Overview

Brief Summary

Biology

The red kite is primarily a scavenger, taking a wide range of animal carrion including sheep, rabbits, birds and even waste from refuse dumps. In the past they were a common sight in some towns and cities where they scavenged amongst refuse. Kites also take live prey in the form of small mammals, birds and invertebrates. Red kites tend to be monogamous and usually pair for life. A red kite's nest is an untidy arrangement of sticks, lodged in the fork of a tree, and often built on the base of an old crow nest. The nest is lined with sheep's wool and then 'decorated' with man-made materials such as pieces of paper, plastic or cloth. The red kite had a reputation for stealing garments left out to dry for use as nest decoration and Shakespeare referred to this habit when he wrote in 'The Winter's Tale' 'When the kite builds, look to lesser linen'. A clutch of one to four eggs is laid in April, and the bulk of the incubation duties are undertaken by the female. The male stays close to the nest at this stage, guarding against attacks by crows and other potential nest robbers. After about seven weeks the young birds leave the nest but remain dependant on the parent birds for food for a further three to four weeks. In contrast to the mainly site-faithful adults, some young red kites undertake long-distance movements and wandering individuals can turn up almost anywhere, often well away from the nearest breeding site.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The red kite has been described as 'the most beautiful bird of prey in Britain'. The plumage is a wonderful mixture of black, chestnut, grey and reddish-brown and the underwings have an obvious white patch contrasting strongly with jet-black wing-tips. In flight the red kite's most notable feature is the long, deeply forked tail. The wing-tips are strongly 'fingered' and the bird's soaring flight is one of the most graceful sights in the British countryside.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 60-66 cm, envergure 1,75-1,95 m, poids moyen 800-1 300 g.

Il niche dans les bosquets d’arbres élevés ou dans le bocage mais s’alimente surtout en terrain découvert, cherchant ses proies dans la végétation basse. Il les détecte par des planés hauts ou des vols actifs bas à la manière des busards. Dans certaines localités, il a gardé son comportement urbain de charognard, mais en général, il habite maintenant dans des secteurs reculés et préservés des perturbations humaines.

Le Milan royal se nourrit de toutes sortes d’animaux vivants ou morts. La plupart des proies sont capturées par surprise mais il arrive qu’il poursuive en vol un insecte ou un oiseau. Il peut aussi dérober la proie d’autres oiseaux (Buse, Balbuzard, Héron, Corvidés…) ou encore piller un nid.

Moins grégaire que le Milan noir, il chasse surtout en solitaire. Il peut se regrouper en dortoirs importants (parfois plus de 100 oiseaux, toujours dans des arbres) mais s’observe isolément ou en petits groupes en journée, y compris en migration. Les aires sont très dispersées et généralement à plus de 1 km les unes des autres. Elles sont occupées à partir de février-mars, voire dès janvier pour les sédentaires. Les territoires des couples se chevauchent sans que des conflits soient remarqués. En présence de la ponte ou de jeunes oiseaux, le mâle défend les abords de l’aire contre ses congénères et tout autre prédateur potentiel. Il passe la nuit à proximité de la nichée, de même que la femelle lorsque les jeunes sont suffisamment grands.

L’unique ponte de 1 à 3 œufs est déposée en mars ou avril, selon la latitude. L’aire est placée à la fourche d’une branche et peut être réutilisée d’une année sur l’autre. C’est assez souvent un ancien nid de Grand Corbeau ou de Buse. Des herbes et de la laine de mouton sont ajoutées à la coupe de branchettes, parfois aussi des papiers et plastiques. La date d’envol des jeunes dépend de leur nombre et de la nourriture disponible. Les plus précoces se déplacent vers des branches attenantes à l’aire dès l’âge de 45 jours, mais s’envolent rarement avant le 50e jour. Certains ne décollent qu’au 70e jour.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Milvus milvus is endemic to the western Palearctic, with the European population of 19,000-23,000 pairs encompassing 95% of its global breeding range(BirdLife International 2004, Mammen 2007). It breeds from Spainand Portugal east through central Europe to Ukraine, north to southern Sweden, Latvia and the U.K., and south to southern Italy. Populations winter within the western breeding range, and formerly in isolated patches south and east to eastern Turkey. Its status as a breeding and wintering species in North Africa is now uncertain. The three largest populations (in Germany [10,500-12,500], France [2,300-3,000] and Spain [1,900-2,700], which together hold more than 75% of the global population [Knott et al. 2009 ]) all declined during 1990-2000, and overall the species declined by almost 20% over that period(BirdLife International 2004). Eastern German populations declined by 25-30% between 1991 and 1997, but have remained stable since then(Mammen 2000, Mammen and Stubbe 2002), whereas in the federal state Saxony-Anhalt the decline continued until 2006 (Mammen 2007). The populations of the northern foothills of the Harz Mts (the most densely populated part of its range) suffering an estimated 50% decline from 1991-2001 (Nicolai and Weihe 2001). In Spain, the species showed an overall decline in breeding population of 46% for the period 1994 to 2004, and surveys of wintering birds in 2004 suggest a decline of around 50% since 1994 (Cardiel 2006); trends that have apparently continued in recent years(J. Vinuela in litt. 2009). In France, breeding populations have decreased in the northeast, and in the north and east Massif Central, but seem to be stable in southwest and central France and Corsica (A. Mionnet in litt. 2005, Mionnet 2007). Comparing counts from 1980 and 2000 suggests a decline of up to 80% in some areas, during which time the species's range in France decreased by 15%(A. Mionnet in litt. 2005, Thiollay and Bretagnolle 2004). A national survey conducted in 2008 revealed a decline of more than 20% of the French breeding population over 6 years (David and Mionnet 2010), with the breeding population declining from 3,000-3,900 pairs in 2002(Mionnet 2007)to 2,335-3,022 pairs in 2008 (Pinaud et al. 2009). A survey in January 2007 indicated that the wintering population in France numbered nearly 6,000 individuals, with most in the Pyrenees (Mionnet 2007). The Balearic Islands population declined from 41-47 breeding pairs in 1993 to 27 in 2004 (Cardiel 2006). However, conservation actions have since enabled the population to recover, to 38 breeding pairs in 2007 (Cardiel in litt. 2007). Populations elsewhere are stable or increasing. In Switzerland, populations increased during the 1990s to 1,200-1,500 in 2008 (Knott et al. 2009), and have now stabilised (V. Keller in litt. 2005) The population in Belgium was estimated at 150 breeding pairs in 2007 (Knott et al. 2009), following an increase from 1-2 irregular pairs in 1967 (Defourny et al. 2007). In Sweden the species has increased from 30-50 pairs in the 1970s to 1,800 pairs in 2007 (L. Lindell in litt. 2005, . Lindstrm in litt. 2005, Knott et al. 2009). The rate of increase in Sweden has been recorded as 7.1% annually during 1982-2006 or 13% annually during 1998-2006, depending on the survey method used (. Lindstrm in litt. 2007); and a rough calculation suggests that Sweden could support 5,000-10,000 pairs once the species has reached carrying capacity (N. Kjelln in litt. 2008). In Denmark, the population has increased from 17 known breeding pairs in 2001 to 81 breeding pairs in 2009 (Hjembk 2010). Since an extreme low during the 20th Century the U.K. population has increased in recent decades and was estimated to number 1,600 breeding pairs in 2008 (Knott et al. 2009). This population is still increasing rapidly and a long-term estimate for future carrying capacity is in the order of 10,000 pairs (N. Kjelln in litt. 2008). Overall, the species population has declined in recent years owing to rapid declines in Iberia for resident breeding birds, and migrants that winter in Spain. Previously the majority of the global population wintered in Spain, but increasingly birds are remaining on their northern European breeding grounds. Those populations that winter outside of Spain are generally increasing. Therefore, while serious declines are expected to continue in southern Europe and therefore in the global population as a whole, as northern populations increase, it is anticipated that their growth will eventually outweigh declines in Iberia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Milvus milvus is endemic to the western Palearctic region in Europe and northwest Africa. Formerly, these birds of prey also occurred in northern Iran. They are rare kites that are resident in western Europe and northwest Africa. Red kites from northeastern and central Europe migrate further south and west, reaching south to Turkey for the winter season. Vagrant birds have been recorded as far north as Finland and south in Israel and Libya.

Biogeographic Regions: palearctic (Native )

  • Newton, I., P. Davis, D. Moss. 1996. Distribution and Breeding of Red Kites Milvus milvus in Relation to Afforestation and Other Land-use in Wales. The Journal of Applied Ecology, 33: 210-224.
  • Snow, D., C. Perrins. 1998. The Birds of the Western Palearctic Concise Edition. Oxford Oxfordshire: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The red kite is almost entirely restricted to Europe. In Britain it is present throughout the year, whilst the majority of birds in central Europe move south to spend the winter in Iberia. The history of the British population is well known. Formerly a common and widespread bird, it was extinct in England and Scotland by 1900, and only a remnant population survived in central Wales. Today, the range of the red kite is expanding in the UK. Successful re-introductions have allowed the bird to re-colonise several parts of its former range and numbers are now increasing in several areas of England and Scotland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Red kites are brownish-chestnut in color with a mix of orange/buff and darker brown or black streaking. The main wing feathers (secondaries and primaries) are dark brown, which contrast with white patches under the wings. They have pale grey heads which are streaked with black. The bright yellow legs and feet can often be seen in flight. They have hooked beaks which are very sharp and designed for tearing meat. Females are generally larger ranging from 1000 to 1300 g in weight, males are 800 to 1200 g. Their wingspan ranges from 175 to 195 cm and body length from 60 to 66 cm.

Range mass: 800 to 1300 g.

Range length: 60 to 66 cm.

Range wingspan: 175 to 195 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species breeds in broadleaf woodlands and forests, mixed with farmland, pasture and heathland, to 2,500 m in Morocco(del Hoyo et al. 1994). In winter it also occupies wasteland, scrub and wetlands. Formerly an urban scavenger, it still visits the edges of towns and cities. It takes a wide range of food, but feeds mainly on carrion and small to medium-sized mammals and birds. Reptiles, amphibians and invertebrates are less important prey. Most birds in north-east Europe are migratory, wintering mainly in southern France and Iberia, but with some travelling as far as Africa(del Hoyo et al. 1994). Migrants travel south from their breeding grounds between August and November, returning between February and April (Snow and Perrins 1998). Birds are usually seen singly or in pairs, but sometimes form small flocks, possibly family groups, when soaring on migration (Ferguson-Lees and Christie 2001).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red kites are a wide-ranging species with a wide habitat tolerance. Their only requirements are large, mature trees in which to build nests. Generally these nests are built 10 to 15 m above ground. Sometimes red kites take over an old crow or buzzard nest. Red kites can be very protective of their nesting area, but are not highly territorial of their entire breeding territory. Most red kites nest within 20 km of where they were reared.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest ; mountains

Other Habitat Features: agricultural ; riparian

  • Mougeot, F. 2000. Territorial intrusions and copulation patterns in red kites, Milvus milvus, in realtion to breeding density. Animal Behaviour, 59: 633-642.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although often associated with woodland, the kite requires open habitats for foraging and birds can be seen drifting over both arable crops and grassland in their quest for food. It is a highly adaptable species and is able to thrive in a wide range of landscape types providing that the basic requirements of open areas for finding food, and woodland for nesting and roosting are met. Productive lowland landscapes support the highest densities of birds but kites are also found in the upland fringes where they forage over moorland and rough pastures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Red kites are primarily scavengers, but they are also predators, especially during the breeding season when they must feed their young. They eat a wide variety of live prey, primarily small mammals such as rabbits, voles, and field mice, but also including birds, worms, and invertebrate prey. Red kites glide lower than their usual soaring height to hunt live prey, visually searching for movements on the ground. They then dive quickly and grab prey in their talons.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Primary Diet: carnivore (Eats terrestrial vertebrates, Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Red kites are important predators and scavengers in the ecosystems they inhabit. Parasites found on these birds include: an acanthocephalan (Centrorhynchus milvus) and a trematode (Phagicola ascolonga).

Commensal/Parasitic Species:

  • acanthocephalan (Centrorhynchus milvus)
  • trematode (Phagicola ascolonga)

  • Kuntz, R., A. Chandler. 1956. Studies on Egyptian Trematodes with Special Reference to the Heterophyids of Mammals. I. Adult Flukes, with Descriptions of Phagicola longicollis n. sp., Cynodiplostomum namrui n. sp., and a Stephanoprora from Cats. The Journal of Parasitology, 42/4: 445-459.
  • Schmidt, G. 1975. Sphaerirostris wertheimae sp. n., and Other Acanthocephala from Vertebrates of Israel. The Journal of Parasitology, 61/2: 298-300.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Goshawks (Accipiter gentilis) are the only known natural predators of adult red kites. The main threat is from human activity. Red kites have been targeted by egg thieves and illegal use of poisoned baits in carcasses, even though they are not set specifically for red kites. Nestlings and eggs are also vulnerable to nest predators, although both parents actively defend the nest. At signs of predators females signal to her fledglings who "play dead," even to the extent that a fox will believe them to be dead and leave, thinking it can return to eat them later.

Known Predators:

  • northern goshawks (Accipiter gentilis)
  • humans (Homo sapiens)
  • red foxes (Vulpes vulpes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Milvus milvus preys on:
Tyto alba

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Red kites, like other carrion birds, feed on widely dispersed food sources, so they may communicate at roost sites. Individuals tend to find food for themselves or by following another.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Captive red kites are known to have lived 26 years in captivity. Wild records are unavailable, but related Milvus migrans have been recorded living up to 24 years in the wild.

Range lifespan

Status: captivity:
26 (high) years.

  • Richards, A. 1998. Birds of Prey: Hunters of the Sky. Philadelphia, Pennsylvania: Courage Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 38 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Red kites are monogamous and pair-bond for life, usually staying with each other year-round. Courtship each year renews the bond the pair already have. Mated pairs are more successful in reproduction with experience.

Courtship begins for established pairs in March. The birds play courtship games, such as flying towards each other and then turning and twisting away from each other at the last moment. They also have mock talon grappling fights, spinning in mid air, spiraling toward the ground, parting at tree level. Occasionally pairs courting this way fail to release each other in time and die.

Mating System: monogamous

Red kites reach maturity between 2 and 4 years of age. These birds normally pair for life, although, in winter they may spend time apart or in communal roosts. Winter is the best time for viewing kites because it minimizes disturbance to breeding kites. They are notorious for being easily disturbed at the nest.

One to three eggs are normally laid in April, produced at 3 day intervals. This ensures that there will be a dominant chick who will likely outlive his siblings. Incubation time is 31 to 32 days with an extra 3 days per additional egg.

Fledging can take 7 to 9 weeks, depending on food availability. At around 6 weeks the chicks will move away from the nest to exercise their wings. Even after their first flight, young do not move far from their nests as parents continue to feed them around the nest for several weeks. Young attain adult plumage at around 1 year and will breed at about 3 years.

Breeding interval: Red kites breed once yearly.

Breeding season: Nest-building usually begins during March, but first-time breeders may not start until April. Eggs are usually laid in early April.

Range eggs per season: 1 to 3.

Range time to hatching: 31 to 35 days.

Range fledging age: 7 to 9 weeks.

Average time to independence: 1 years.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both parents assist in nest-building, usually in hardwood trees. Red kites are protective of the nest area, but not of the entire breeding territory.  The female carries out the majority of incubation with relief from the male for several 20-minute breaks during the day for feeding and exercise. The parents stay alert for nest predators, such as crows and ravens. When the chicks hatch, the male bird brings food to the nest for the female to tear into small pieces to feed them. Parents will continue to feed the young a few weeks past the fledgling stage.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Mougeot, F. 2000. Territorial intrusions and copulation patterns in red kites, Milvus milvus, in realtion to breeding density. Animal Behaviour, 59: 633-642.
  • Newton, I., P. Davis, D. Moss. 1996. Distribution and Breeding of Red Kites Milvus milvus in Relation to Afforestation and Other Land-use in Wales. The Journal of Applied Ecology, 33: 210-224.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Milvus milvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAATCTTCGGCGCCTGGGCTGGTATGATCGGCACCGCCCTCAGCCTACTCATTCGCGCAGAACTTGGTCAACCAGGTACGCTCCTAGGCGACGACCAAATCTACAATGTAATCGTCACTGCACATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATAATTGGAGGGTTCGGAAACTGACTTGTCCCTCTCATAATTGGCGCCCCTGACATAGCTTTCCCACGCATGAACAACATAAGCTTCTGACTACTCCCTCCATCTTTCCTCCTCCTACTAGCCTCCTCAACCGTAGAAGCAGGGGCTGGTACTGGATGAACTGTTTACCCCCCATTAGCTGGCAACATAGCCCATGCCGGGGCCTCAGTAGATCTAGCCATCTTCTCCTTACACCTAGCCGGAATTTCATCCATTCTAGGAGCAATTAACTTCATCACAACTGCTATCAACATAAAACCCCCAGCCCTTTCCCAATACCAAACACCCCTATTTGTATGATCTGTCCTCATTACCGCTGTCCTACTACTACTCTCACTCCCAGTCCTAGCTGCTGGCATTACCATGTTACTTACAGACCGAAACCTCAACACAACGTTCTTTGACCCTGCCGGCGGAGGCGATCCCATCCTATACCAACATCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Milvus milvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Aebischer, A., Cardiel, I., Carter, I., Cross, A., Ignacio, A., Keller, V., Lindell, L., Lindstrm, ., Madroo, A., Mammen, U., Mionnet, A., Newberry, P., Seyer, H., Tourret, P., Vinuela, J., Kjelln, N. & Barov, B.

Justification
This species is listed as Near Threatened because it is experiencing a moderately rapid population decline, owing mostly to poisoning from pesticides and persecution, and changes in land-use amongst other threats. Despite the current rapid declines in southern Europe, if population increases in northern range states are sustained the species may qualify for downlisting in the future.


History
  • 2012
    Near Threatened (NT)
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Threatened (T)