo is 40.5–50 cm (15.9–19.7 in) long and weighs 95–120 g (3.4–4.2 oz).[3] The adult has mainly chestnut upperparts and head, becoming paler on the throat. The lower breast is grey and the belly is blackish. The central tail feathers are rufous, but the outer are black with white tips. The bill is yellow and the iris is red. Immature birds have a grey bill and eyering, brown iris, and less white in the tail. It resembles the little cuckoo, but that species is smaller and has a darker throat.

There are a number of subspecies with minor plumage variations. For example, P. c. mehleri, one of the South American subspecies, has mainly brown (not black) outer tail feathers. Additionally, the subspecies from Mexico, Central America, and northern and western South America have a yellow eye-ring, but this is red in the remaining part of South America.

It makes explosive kip! and kip! weeuu calls, and the song is a whistled wheep wheep wheep wheep.

Habitat and behavior[edit]

Squirrel cuckoo with a large caterpillar. Note the yellow eye-ring (the eye itself is reddish), typical of the subspecies from Mexico, Central America, and northern and western South America

The squirrel cuckoo is found in woodland canopy and edges, second growth, hedges and semi-open habitats from sea level to as high as 2,500 m (8,200 ft), although it is uncommon above 1,200 m (3,900 ft).

This species’ English name derives from its habit of running along branches and leaping from branch to branch like a squirrel. It normally flies only short distances, mainly gliding with an occasional flap.

It feeds on large insects such as cicadas, wasps and caterpillars (including those with stinging hairs or spines), and occasionally spiders and small lizards, rarely taking fruit.[4] Its static prey is typically taken off the foliage with a quick lunge, but wasps may be picked out of the air. Squirrel cuckoos are often observed to forage peacefully alongside small mammals such as common marmosets (Callithrix jacchus) during the dry season for cocoa beans. In particular, they can be seen to attend army ant columns together, picking off prey flushed by the ants, and occasionally will join mixed-species feeding flocks.[5][6][7]

The nest is a cup of leaves on a twig foundation, hidden in dense vegetation 1–12 m (3.3–39.4 ft) high in a tree. The female lays two white eggs.

The squirrel cuckoo is plentiful in most of its range and appears to be quite tolerant of human disturbance, as long as wooded land remains.[7] Compared to many cuckoos in the world, it is relatively bold and conspicuous, although it most often encountered skulking about within vegetation. Owing to its wide range, it is considered a species of Least Concern by the IUCN.[1]

References[edit]

  1. ^ a b BirdLife International (2014). "Piaya cayana". IUCN Red List of Threatened Species. Version 2014.2. International Union for Conservation of Nature. Retrieved 11 August 2014. 
  2. ^ BirdLife species factsheet for Piaya mexicana
  3. ^ "Squirrel Cuckoo". Oiseaux-birds.com. Retrieved 3 May 2014. 
  4. ^ e.g. of Trophis racemosa (Moraceae).
  5. ^ Machado, C. G. (1999). "A composição dos bandos mistos de aves na Mata Atlântica da Serra de Paranapiacaba, no sudeste brasileiro" [Mixed flocks of birds in Atlantic Rain Forest in Serra de Paranapiacaba, southeastern Brazil]. Revista Brasileira de Biologia 59. doi:10.1590/S0034-71081999000100010.  edit
  6. ^ Lyra-Neves, R. M. D.; Oliveira, M. A. B.; Telino-Júnior, W. R.; Santos, E. M. D. (2007). "Comportamentos interespecíficos entre Callithrix jacchus (Linnaeus) (Primates, Callitrichidae) e algumas aves de Mata Atlântica, Pernambuco, Brasil" [Interspecific behaviour between Callithrix jacchus (Linnaeus) (Callitrichidae, Primates) and some birds of the Atlantic forest, Pernanbuco State, Brazil]. Revista Brasileira de Zoologia 24 (3): 709. doi:10.1590/S0101-81752007000300022.  edit
  7. ^ a b Foster, M. S. (2007). "The potential of fruit trees to enhance converted habitats for migrating birds in southern Mexico". Bird Conservation International 17: 45. doi:10.1017/S0959270906000554.  edit

Further reading[edit]

  • ffrench, Richard; O'Neill, John Patton; Eckelberry, Don R. (1991). A Guide to the Birds of Trinidad and Tobago (2nd ed.). Ithaca, N.Y.: Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L. (2003). Birds of Venezuela. Princeton University Press. ISBN 0-7136-6418-5. 
  • Stiles, F. Gary; Skutch, Alexander F. (1989). A Guide to the Birds of Costa Rica. Comstock Publishing Associates. ISBN 0-8014-9600-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!