Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: RESIDENT: northern Mexico and southern Texas (lower Rio Grande Valley; common in Cameron, Hidalgo, Starr, and Willacy counties) south to southern Brazil, Uruguay, and eastern Argentina.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 29 cm

Weight: 153 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: ALL SEASONS: Open woodland, forest edge, second growth, dense moist woodlands and thickets, citrus groves, clearings, and less often, cultivated areas around human habitation, primarily in arid and semiarid regions. See Boydstun and DeYoung (1985) for Texas habitats. BREEDING: Nests in tree, shrub, or vine tangle, up to about 3-4 m above ground; often low, sometimes on ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly seeds, also small fruits and some insects; forages on ground or low branches under or near shrubby cover (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Relatively sedentary in Texas; moves over area of generally less than 10 ha (Boydstun and DeYoung 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Lays clutch of 2 eggs, late March-July (mostly May) in north (Texas). Incubation 14 days, by both sexes. Young tended by both parents, leave nest at 15-16 days, begin to feed themselves at about 4 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leptotila verreauxi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTAATCAATCGATGACTATTCTCCACCAACCACAAGGACATCGGTACACTATACCTAATCTTCGGCGCATGAGCAGGCATAGTTGGTACTGCACTTAGCCTCCTTATTCGCGCAGAACTAGGACAACCCGGTACACTCCTAGGAGATGACCAAATCTACAATGTAATTGTTACAGCTCATGCCTTTGTAATAATCTTCTTCATAGTTATACCGATCATGATCGGAGGTTTTGGAAACTGACTAGTCCCCCTCATAATTGGAGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTCCTCCTCCTAGCCTCCTCCACAGTAGAAGCCGGCGCTGGAACAGGATGGACCGTATACCCTCCCCTGGCTGGCAACCTAGCCCATGCTGGAGCCTCCGTAGACCTAGCCATCTTCTCCCTCCACCTAGCCGGTGTTTCCTCCATCCTAGGGGCTATCAACTTTATCACAACCGCCATCAACATAAAACCTCCAGCTCTCTCACAATACCAAACCCCCCTATTTGTATGATCAGTCCTCATCACTGCTGTTCTCCTCCTTCTATCCCTCCCAGTCCTTGCCGCTGGCATCACCATACTACTTACAGACCGCAACCTAAACACTACATTCTTTGACCCTGCCGGCGGAGGTGATCCAGTATTATACCAACACCTCTTCTGATTCTTTGGCCACCCCGAAGTCTACATCCTAATCCTTCCCGGCTTTGGAATCATCTCCCATGTAGTAGCCTACTATGCAGGTAAAAAAGAGCCATTCGGCTACATAGGAATGGTGTGAGCCATGCTATCCATTGGCTTCTTAGGCTTTATCGTCTGAGCCCATCACATATTTACAGTAGGCATAGACGTAGATACCCGAGCATACTTTACATCTGCCACCATAATCATCGCCATTCCAACGGGCATCAAAGTCTTCAGCTGATTGGCTACACTTCACGGAGGAACCATTAAATGAGACCCCCCTATACTATGAGCCCTAGGCTTCATCTTCCTTTTTACCATCGGAGGCCTAACTGGAATCGTCCTAGCAAACTCCTCTCTAGACATTGCCCTCCATGACACCTACTATGTAGTTGCCCACTTCCACTACGTCCTCTCAATAGGAGCTGTATTTGCCATCCTGGCAGGATTTACTCACTGATTCCCCTTATTCACAGGATACACCCTACACCCCACATGAGCTAAAGCCCACTTTGGAGTCATATTCACTGGTGTAAACCTAACATTCTTCCCCCAACACTTCCTTGGCCTTGCCGGCATACCACGACGGTACTCAGACTACCCAGACGCCTACACCCTATGAAACACCGCATCCTCTATCGGATCCCTAATCTCAATAACAGCCGTGATCATGCTAATATTTATTATCTGAGAAGCCTTCGCATCAAAACGTAAAGTATCACAGCCAGAACTCACCTCCACCAACATTGAATGAATCCACGGCTGCCCTCCCCCTTATCATACCTTCGAAGAGCCAGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Leptotila verreauxi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-tipped Dove

The White-tipped Dove (Leptotila verreauxi) is a large New World tropical dove. Its scientific name commemorates the French naturalists Jules and Edouard Verreaux.

Contents

Distribution and habitat

The dove is a resident breeder from southernmost Texas in the USA through Mexico and Central America south to western Peru and central Argentina. It also breeds on the offshore islands of northern South America, including Trinidad and Tobago and the Netherlands Antilles. It inhabits scrub, woodland and forest.

Subspecies

Numerous subspecies exist; some of the more widespread are:

  • L. v. verreauxi, the nominate taxon, from Nicaragua to Venezuela
  • L. v. angelica from Texas and coastal Mexico
  • L. v. decolor west of the Andes from Colombia to northern Peru
  • L. v. brasiliensis in most of the Amazon north of the Amazon River
  • L. v. decipiens in much of central South America

Description

The dove is about 28 cm (11 in) long and weighs 155 g (5.5 oz). Adult birds of most races have a grey tinge from the crown to the nape, a pale grey or whitish forehead and a whitish throat. The eye-ring is typically red in most of its range, but blue in most of the Amazon and northern South America. The upperparts and wings are grey-brown, and the underparts are whitish shading to pinkish, dull grey or buff on the chest. The underwing coverts are rufous. The tail is broadly tipped with white, but this is best visible from below or in flight. The bill is black, the legs are red and the iris is yellow.

The White-tipped Dove resembles the closely related Grey-fronted Dove, Leptotila rufaxilla, which prefers humid forest habitats. The best distinctions are the greyer forehead and crown, which contrast less with the hindcrown than in the Grey-fronted Dove. In the area of overlap, the White-tipped Dove usually has a blue (not red) eye-ring, but this is not reliable in some parts of Brazil, Argentina, Bolivia, Paraguay and Uruguay, where it typically is red in both species.

Behaviour

The White-tipped Dove is usually seen singly or in pairs, and is rather wary. Its flight is fast and direct, with the regular beats and clattering of the wings which are characteristic of pigeons in general. The call is a deep hollow ooo-wooooo.

Breeding

It builds a large stick nest in a tree and lays two white eggs. Incubation is about 14 days, and fledging another 15.

Feeding

The food is mainly seeds obtained by foraging on the ground, but it will also take insects, including butterflies and moths.

References

  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd edition ed.). Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes Brasiliensis (Brazilian Dove), regarded by some as a separate species (AOU 1983). Appears to constitute a superspecies with L. MEGALURA of South America (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!