Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: northern Mexico and southern Texas (lower Rio Grande Valley; common in Cameron, Hidalgo, Starr, and Willacy counties) south to southern Brazil, Uruguay, and eastern Argentina.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 29 cm

Weight: 153 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: ALL SEASONS: Open woodland, forest edge, second growth, dense moist woodlands and thickets, citrus groves, clearings, and less often, cultivated areas around human habitation, primarily in arid and semiarid regions. See Boydstun and DeYoung (1985) for Texas habitats. BREEDING: Nests in tree, shrub, or vine tangle, up to about 3-4 m above ground; often low, sometimes on ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly seeds, also small fruits and some insects; forages on ground or low branches under or near shrubby cover (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Relatively sedentary in Texas; moves over area of generally less than 10 ha (Boydstun and DeYoung 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of 2 eggs, late March-July (mostly May) in north (Texas). Incubation 14 days, by both sexes. Young tended by both parents, leave nest at 15-16 days, begin to feed themselves at about 4 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leptotila verreauxi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTAATCAATCGATGACTATTCTCCACCAACCACAAGGACATCGGTACACTATACCTAATCTTCGGCGCATGAGCAGGCATAGTTGGTACTGCACTTAGCCTCCTTATTCGCGCAGAACTAGGACAACCCGGTACACTCCTAGGAGATGACCAAATCTACAATGTAATTGTTACAGCTCATGCCTTTGTAATAATCTTCTTCATAGTTATACCGATCATGATCGGAGGTTTTGGAAACTGACTAGTCCCCCTCATAATTGGAGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTCCTCCTCCTAGCCTCCTCCACAGTAGAAGCCGGCGCTGGAACAGGATGGACCGTATACCCTCCCCTGGCTGGCAACCTAGCCCATGCTGGAGCCTCCGTAGACCTAGCCATCTTCTCCCTCCACCTAGCCGGTGTTTCCTCCATCCTAGGGGCTATCAACTTTATCACAACCGCCATCAACATAAAACCTCCAGCTCTCTCACAATACCAAACCCCCCTATTTGTATGATCAGTCCTCATCACTGCTGTTCTCCTCCTTCTATCCCTCCCAGTCCTTGCCGCTGGCATCACCATACTACTTACAGACCGCAACCTAAACACTACATTCTTTGACCCTGCCGGCGGAGGTGATCCAGTATTATACCAACACCTCTTCTGATTCTTTGGCCACCCCGAAGTCTACATCCTAATCCTTCCCGGCTTTGGAATCATCTCCCATGTAGTAGCCTACTATGCAGGTAAAAAAGAGCCATTCGGCTACATAGGAATGGTGTGAGCCATGCTATCCATTGGCTTCTTAGGCTTTATCGTCTGAGCCCATCACATATTTACAGTAGGCATAGACGTAGATACCCGAGCATACTTTACATCTGCCACCATAATCATCGCCATTCCAACGGGCATCAAAGTCTTCAGCTGATTGGCTACACTTCACGGAGGAACCATTAAATGAGACCCCCCTATACTATGAGCCCTAGGCTTCATCTTCCTTTTTACCATCGGAGGCCTAACTGGAATCGTCCTAGCAAACTCCTCTCTAGACATTGCCCTCCATGACACCTACTATGTAGTTGCCCACTTCCACTACGTCCTCTCAATAGGAGCTGTATTTGCCATCCTGGCAGGATTTACTCACTGATTCCCCTTATTCACAGGATACACCCTACACCCCACATGAGCTAAAGCCCACTTTGGAGTCATATTCACTGGTGTAAACCTAACATTCTTCCCCCAACACTTCCTTGGCCTTGCCGGCATACCACGACGGTACTCAGACTACCCAGACGCCTACACCCTATGAAACACCGCATCCTCTATCGGATCCCTAATCTCAATAACAGCCGTGATCATGCTAATATTTATTATCTGAGAAGCCTTCGCATCAAAACGTAAAGTATCACAGCCAGAACTCACCTCCACCAACATTGAATGAATCCACGGCTGCCCTCCCCCTTATCATACCTTCGAAGAGCCAGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leptotila verreauxi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5