Overview

Brief Summary

Biology

The red kite is primarily a scavenger, taking a wide range of animal carrion including sheep, rabbits, birds and even waste from refuse dumps. In the past they were a common sight in some towns and cities where they scavenged amongst refuse. Kites also take live prey in the form of small mammals, birds and invertebrates. Red kites tend to be monogamous and usually pair for life. A red kite's nest is an untidy arrangement of sticks, lodged in the fork of a tree, and often built on the base of an old crow nest. The nest is lined with sheep's wool and then 'decorated' with man-made materials such as pieces of paper, plastic or cloth. The red kite had a reputation for stealing garments left out to dry for use as nest decoration and Shakespeare referred to this habit when he wrote in 'The Winter's Tale' 'When the kite builds, look to lesser linen'. A clutch of one to four eggs is laid in April, and the bulk of the incubation duties are undertaken by the female. The male stays close to the nest at this stage, guarding against attacks by crows and other potential nest robbers. After about seven weeks the young birds leave the nest but remain dependant on the parent birds for food for a further three to four weeks. In contrast to the mainly site-faithful adults, some young red kites undertake long-distance movements and wandering individuals can turn up almost anywhere, often well away from the nearest breeding site.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The red kite has been described as 'the most beautiful bird of prey in Britain'. The plumage is a wonderful mixture of black, chestnut, grey and reddish-brown and the underwings have an obvious white patch contrasting strongly with jet-black wing-tips. In flight the red kite's most notable feature is the long, deeply forked tail. The wing-tips are strongly 'fingered' and the bird's soaring flight is one of the most graceful sights in the British countryside.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Milvus milvus is endemic to the western Palearctic, with the European population of 19,000-23,000 pairs encompassing 95% of its global breeding range(BirdLife International 2004, Mammen 2007). It breeds from Spain and Portugal east through central Europe to Ukraine, north to southern Sweden, Latvia and the U.K., and south to southern Italy. Populations winter within the western breeding range, and formerly in isolated patches south and east to eastern Turkey. Its status as a breeding and wintering species in North Africa is now uncertain. The three largest populations (in Germany [10,500-12,500], France [2,300-3,000] and Spain [1,900-2,700] , which together hold more than 75% of the global population [Knott et al. 2009 ]) all declined during 1990-2000, and overall the species declined by almost 20% over that period(BirdLife International 2004). Eastern German populations declined by 25-30% between 1991 and 1997, but have remained stable since then(Mammen 2000, Mammen and Stubbe 2002), whereas in the federal state Saxony-Anhalt the decline continued until 2006 (Mammen 2007). The populations of the northern foothills of the Harz Mts (the most densely populated part of its range) suffering an estimated 50% decline from 1991-2001 (Nicolai and Weihe 2001). In Spain, the species showed an overall decline in breeding population of 46% for the period 1994 to 2004, and surveys of wintering birds in 2004 suggest a decline of around 50% since 1994 (Cardiel 2006); trends that have apparently continued in recent years(J. Vinuela in litt. 2009). In France, breeding populations have decreased in the northeast, and in the north and east Massif Central, but seem to be stable in southwest and central France and Corsica (A. Mionnet in litt. 2005, Mionnet 2007). Comparing counts from 1980 and 2000 suggests a decline of up to 80% in some areas, during which time the species's range in France decreased by 15%(A. Mionnet in litt. 2005, Thiollay and Bretagnolle 2004). A national survey conducted in 2008 revealed a decline of more than 20% of the French breeding population over 6 years (David and Mionnet 2010), with the breeding population declining from 3,000-3,900 pairs in 2002(Mionnet 2007)to 2,335-3,022 pairs in 2008 (Pinaud et al. 2009). A survey in January 2007 indicated that the wintering population in France numbered nearly 6,000 individuals, with most in the Pyrenees (Mionnet 2007). The Balearic Islands population declined from 41-47 breeding pairs in 1993 to 27 in 2004 (Cardiel 2006). However, conservation actions have since enabled the population to recover, to 38 breeding pairs in 2007 (Cardiel in litt. 2007). Populations elsewhere are stable or increasing. In Switzerland, populations increased during the 1990s to 1,200-1,500 in 2008 (Knott et al. 2009), and have now stabilised (V. Keller in litt. 2005) The population in Belgium was estimated at 150 breeding pairs in 2007 (Knott et al. 2009), following an increase from 1-2 irregular pairs in 1967 (Defourny et al. 2007). In Sweden the species has increased from 30-50 pairs in the 1970s to 1,800 pairs in 2007 (L. Lindell in litt. 2005, Å. Lindström in litt. 2005, Knott et al. 2009). The rate of increase in Sweden has been recorded as 7.1% annually during 1982-2006 or 13% annually during 1998-2006, depending on the survey method used (Å. Lindström in litt. 2007); and a rough calculation suggests that Sweden could support 5,000-10,000 pairs once the species has reached carrying capacity (N. Kjellén in litt. 2008). In Denmark, the population has increased from 17 known breeding pairs in 2001 to 81 breeding pairs in 2009 (Hjembæk 2010). Since an extreme low during the 20th Century the U.K. population has increased in recent decades and was estimated to number 1,600 breeding pairs in 2008 (Knott et al. 2009). This population is still increasing rapidly and a long-term estimate for future carrying capacity is in the order of 10,000 pairs (N. Kjellén in litt. 2008). Overall, the species population has declined in recent years owing to rapid declines in Iberia for resident breeding birds, and migrants that winter in Spain. Previously the majority of the global population wintered in Spain, but increasingly birds are remaining on their northern European breeding grounds. Those populations that winter outside of Spain are generally increasing. Therefore, while serious declines are expected to continue in southern Europe and therefore in the global population as a whole, as northern populations increase, it is anticipated that their growth will eventually outweigh declines in Iberia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Milvus milvus is endemic to the western Palearctic region in Europe and northwest Africa. Formerly, these birds of prey also occurred in northern Iran. They are rare kites that are resident in western Europe and northwest Africa. Red kites from northeastern and central Europe migrate further south and west, reaching south to Turkey for the winter season. Vagrant birds have been recorded as far north as Finland and south in Israel and Libya.

Biogeographic Regions: palearctic (Native )

  • Newton, I., P. Davis, D. Moss. 1996. Distribution and Breeding of Red Kites Milvus milvus in Relation to Afforestation and Other Land-use in Wales. The Journal of Applied Ecology, 33: 210-224.
  • Snow, D., C. Perrins. 1998. The Birds of the Western Palearctic Concise Edition. Oxford Oxfordshire: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The red kite is almost entirely restricted to Europe. In Britain it is present throughout the year, whilst the majority of birds in central Europe move south to spend the winter in Iberia. The history of the British population is well known. Formerly a common and widespread bird, it was extinct in England and Scotland by 1900, and only a remnant population survived in central Wales. Today, the range of the red kite is expanding in the UK. Successful re-introductions have allowed the bird to re-colonise several parts of its former range and numbers are now increasing in several areas of England and Scotland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red kites are brownish-chestnut in color with a mix of orange/buff and darker brown or black streaking. The main wing feathers (secondaries and primaries) are dark brown, which contrast with white patches under the wings. They have pale grey heads which are streaked with black. The bright yellow legs and feet can often be seen in flight. They have hooked beaks which are very sharp and designed for tearing meat. Females are generally larger ranging from 1000 to 1300 g in weight, males are 800 to 1200 g. Their wingspan ranges from 175 to 195 cm and body length from 60 to 66 cm.

Range mass: 800 to 1300 g.

Range length: 60 to 66 cm.

Range wingspan: 175 to 195 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species breeds in broadleaf woodlands and forests, mixed with farmland, pasture and heathland, to 2,500 m in Morocco(del Hoyo et al. 1994). In winter it also occupies wasteland, scrub and wetlands. Formerly an urban scavenger, it still visits the edges of towns and cities. It takes a wide range of food, but feeds mainly on carrion and small to medium-sized mammals and birds. Reptiles, amphibians and invertebrates are less important prey. Most birds in north-east Europe are migratory, wintering mainly in southern France and Iberia, but with some travelling as far as Africa(del Hoyo et al. 1994). Migrants travel south from their breeding grounds between August and November, returning between February and April (Snow and Perrins 1998). Birds are usually seen singly or in pairs, but sometimes form small flocks, possibly family groups, when soaring on migration (Ferguson-Lees and Christie 2001).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red kites are a wide-ranging species with a wide habitat tolerance. Their only requirements are large, mature trees in which to build nests. Generally these nests are built 10 to 15 m above ground. Sometimes red kites take over an old crow or buzzard nest. Red kites can be very protective of their nesting area, but are not highly territorial of their entire breeding territory. Most red kites nest within 20 km of where they were reared.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest ; mountains

Other Habitat Features: agricultural ; riparian

  • Mougeot, F. 2000. Territorial intrusions and copulation patterns in red kites, Milvus milvus, in realtion to breeding density. Animal Behaviour, 59: 633-642.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although often associated with woodland, the kite requires open habitats for foraging and birds can be seen drifting over both arable crops and grassland in their quest for food. It is a highly adaptable species and is able to thrive in a wide range of landscape types providing that the basic requirements of open areas for finding food, and woodland for nesting and roosting are met. Productive lowland landscapes support the highest densities of birds but kites are also found in the upland fringes where they forage over moorland and rough pastures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Red kites are primarily scavengers, but they are also predators, especially during the breeding season when they must feed their young. They eat a wide variety of live prey, primarily small mammals such as rabbits, voles, and field mice, but also including birds, worms, and invertebrate prey. Red kites glide lower than their usual soaring height to hunt live prey, visually searching for movements on the ground. They then dive quickly and grab prey in their talons.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Primary Diet: carnivore (Eats terrestrial vertebrates, Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Red kites are important predators and scavengers in the ecosystems they inhabit. Parasites found on these birds include: an acanthocephalan (Centrorhynchus milvus) and a trematode (Phagicola ascolonga).

Commensal/Parasitic Species:

  • Schmidt, G. 1975. Sphaerirostris wertheimae sp. n., and Other Acanthocephala from Vertebrates of Israel. The Journal of Parasitology, 61/2: 298-300.
  • Kuntz, R., A. Chandler. 1956. Studies on Egyptian Trematodes with Special Reference to the Heterophyids of Mammals. I. Adult Flukes, with Descriptions of Phagicola longicollis n. sp., Cynodiplostomum namrui n. sp., and a Stephanoprora from Cats. The Journal of Parasitology, 42/4: 445-459.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Goshawks (Accipiter gentilis) are the only known natural predators of adult red kites. The main threat is from human activity. Red kites have been targeted by egg thieves and illegal use of poisoned baits in carcasses, even though they are not set specifically for red kites. Nestlings and eggs are also vulnerable to nest predators, although both parents actively defend the nest. At signs of predators females signal to her fledglings who "play dead," even to the extent that a fox will believe them to be dead and leave, thinking it can return to eat them later.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Milvus milvus preys on:
Tyto alba

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red kites, like other carrion birds, feed on widely dispersed food sources, so they may communicate at roost sites. Individuals tend to find food for themselves or by following another.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Captive red kites are known to have lived 26 years in captivity. Wild records are unavailable, but related Milvus migrans have been recorded living up to 24 years in the wild.

Range lifespan

Status: captivity:
26 (high) years.

  • Richards, A. 1998. Birds of Prey: Hunters of the Sky. Philadelphia, Pennsylvania: Courage Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 38 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Red kites are monogamous and pair-bond for life, usually staying with each other year-round. Courtship each year renews the bond the pair already have. Mated pairs are more successful in reproduction with experience.

Courtship begins for established pairs in March. The birds play courtship games, such as flying towards each other and then turning and twisting away from each other at the last moment. They also have mock talon grappling fights, spinning in mid air, spiraling toward the ground, parting at tree level. Occasionally pairs courting this way fail to release each other in time and die.

Mating System: monogamous

Red kites reach maturity between 2 and 4 years of age. These birds normally pair for life, although, in winter they may spend time apart or in communal roosts. Winter is the best time for viewing kites because it minimizes disturbance to breeding kites. They are notorious for being easily disturbed at the nest.

One to three eggs are normally laid in April, produced at 3 day intervals. This ensures that there will be a dominant chick who will likely outlive his siblings. Incubation time is 31 to 32 days with an extra 3 days per additional egg.

Fledging can take 7 to 9 weeks, depending on food availability. At around 6 weeks the chicks will move away from the nest to exercise their wings. Even after their first flight, young do not move far from their nests as parents continue to feed them around the nest for several weeks. Young attain adult plumage at around 1 year and will breed at about 3 years.

Breeding interval: Red kites breed once yearly.

Breeding season: Nest-building usually begins during March, but first-time breeders may not start until April. Eggs are usually laid in early April.

Range eggs per season: 1 to 3.

Range time to hatching: 31 to 35 days.

Range fledging age: 7 to 9 weeks.

Average time to independence: 1 years.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both parents assist in nest-building, usually in hardwood trees. Red kites are protective of the nest area, but not of the entire breeding territory.  The female carries out the majority of incubation with relief from the male for several 20-minute breaks during the day for feeding and exercise. The parents stay alert for nest predators, such as crows and ravens. When the chicks hatch, the male bird brings food to the nest for the female to tear into small pieces to feed them. Parents will continue to feed the young a few weeks past the fledgling stage.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Newton, I., P. Davis, D. Moss. 1996. Distribution and Breeding of Red Kites Milvus milvus in Relation to Afforestation and Other Land-use in Wales. The Journal of Applied Ecology, 33: 210-224.
  • Mougeot, F. 2000. Territorial intrusions and copulation patterns in red kites, Milvus milvus, in realtion to breeding density. Animal Behaviour, 59: 633-642.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Milvus milvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAATCTTCGGCGCCTGGGCTGGTATGATCGGCACCGCCCTCAGCCTACTCATTCGCGCAGAACTTGGTCAACCAGGTACGCTCCTAGGCGACGACCAAATCTACAATGTAATCGTCACTGCACATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATAATTGGAGGGTTCGGAAACTGACTTGTCCCTCTCATAATTGGCGCCCCTGACATAGCTTTCCCACGCATGAACAACATAAGCTTCTGACTACTCCCTCCATCTTTCCTCCTCCTACTAGCCTCCTCAACCGTAGAAGCAGGGGCTGGTACTGGATGAACTGTTTACCCCCCATTAGCTGGCAACATAGCCCATGCCGGGGCCTCAGTAGATCTAGCCATCTTCTCCTTACACCTAGCCGGAATTTCATCCATTCTAGGAGCAATTAACTTCATCACAACTGCTATCAACATAAAACCCCCAGCCCTTTCCCAATACCAAACACCCCTATTTGTATGATCTGTCCTCATTACCGCTGTCCTACTACTACTCTCACTCCCAGTCCTAGCTGCTGGCATTACCATGTTACTTACAGACCGAAACCTCAACACAACGTTCTTTGACCCTGCCGGCGGAGGCGATCCCATCCTATACCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Milvus milvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Aebischer, A., Cardiel, I., Carter, I., Cross, A., Ignacio, A., Keller, V., Lindell, L., Lindström, Å., Madroño, A., Mammen, U., Mionnet, A., Newberry, P., Seyer, H., Tourret, P., Vinuela, J., Kjellén, N. & Barov, B.

Justification
This species is listed as Near Threatened because it is experiencing a moderately rapid population decline, owing mostly to poisoning from pesticides and persecution, and changes in land-use amongst other threats. Despite the current rapid declines in southern Europe, if population increases in northern range states are sustained the species may qualify for downlisting in the future.


History
  • 2012
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red kites are directly persecuted by poachers, forestry workers, tourists, and others. Habitat destruction, shortage of food, over-use of pesticides and other chemicals, over-exploitation, collisions, and petroleum and oil pollution are all indirect threats to Milvus milvus. They are considered near-threatened by the IUCN. Populations are in decline in areas that were previously considered strongholds of this species, including Germany, Spain, and France.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as a red listed 'Bird of Conservation Concern' in the UK, and fully protected under Schedule I of the Wildlife and Countryside Act, 1981. Classified as Near Threatened (NT) on the IUCN Red List.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A review of available data in 2009 concluded the population numbers 21,000-25,500 pairs.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The most pertinent threat to this species is illegal direct poisoning to kill predators of livestock and game animals (targetting foxes, wolves, corvids etc.)and indirect poisoning from pesticides and secondary poisoning from consumption of poisoned rodents by rodenticides spread on farmland to control vole plagues, particularly in the wintering ranges in France and Spain, where it is driving rapid population declines(A. Aebischer in litt. 2009); there is a strong correlation between rapid declines and those populations that winter in Spain(Carter 2007). The Spanish government released more than 1,500 tons of rodenticide-treated baits over about 500,000 ha to fight against a common vole plague in agricultural lands between August 2007 and April 2008; records of Red Kites dying by secondary poisoning in treated areas resulted(J. Vinuela in litt. 2009). Illegal poisoning is also a serious threat to the species in north Scotland, with 40% of birds found dead between 1989 and 2006 having been killed by poisoning (Smart et al. 2010). In France populations disappeared at the same rate as conversion from grasslands to cereal crops(P. Tourret in litt. 2009). The decline of grazing livestock and farming intensification leading to chemical pollution, homogenization of landscapes and ecological impoverishment also threatens the species (Knott et al. 2009). Wind turbines are a potentially serious future threat (Duchamp 2003, Mammen et al. 2009, P. Tourret in litt. 2009) and more research needs to be conducted to assess the level of threat windfarms pose to the species. Other less significant threats include electrocution and collision with powerlines(Mionnet 2007, P. Tourret in litt. 2009), hunting and trapping (Mionnet 2007, P. Tourret in litt. 2009), road-kills, deforestation, egg-collection (on a local scale) and possibly competition with the generally more successful Black Kite M. migrans(Ferguson-Lees et al. 2001, Cardiel in litt. 200, Mammen 2007, Cardiel and Viñuela 2007). Another factor implicated in the declines in France and Spain is a decrease in the number of rubbish dumps (Mionnet 2007, Cardiel and Viñuela 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the countryside, red kites were formerly blamed for killing game and livestock and were persecuted relentlessly. Despite their scavenging habits, the bird's large claws and hooked bill were sufficient to condemn them in the eyes of many farmers and gamekeepers. By the early part of the 20th century, the British population was limited to a few pairs in remote parts of central Wales where levels of human persecution were lower. Sadly, kites in Britain still fall victim to illegal persecution, despite our greater knowledge of the bird and its habits. In England it is estimated that as many as 80 birds have been killed by poison baits during the last 10 years. These are often intended for crows and foxes but are indiscriminate and the kite, with its scavenging habits, is a frequent victim. An additional threat is posed by highly toxic anticoagulant rodenticides used to control rats. Red kites are at risk if they scavenge on rats that have been poisoned and subsequently die. In addition, the kite's eggs are a target for egg collectors.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species is on Annex I of the EU Birds Directive is the the focus of close monitoring and targeted conservation actions across most of its range, including reintroduction to parts of the U.K. since 1989(English Nature 1995; RSPB 2007). Since 2007, further reintroduction projects are aiming to re-establish Red Kites in Tuscany and in the Marche (Italy), the Republic of Ireland and Northern Ireland - the first breeding attempt in the Republic was recorded in 2009. An EU species action plan for the Red Kite was published in 2009 (Knott et al. 2009). National species action plans are in place in Germany, France, the Balearic Islands and Denmark, and a draft national action plan is in place in Portugal. Ongoing research in Germany aims to examine further the impact of windfarms on the red kite breeding population in this country. In 2007, for the first time, three young birds in France were fitted with satellite transmitters, although only one provided regular information(Mionnet 2007). In Spain, radio-tracking was carried out in Segovia in 2006-2007.

Conservation Actions Proposed
Continue to monitor population trends and breeding productivity. Continue to manage reintroduction projects. Regulate the use of pesticides, especially in France and Spain. Reduce persecution through law enforcement, prosecutions and awareness campaigns. Carry out further studies into the impact of changing land-use practices. Lobby for changes in EU and national agricultural policies. Increase the area of suitable woodland and forest with protected status. Work with land-owners to protect habitat and prevent persecution. Consider extending supplementary feeding to more areas of low food availability. Ensure national legislation on animal by-products takes into account the needs of scavengers. Promote control on feeding stations to be compliant with sanitary regulations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

It had long been hoped that red kites would find their way back to England naturally as their numbers increased in Wales. However, the Welsh population has been slow to increase and expand its range due to the low level of breeding success and reluctance for birds to breed far from the nest site where they themselves were reared. In order to improve the fortunes of the red kite it was decided to try to reintroduce them to suitable areas in England and Scotland. English Nature, Scottish Natural Heritage and the RSPB began a project in 1989 using nestlings brought in from Spain and southern Sweden. The young birds were kept in captivity for six to eight weeks with minimal human contact, before being released into the wild. The red kite was one of the founding species in English Nature's Species Recovery Programme and represents one of the Programme's biggest success stories to date. Over a period of five years, 186 young kites were released in the Chilterns of southern England and in northern Scotland and self-sustaining breeding populations have become established in both areas. Further projects in England have resulted in a breeding population becoming established in the East Midlands (in partnership with Forest Enterprise) and releases began at the Harewood Estate in Yorkshire in 1999 in a project funded by Yorkshire Water. In the year 2000, a breeding survey recorded 16 pairs in the Midlands, three pairs in Yorkshire, and well over 100 pairs in the initial release area in the Chilterns. Whilst the future of the red kite is by no means totally secure, the project has so far been a great success and is an excellent example of what can be achieved by a well-planned and carefully monitored reintroduction programme.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Milvus milvus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red kites prey on rabbits and other rodents that act as agricultural pests. They also help by removing dead carcasses that could spread disease.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red Kite

The Red Kite (Milvus milvus) is a medium-large bird of prey in the family Accipitridae, which also includes many other diurnal raptors such as eagles, buzzards, and harriers. The species is currently endemic to the Western Palearctic region in Europe and northwest Africa, though formerly also occurred just outside in northern Iran.[2] It is resident in the milder parts of its range in western Europe and northwest Africa, but birds from northeastern and central Europe winter further south and west, reaching south to Turkey. Vagrants have reached north to Finland and south to Israel, Libya and Gambia.[2][3]

Taxonomy[edit]

This species was first described by Linnaeus in his Systema Naturae in 1758 as Falco milvus.[4]

The Red Kite has been known to successfully hybridize with the Black Kite in captivity where both species were kept together, and in the wild on the Cape Verde Islands and infrequently in other places.[5] The Red Kites on the Cape Verde Islands are (or rather were) quite distinct in morphology, being somewhat intermediate with Black Kites. The question whether the Cape Verde Kite should be considered a distinct species (Milvus fasciicauda) or a Red Kite subspecies has not been settled. A recent mtDNA study on museum specimens suggests that Cape Verde birds did not form a monophyletic lineage among or next to Red Kites.[6]

This interpretation is problematic: mtDNA analysis is susceptible to hybridization events, the evolutionary history of the Cape Verde population is not known, and the genetic relationship of Red Kites is confusing, with geographical proximity being no indicator of genetic relatedness and the overall genetic similarity high,[7] perhaps indicating a relict species.

Given the morphological distinctness of the Cape Verde birds and that the Cape Verde population was isolated from other populations of Red Kites, it cannot be conclusively resolved as to whether the Cape Verde population was not a distinct subspecies (as M. migrans fasciicauda) or even species that frequently absorbed stragglers from the migrating European populations into its gene pool. More research seems warranted, but at any rate the Cape Verde population is effectively extinct since 2000, all surviving birds being hybrids with Black Kites (which merely raises further questions about their taxonomic status).[6]

Description[edit]

Leucistic form
A Red Kite skull

Red Kites are 60 to 70 cm long[8] with a 175–179 cm (69–70 in) wingspan; males weigh 800–1,200 g (28–42 oz), and females 1,000–1,300 g (35–46 oz).[2] It is an elegant bird, soaring on long wings held at a dihedral, and long forked tail, twisting as it changes direction. The body, upper tail and wing coverts are rufous. The white primary flight feathers contrast with the black wing tips and dark secondaries. Apart from the weight difference, the sexes are similar, but juveniles have a buff breast and belly. Its call is a thin piping sound, similar to but less mewling than the Common Buzzard. There is a rare white leucistic form accounting for approximately 1% of hatchlings in the Welsh population but is at a disadvantage in the survival stakes.[9]

Differences between adults and juveniles[edit]

Adults differ from juveniles in a number of characteristics:

  • Adults are overall more deeply rufous, compared with the more washed out colour of juveniles;
  • Adults have black breast-streaks whereas on juveniles these are pale;
  • Juveniles have a less deeply forked tail, with a dark subterminal band;
  • Juveniles have pale tips to all of the greater-coverts (secondary and primary) on both the upper- and under-wings, forming a long narrow pale line; adults have pale fringes to upperwing secondary-coverts only.

These differences hold throughout most of the first year of a bird's life.

Behaviour[edit]

Diet[edit]

The Red Kite's diet consists mainly of small mammals such as mice, voles, shrews, young hares and rabbits. It feeds on a wide variety of carrion including sheep carcasses and dead game birds. Live birds are also taken and occasionally reptiles and amphibians. Earthworms form an important part of the diet, especially in spring.[10]

As scavengers, red kites are particularly susceptible to poisoning.[11] Illegal poison baits set for foxes or crows are indiscriminate and kill protected birds and other animals.

Juvenile behaviour[edit]

At signs of danger a mother will signal the young who will "play dead" when a predator is near.[12]

Breeding[edit]

Adult red kites are sedentary birds, and occupy their breeding home range all year in the United Kingdom, though many global populations are migratory (particularly the Swedish population, which winters in Spain).[13] Each nesting territory can contain up to five nest sites. Both male and female birds build the nest on a main fork or a limb high in a tree, 12–20 metres above the ground. The nest is made of twigs and lined with grass or other vegetation and sheep’s wool.[10][13]

Distribution and status[edit]

Red Kites inhabit broadleaf woodlands, valleys and wetland edges, to 800 metres. They are endemic to the western Palearctic, with the European population of 19,000–25,000 pairs encompassing 95% of its global breeding range. It breeds from Spain and Portugal east into central Europe and Ukraine, north to southern Sweden, Latvia and the UK, and south to southern Italy. There is a population in northern Morocco. Northern birds move south in winter, mostly staying in the west of the breeding range, but also to eastern Turkey, northern Tunisia and Algeria. The three largest populations (in Germany, France and Spain, which together hold more than 75% of the global population) declined between 1990 and 2000, and overall the species declined by almost 20% over the ten years. The main threats to Red Kites are poisoning, through illegal direct poisoning and indirect poisoning from pesticides, particularly in the wintering ranges in France and Spain, and changes in agricultural practices causing a reduction in food resources. Other threats include electrocution, hunting and trapping, deforestation, egg-collection (on a local scale) and possibly competition with the generally more successful Black Kite M. migrans.[1]

Red Kite in flight in Gredos Mountains, Avila, Spain

Continental Europe[edit]

German populations declined by 25%–30% between 1991 and 1997, but have remained stable since. The populations of the northern foothills of the Harz Mountains (the most densely populated part of its range) suffered an estimated 50% decline from 1991 to 2001. In Spain, the species showed an overall decline in breeding population of up to 43% for the period 1994 to 2001–02, and surveys of wintering birds in 2003–04 suggest a similarly large decline in core wintering areas. The Balearic Islands population has declined from 41–47 breeding pairs in 1993 to just 10 in 2003. In France, breeding populations have decreased in the northeast, but seem to be stable in southwest and central France and Corsica. Populations elsewhere are stable or undergoing increases. In Sweden, the species has increased from 30–50 pairs in the 1970s to 1,200 breeding pairs in 2003. In Switzerland, populations increased during the 1990s, and have stabilised.[1] According to a report by the Welsh Kite Trust, the UK is the only country in which the Red Kite population is increasing. Red Kites are decreasing in their strongholds of Spain, France and Germany.[14]

United Kingdom[edit]

In the United Kingdom Red Kites were ubiquitous scavengers that lived on carrion and rubbish. Shakespeare's King Lear describes his daughter Goneril as a detested kite, and he wrote "when the kite builds, look to your lesser linen" in reference to them stealing washing hung out to dry in the nesting season.[15] In the mid-15th century King James II of Scotland decreed that they should be "killed wherever possible", but they remained protected in England and Wales for the next 100 years as they kept the streets free of carrion and rotting food.[16] Under Tudor "vermin laws" many creatures were seen as competitors for the produce of the countryside and bounties were paid by the parish for their carcasses.[17]

By the 20th century the breeding population was restricted to a handful of pairs in South Wales, but recently the Welsh population has been supplemented by re-introductions in England and Scotland. In 2004, from 375 occupied territories identified, at least 216 pairs were thought to have hatched eggs and 200 pairs reared at least 286 young.[1] In 1989 six Swedish birds were released at a site in north Scotland and four Swedish and a Welsh bird in Buckinghamshire.[18] Altogether, 93 birds of Swedish and Spanish origin were released at each of the sites. In the second stage of reintroduction in 1995 and 1996, further birds were brought from Germany to populate areas of Dumfries and Galloway. 94 birds were brought from the Chilterns and introduced into the Derwent Valley in North East England between 2004 and 2006.[18] In Northern Ireland 80 birds from wild stock in Wales were released over three years between 2008 and 2010, and in 2010 the first successful breeding was recorded. The reintroductions in the Chilterns have been a success. Between 1989 and 1993 90 birds were released in the Chilterns Area of Outstanding Natural Beauty and by 2002, 139 pairs were breeding there.[19] Another successful reintroduction has been in Northamptonshire, which has become a stronghold for the Red Kite.[20] Thirty Spanish birds were introduced into Rockingham Forest near Corby in 2000,[21] and by 2010, the RSPB estimated that over 200 chicks had been reared from the initial release. So successful has the reintroduction been that 30 chicks have been transported from Rockingham Forest, for release in Cumbria.[22]

A sighting of the first Red Kite in London for 150 years was reported in The Independent newspaper in January 2006[23] and in June of that year, the UK-based Northern Kites Project reported that kites had bred in the Derwent Valley in and around Rowlands Gill, Tyne and Wear for the first time since the re-introduction.[24]

In 1999 the Red Kite was named 'Bird of the Century' by the British Trust for Ornithology.[15] It has been unofficially adopted as the national bird of Wales.[25]

In June 2010 the Forestry Commission North West England announced a three-year project to release 90 Red Kites in Grizedale Forest, Cumbria under a special licence issued by Natural England. The Grizedale programme will be the ninth reintroduction of Red Kites into different regions of the UK, and the final re-introduction phase in England.[26]

The stated aims of the Grizedale project are:

  • To establish a viable population of Red Kites in Grizedale, South Cumbria by 2015.
  • To increase the rate of Red Kite expansion into North West England and link up with existing populations in Wales, Yorkshire, North East England and South West Scotland and so increase the chances of a continuous geographical range.
  • To develop community involvement and create educational opportunities arising from the project.[27]

As of July 2011, non-breeding birds are regularly seen in all parts of Britain, and the number of breeding pairs is too large for the RSPB to continue to survey them on an annual basis.[28]

Ireland[edit]

Red Kites were extinct in Ireland by the middle nineteenth century, due to persecution, poisoning and woodland clearance. In May 2007, Minister for the Environment, Heritage and Local Government Dick Roche announced an agreement to bring at least 100 birds from Wales to restock the population as part of a 5-year programme in the Wicklow Mountains, similar to the earlier Golden Eagle reintroduction programme.[29] On 19 July 2007, the first thirty red kites were released in Co. Wicklow.[30][31] On 22 May 2010, 2 newly hatched Red Kite chicks were discovered in the Wicklow mountains,[32] bringing the number of chicks hatched since reintroduction to 7.[33]

Red kite at Wildensbuch, Switzerland

Sweden[edit]

The red kite is the landscape bird of Scania, Sweden and the coat of arms of the municipality of Tomelilla. Sweden is one location where the red kite seems to be in progress with around 2000 pairs in 2009 some of which are overwintering and some flying south to the Mediterranean landscapes for the winter. They return around March–April. The Kite is often seen roaming the open colourful patchwork quilt of wheat and rapeseed fields of Scania and if you go for a drive in the spring or summertime you are almost inevitably going to run into a number of them along the roadsides. Just north of Ystad you can even experience the kites flying along with Golden Eagles.

Populations and trends by country[edit]

The following figures (mostly estimates) have been collated from various sources.[2][34][35][36][37][38] They cover most of the countries in which Red Kites are believed to have bred.

CountryYearPairsTrendNotes
 AlbaniaUnknownBred 1906
 Algeria0UnknownBred in 19th century, now extinct
 Austria20000–2DecreaseExtinct 1950, recolonised 1970s; 10 pairs 1990
 Belarus19971UnknownExtinct 1950s, recolonised 1985; 10 pairs 1990
 Belgiumc.199550–60IncreaseDeclined to 1–3 pairs early 1970s, then recovery
 Bosnia and Herzegovina0Unknown 
 Bulgaria0UnknownMay breed but no proof
 Canary Islands0SteadyExtinct 1970s
 Cape Verde20001?Decrease50–75 pairs late 1980s; effectively extinct
 Croatia0Unknown2–5 pairs 1980s
 Czech Republic2013165-185IncreaseExtinct late 19th century, recolonised 1975
 Denmark200975–80[39]IncreaseExtinct c.1920, then recolonised (from Sweden) 1970s
 England2011c.2000IncreaseExtinct 1870s, reintroduced 1989–1992
 Estonia1989<1Unknown 
 Francelate 2000sc.3000Decrease2300–2900 pairs 1980s
 Germanylate 2000sc.12000Decrease15000–25000 pairs 1980s
 Greece0Unknown 
 Hungaryc.19981+Decrease30 pairs 1950s
 Ireland20107IncreaseFirst successful breeding reported in 2010 following reintroduction in 2007
 Italyc.2002300–400Unknown70–150 pairs late 1980s
 Latvia19920–50IncreaseExtinct 1964, then recolonised
 Lithuania19881–2IncreaseExtinct, then recolonised 1981
 Luxembourg199746Increase 
 Macedonia0Unknown 
 Moldova19901Unknown 
 Montenegro19950Unknown 
 Moroccoc.199210–100DecreaseIn danger of extinction
 Netherlandsc.1998<5IncreaseExtinct 1852, recolonised 1976
 Northern Ireland20105IncreaseFirst successful breeding reported in 2010 following reintroduction in 2008
 Norway19800SteadyBred occasionally in 19th century
 Polandc.1998650–700Increase400–450 pairs 1980s
 Portugalc.1995100–200Unknown 
 Romania199515–20Unknown 
 Russia19920–50Unknown 
 Scotland2009135IncreaseExtinct 1886, reintroduced 1989–1992
 SerbiaUnknown 
 Slovakia199210–20Unknown 
 Spainlate 2000sc.2200Decrease10000 pairs 1977
 Swedenlate 2000sc.1800IncreaseIncrease from 400 pairs in 1993
  Switzerlandc.1995800–1000IncreaseDeclined 19th century, later recovery; 235–300 pairs late 1980s
 Tunisia0UnknownBred in 19th century, now extinct
 Turkey0UnknownMay have bred in past but no proof
 Ukraine19905–8Decrease 
 Wales2009c.1000IncreaseDeclined to 2 pairs in 1930s, then recovery
 Yugoslavia0UnknownFormerly more common

Observation[edit]

Red kite in flight at Gigrin farm, UK

One of the best places to see the Red Kite in Scandinavia is Scania in southern Sweden. It may be observed in one of its breeding locations such as the Kullaberg Nature Preserve near Mölle.[40]

Some of the best places to see them in the UK are Gigrin Farm near Rhayader, mid Wales, where hundreds are fed by the local farmer as a tourist attraction,[41] and the nearby Nant-Yr-Arian forest recreation centre in Ceredigion[42] where the rare leucistic variant can be seen.[43] In the UK the Oxfordshire part of the Chilterns has many Red Kites, especially near Henley-on-Thames and Watlington, where they were introduced on John Paul Getty's estate.[19] They can also be seen around Harewood near Leeds where they were re-introduced in 1999.[44]

See also[edit]

References[edit]

  1. ^ a b c d BirdLife International (2013). "Milvus milvus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d Snow, D. W. & Perrins, C. M. (1998). The Birds of the Western Palearctic Concise Edition. OUP ISBN 0-19-854099-X.
  3. ^ Barlow, C., Wacher, T. and Disley, T. (1997) A Field Guide to Birds of the Gambia and Senegal. Pica Press, Mountfield, UK. ISBN 1-873403-32-1.
  4. ^ Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. (in Latin). Stockholm: Laurentius Salvius. p. 89. "F. cera flava, cauda forsicata, corpore ferrugineo, capite albidiore.." 
  5. ^ Sabine Hille and Jean-marc Thiollay (2000). The imminent extinction of the Kites Milvus milvus fasciicauda and Milvus m. migrans on the Cape Verde Islands. Bird Conservation International, 10 , pp 361-369
  6. ^ a b Jeff A. Johnson, Richard T. Watson & David P. Mindell (2005). "Prioritizing species conservation: does the Cape Verde kite exist?". Proceedings of the Royal Society B: Biological Sciences 272 (7): 1365–1371. doi:10.1098/rspb.2005.3098. PMC 1560339. PMID 16006325. 
  7. ^ Schreiber, Arnd; Stubbe, Michael & Stubbe, Annegret (2000). "Red kite (Milvus milvus) and black kite (M. migrans): minute genetic interspecies distance of two raptors breeding in a mixed community (Falconiformes: Accipitridae)". Biological Journal of the Linnean Society 69 (3): 351–365. doi:10.1006/bijl.1999.0365. 
  8. ^ Campbell, David (2000). "Red Kite". The Encyclopedia of British Birds. Bath: Parragon. p. 118. ISBN 0752541595. 
  9. ^ Anon. "The White Kite". Gigrin Farm - The Red Kite feeding station. Gigrin Farm. Archived from the original on February 2, 2009. Retrieved 2009-07-07. 
  10. ^ a b Pugh, Effyn. "The Red Kite". birdsofbritain.co.uk. Birds of Britain. Retrieved 2009-10-26. 
  11. ^ "Wildlife crime soars". The Herald Series. 12 September 2007. Retrieved 6 July 2009. "In Didcot, poisoned rabbits were laid out as bait disguised as road-kill, targeting red kites" 
  12. ^ Anon. "Red kite". BBC Nature: Wildlife. BBC. Retrieved 25 November 2013. 
  13. ^ a b Anon. "Scotland's Wildlife: Red Kite". BBC Scotland outdoors articles. BBC. Retrieved 26 October 2009. 
  14. ^ "Red Kites decline in Europe". Welsh Kite Trust. undated. Retrieved 2007-02-24. 
  15. ^ a b BBC Radio 4, Debating Animals, Series 2, The Kestrel and Red Kite by Rod Liddle
  16. ^ Atrill, Rod. "The Red Kite in West Wales". New Key on Cardigan Bay in West Wales. Rod Attrill. Retrieved 2009-07-07. 
  17. ^ McCarthy, Michael (23 March 2007). "Book Review:Silent Field, By Roger Lovegrove:songbirds versus shotguns". The Independent: (London: Independent.co.uk). Retrieved 2009-07-07. 
  18. ^ a b Anon. "Red Kite". RSPB Conservation. RSPB. Retrieved 2009-10-26. 
  19. ^ a b Schurmer, Michael (November 2002). "Breeding Bird Survey of the Chilterns Area of Outstanding Natural Beauty 2002". RSPB. Retrieved 26 October 2009. 
  20. ^ "RSPB Red Kite numbers are soaring across the UK". Birdguides. 15 September 2008. Retrieved 4 August 2011. 
  21. ^ "Red Kite project a soaring success". Evening Telegraph. 9 November 2007. Retrieved 4 August 2011. 
  22. ^ "Red kite chicks from Northamptonshire released to wild". BBC. 17 August 2010. Retrieved 4 August 2011. 
  23. ^ McCarthy, Michael (13 January 2006). "Shakespeare's red kite returns to London after an absence of 150 years". The Independent on Sunday (Independent News and Media Limited). Retrieved 2009-07-05. 
  24. ^ "Delight as red kite chicks hatch". BBC News. 16 June 2006. Retrieved 2006-10-27. 
  25. ^ Welsh Kite Trust. Accessed 12 May 2013
  26. ^ Anon (17 June 2010). "Red kites to make a Lake District return". The Westmorland Gazette (Newsquest media group). Retrieved 12 July 2010. 
  27. ^ Anon. "Grizedale Red Kite Project". Forestry Commission information posters. Forestry commission. Retrieved 12 July 2010. 
  28. ^ "Red kite: Distribution and population size". The RSPB. Retrieved 2012-08-28. 
  29. ^ Anon. "Golden Eagle Trust, Glenveagh National Park". National Development plan. NDP. Retrieved 26 October 2009. 
  30. ^ News - Department of the Environment, Heritage & Local Government
  31. ^ Anon. "Red Kites fly again in Ireland.". Wildlife Extra: News. Wildlife Extra. Retrieved 26 October 2009. 
  32. ^ Melia, Paul (22 May 2010). "Two chicks about the size of a fist". Irish Independent. 
  33. ^ "Golden Eagle Trust | Red Kite | Project Updates". Goldeneagle.ie. Retrieved 2012-08-28. 
  34. ^ Carter, Ian (2001): The Red Kite. Arlequin Press, Chelmsford, UK. 187pp.
  35. ^ Cramp, S. (1980). The Birds of the Western Palearctic Volume 2. Oxford ISBN 0-19-857505-X.
  36. ^ Holloway, S. (1996). The Historical Atlas of Breeding Birds in Britain and Ireland: 1875–1900. T & A D Poyser ISBN 0-85661-094-1.
  37. ^ RSPB Scotland, cited in The Scotsman, Monday 15 September 2008
  38. ^ Carter, Ian (2009): The Red Kite. presentation to the Cambridgeshire Bird Club, Cambridge, UK, 13 November 2009.
  39. ^ Gert Hjembæk (2009-11-25). "Den røde drage bliver hængende i Danmark". Dansk Ornitologisk Forening. Retrieved 2009-11-28. 
  40. ^ Hogan, C. Michael (2005): Kullaberg Nature Reserve, Sweden. Lumina technologies.
  41. ^ "Red Kite Feeding Station — Gigrin Farm". Retrieved 2006-10-27. 
  42. ^ Anon (2008). "Bwlch Nant-yr-Arian". Bwlch Nant Yr Arian Visitor Centre. Retrieved 2009-07-07. 
  43. ^ Melton, Tom (13 August 2008). "Leucistic Red Kite". ephotozone. ephotozone. Retrieved 2009-07-07. 
  44. ^ Anon. "Birder watchers' paradise". BBC Hands on Nature:. BBC. pp. Parks: Harewood Estate. Retrieved 26 October 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!