Articles on this page are available in 1 other language: Spanish (19) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Busarellus nigricollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATNTAATNTTCGGCGCNTGAGCTGGTATAGTCGGCACCGCCCTTAGCCTACTCATCCGCGCAGAACTCGGCCAACCAGGCACACTCCTAGGCGACGACCAAATCTACAACGTTATCGTCACTGCACATGCATTCGTAATAATCTTCTTTATAGTTATACCAATCATGATCGGAGGATTTGGAAACTGACTCGTCCCACTCATAATTGGTGCCCCTGACATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTACTAGCCTCCTCAACAGTAGAAGCAGGAGCTGGCACCGGATGAACTGTTTATCCCCCACTAGCCGGCAACATAGCCCATGCTGGAGCCTCGGTAGACCTAGCCATCTTTTCCTTACACCTAGCCGGAGTCTCATCCATTCTAGGGGCAATCAACTTCATTACAACCGCCATCAACATAAAGCCCCCAGCCCTCTCCCAATACCAAACACCCCTATTTGTATGGTCTGTCCTCATTACCGCTGTTCTTCTCCTACTTTCACTCCCAGTCCTAGCCGCCGGCATCACCATACTACTTACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCCGGCGGAGGCGACCCCATCCTATACCAACACCTCTTCTGGTTCTTTGGACACCCAGAAGTCTATATCTTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Busarellus nigricollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimated the population to number <50,000 individuals (A. Panjabi in litt. 2008), which is placed in the band 20,000-49,999 individuals here.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-collared Hawk

The Black-collared Hawk (Busarellus nigricollis) is a species of bird of prey in the Accipitridae family. It is monotypic within the genus Busarellus.[2] It is found in Argentina, Belize, Bolivia, Brazil, Colombia, Costa Rica, Ecuador, El Salvador, French Guiana, Guatemala, Guyana, Honduras, Mexico, Nicaragua, Panama, Paraguay, Peru, Suriname, Trinidad and Tobago, Uruguay, and Venezuela. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical swamps, and swamps.[1]

A Black-collared Hawk in the Amazon Region of Peru

The adult Black-collared Hawk has a more or less white head, tinged with buff, and with black shaft streaks on the crown. The body, above and below, and the mantle are bright cinnamon-rufous, paler on the chest. There is a black crescent on the upper breast. The back has scattered black shaft stripes; the flight and tail feathers are black with the base of the tail barred with rufous. The eyes are bright reddish brown, the cere and bill black, and the legs bluish white. Immatures are similar, but blotched with black, including on the crown, and the rufous barring on the tail is more extensive. The pale area on the chest is also more clearly marked. The upper surface of the wings is barred, and the eyes are brown.

The nest is usually placed in a large tree, frequently near water, but sometimes in shade trees in coffee plantations or suburban areas. The nest is lined with green leaves. The female lays three to five eggs, dull white, spotted with pale yellow-brown or red-brown and a few darker freckles. There is no further information on its reproduction.

The Black-collared Hawk lives on a diet mainly composed of fish. It also eats water bugs and occasionally lizards, snails and rodents.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!