Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: southern California, central Arizona, southern New Mexico, central Texas, Gulf coast, South Carolina, Bermuda and Bahamas south through Mexico, Antilles and Central America to central Costa Rica; in western Panama; from Colombia, Venezuela to Ecuador and eastern Brazil. Wanders north to California, Iowa, New York.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 17 cm

Weight: 30 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

See Dunn and Garrett (1990) for information on identification of common and ruddy ground-doves.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Once inhabited open country with trees and bushes, sandy reefs, open sandy areas in forest and savannah, but over much of its range now primarily a bird of cultivated land, villages and towns (Goodwin 1983). In general, habitat structure rather than species composition appears to be a the best predictor of suitable habitat (Landers and Buckner 1979). Found primarily in open areas with plants that produce small seeds such as abandoned agricultural fields, young pine plantations or citrus groves and other early successional habitats. These habitats tend satisfy their food and nesting requirements because forbs and grasses that produce small seeds, a major food of Ground-Doves, are generally abundant there (Landers and Buckner 1979).

Landers and Buckner (1979) found that sites with Ground-Doves were much more open than those without doves, and that sites with doves had smaller diameter trees than those without. Additionally, Ground-Doves may require a bare ground component for feeding and cover consisting of trees and shrubs in the desert or cropland and other habitat. Early seral stages also provide good nesting cover. Sandy soils with low natural fertility may be closely associated with this species (Hopkins 1958) because they tend to retard the rate of succession and make suitable Ground-Dove habitat available for longer periods of time (Jones and Mirarchi 1990).

Especially in the arid southwestern U.S., Ground-Doves are often associated with riparian areas. In New Mexico occurs up to 1524 m (5,000 ft.) in shrubby riparian habitat often at the edges of riparian woodlands and in desert shrub dominated by mesquite or OPUNTIA SPP. In California, found in desert scrub and near edges of desert riparian habitats, as well as in alkali desert scrub, desert wash, orchard-vineyard, and eucalyptus habitats, usually below 305 m (1000 ft.) (Small 1994). In coastal California, Ground-Doves prefer river valleys with similar growth (Garrett and Dunn 1981). In the Sonoran Desert of Arizona, occurs in desert scrub, open to dense vegetation of shrubs, low trees and succulents dominated by paloverde (CERCIDIUM MICROPHYLLUM), prickly pear (OPUNTIA SPP.), and giant saguaro (CEREUS GIGANTEUS). In the Chihuahuan Desert found in open stands of creosote bush and large succulents (FEROCACTUS PRINGLEI, ECHINOCACTUS PLATYACONTHUS, NMDGF 1994).

In the lower Colorado River region prefers agricultural edges, orchards and sparse riparian vegetation. Nests here can be found in almost any tree species with willows and mesquites near a water source preferred. Occurs in suburban habitats at Yuma, where it replaces the Inca Dove (COLUMBINA INCA) which is the small suburban dove elsewhere in the valley and throughout most of central and southern Arizona (Rosenberg et al.1991). In Texas, however, Ground-Dove habitat is quite different. Inca Dove typically occupies the cultivated areas, leaving brushy rangeland to the this species (Oberholser 1974), but Ground-Doves are also found in orchards, brushy rangeland, and open woodlands. Oberholser (1974) describes this species reaching its maximum density in the state of Texas on the one-million-acre King Ranch located in Kleberg and Kenedy counties where the primary habitat type was grassy mesquite-live oak-cactus savanna. Also found in scrubby juniper-oak associations in the Trans-Pecos and on the Edwards Plateau.

In Florida, Ground-Doves can be found in almost any habitat type from sea coast to pine flatwoods, except in wetlands. In Florida and South Texas birds also commonly nest in citrus groves (Mitchell et al. 1996) and sometimes in wax myrtle (MYRICA CERIFERA) on the coastal plain. In Georgia, nests in 5-year-old slash pine (PINUS ELLIOTTII) plantations (Landers and Buckner 1976). Hopkins (1957) reports that plum trees and some species of PRUNUS are usually present in Ground-Dove habitat in this state as well. Of sixty-nine sites surveyed by Jones and Mirarchi (1990) in Alabama, habitat types included old field (31), young pine plantation (23), forest (7), agricultural field (4), coastal dune (3) and homesite (1). Among coastal sites they recorded Common Ground-Doves in all vegetative zones from the foredunes through the hinddunes. Also observed in freshly plowed or recently harvested agricultural fields, and in hardwood and pine forest types.

Populations in Puerto Rico and the Virgin Islands occur primarily in coastal habitat from mangroves, palm groves and residential areas, cane field and arid scrublands. Most common in arid regions and is only absent from heavily wooded areas (Raffaele 1983). Throughout the remainder of its range, found in arid lowland scrub, low seasonally wet grassland, arid montane scrub, second growth scrub (0-1400m) in the tropical and subtropical zones.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Wanders in fall and spring north of breeding areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on small seeds gathered from gardens and lawns, along roadsides, in fields, weed patches, or grassy areas, but will also take berries and some insects. Landers and Buckner (1979) collected eight birds in Georgia and found that the most common food item was three-sided mercury (ACALYPHA VIRGINICA). Others included Croton (CROTON GLANDULOSUS), Yellow wood sorrel (OXALIS STRICTA), Eyebane (EUPHORBIA MACULATA), Texas panicum (PANICUM TEXANUM), Marsh elder (IVA ANNUA), Amaranth (AMARANTHUS SPP.), Ragweed (AMBROSIA ARTEMISIIFOLIA), Panic grass (PANICUM DICHOTOMIFLORUM), and Bull grass (PASPALUM BOSCIANUM). Most birds were seen in crabapple thickets and often in areas of blackberry and scrub oak. Birds were often seen feeding on the ground in small clearings with sparse herbaceous cover, especially in 1-year-old pine stands. In Florida and Texas important food sources include CROTON spp., PANICUM spp. and PORTULACA spp. (Howell 1932, Passmore 1981). This species must drink frequently and is often found in association with a water source.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: In Puerto Rico, calling peaked in spring and a secondary peak ocurred in fall in the dry zone (Rivera-Milan 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 7.2 years (wild) Observations: In the wild, these animals can live up to 7.2 years (Klimkiewicz and Futcher 1989). Like in other doves, the breeding patterns of these animals depend on geographic region with animals in Central America being able to breed throughout the year (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Typical nesting season in Florida extends from early March to early September, peaking from 3 April-16 May, and begins earlier in Texas (mid-March to late October), Arizona, and California (Bowman and Woolfenden 1997, Oberholser 1974). However, birds are suspected to nest year round (Bent 1932, Sprunt 1954). Nest is a thin frail platform of fine twigs, grasses, rootlets built in a tree or bush or on the old nest of another species. Occasionally on the beams of open buildings. Nests are typically 2.4-6.1 m (8-20 ft). up, and may be reused multiple times (Baicich and Harrison 1997). Sometimes built on the ground (Peterson 1961).

Pair nests solitarily or in small groups. Female lays two white eggs, and two or four broods may be raised in a year. Incubation period is 12-14 days and nestling care 12 days with both parents incubating. Young are altricial and cared for by both parents, fledging at 11 days. Young presumably fed crop milk initially (Ehrlich et al. 1988). It takes roughly a month to complete a successful nesting cycle (Bowman and Woolfenden 1997). Breeding pairs are territorial and will defend an area around the nest. Nicholson (1937) frequently found 3 pairs nesting within a 46m (150 ft) radius in Florida. A rare cowbird host (Ehrlich et al. 1998).

Information on survivorship and productivity is scant, but Passmore (1984) suggests that in south Texas, productivity may be 2.5 young per pair per year. This would be a 42% egg success based on an assumed two eggs per nest and three successful nestings. In addition, juvenile birds are thought to breed (Passmore 1984). The timing of the fall peak of weed seed production may coincide with a peak in breeding activity in Florida (Bowman and Woolfenden 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Columbina passerina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCAAATCAATCGATGATTATTCTCCACCAACCACAAAGACATTGGCACCTTATACTTAATCTTTGGTGCATGAGCTGGCATAATCGGCACCGCACTCAGCCTCCTCATTCGCGCCGAACTAGGACAACCGGGCACTCTCCTAGGAGATGACCAAATCTACAATGTAATCGTCACCGCCCATGCTTTCGTCATAATTTTCTTTATAGTTATACCAATCATAATTGGGGGCTTCGGAAACTGACTAGTTCCACTCATAATCGGCGCCCCTGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTCCTCCCTCCATCCTTCCTACTCCTCCTAGCCTCCTCCACAGTCGAAGCCGGCGCAGGCACAGGATGAACCGTATACCCACCTCTAGCCGGCAACCTAGCACATGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCCCTCCACCTCGCAGGTGTCTCCTCCATCCTGGGAGCCATTAACTTTATCACAACTGCCATCAACATAAAACCACCAGCCCTATCACAATACCAAACTCCCCTATTCGTCTGATCAGTCCTTATCACCGCCGTCCTCCTTCTTCTCTCTCTACCAGTCCTTGCTGCCGGCATTACAATACTACTTACAGACCGAAACCTAAACACCACATTCTTCGACCCCGCAGGAGGAGGTGACCCAGTACTCTACCAACACCTCTTCTGATTCTTTGGTCACCCCGAAGTCTACATTCTCATCCTCCCAGGCTTCGGAATTATCTCTCACGTAGTAGCATACTACGCAGGTAAAAAAGAACCTTTCGGCTACTTGGGAATAGTCTGAGCCATACTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Columbina passerina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 54
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5