You are viewing this Taxon as classified by:

Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident from central Sonora, southern Arizona (breeds irregularly), Distrito Federal (Mexico), and central and southeastern Texas south through most of Middle America and South America west of Andes to western Ecuador, east of Andes to eastern Peru, Bolivia, northern Argentina, Paraguay, and southeastern Brazil; formerly bred in Puerto Rico; one breeding record for Tennessee, possibly based on escaped individuals. Possibly expanding range into eastern Texas and southwestern Louisiana (see McKenzie and Zwank 1988). In the U.S., occurs in winter primarily in southern coastal Texas (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 53 cm

Weight: 849 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Freshwater and brackish marshes, lagoons, and borders of ponds and streams; often forages in cultivated fields (AOU 1983); wet pastures. Rests in or beside water by day (Stiles and Skutch 1989). Perches readily in trees (Ridgely and Gwynne 1989). Nests in tree cavities (sometimes considerable distance from water), nest boxes, or on the ground in grassy areas or under brush/cactus near water; ground nesting most common where mammalian nest predators absent; sometimes nests on or in human-made structures. See McKenzie and Zwank (1988) for details on nest sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Marsh

Black-bellied Whistling Ducks nest in thickets or stands of mesquite, hackberry, willow, live oak, and other trees. They forage in fields, lawns, and shallow, freshwater ponds that often contain water hyacinth, water lilies, and cattails. In the tropics, they also use mangroves, rivers, and lagoons.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Mostly migratory in far north (Texas) and also at southern limit. Generally departs from Texas breeding areas October-November, return mainly March-April. In Costa Rica, pronounced movements reflect changing water levels (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats grain, seeds, some insects and mollusks, also leaves and shoots; forages in fields and in shallow water (Palmer 1976). Young eat various insects, spiders, snails, and other invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food

Black-bellied Whistling-Ducks eat mainly plants, including smartweed, grasses, swamp timothy, amaranth, sedges, bindweed, and nightshade. They also eat many agricultural crops including sorghum, millet, corn, rice, and wheat. They eat a smaller amount of aquatic animals such as snails, insects, and spiders. They typically forage at night, leaving roosts at sunset to fly to foraging areas. They feed in fields or by dabbling in shallow ponds.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious. Large flocks observed in wintering areas in Mexico and Central America (though formerly more abundant in interior Mexico than at present).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Dabbler

Black-bellied Whistling-Ducks have long legs and spend more time than other ducks walking on land or perching in trees. You may see them perched on fences, telephone lines, or in Spanish moss. They are gregarious year-round, forming flocks of up to 1,000 birds. They form lifelong pair bonds and breed in their first year of life. Males spar by chasing or nipping at each other, or with a threat display that involves stretching their neck forward and opening their bill. Pairs form in winter; courtship includes birds stretching their necks out horizontally, dipping their bill, and flicking water over the back. Females often lay eggs in the nests of other whistling-ducks—a behavior known as egg-dumping. Individuals are attracted to areas where corn and rice are grown and can cause damage to crops. Nest predators include raccoons, rat snakes, and bull snakes; ducklings may be killed by fire ants, bass, catfish, and gar. Great Horned Owls sometimes take adults.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Commonly feeds at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Most nesting occurs May-June in Texas; September-October breeding in Venezuela; adults with young April-August and December-February in Colombia (Hilty and Brown 1986); nests May-October in Costa Rica (Stiles and Skutch 1989). Clutch size is 9-18. Incubation, by both sexes, lasts 25-30 days. Young are tended by both sexes, leave nest at 1-2 days, first fly at 56-63 days. Apparently breeds in first year. Life-long pair-bond. Intraspecific dump nesting is common. Nest density of 16/ha was observed on islands in Tamaulipas, Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrocygna autumnalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTATCTTTGGAGCATGAGCAGGAATAATCGGTACCGCACTCAGCTTGCTAATTCGTGCAGAACTGGGACAACCTGGAACCCTTCTAGGAGATGACCAAATTTACAACGTAATCGTCACTGCTCATGCCTTCGTAATAATTTTCTTCATAGTTATACCCATTATGATTGGAGGCTTCGGAAACTGACTGGTTCCCCTAATAATTGGCGCCCCCGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGGCTACTGCCACCATCATTCCTACTCCTCCTAGCTTCATCAACTGTAGAAGCGGGCGCCGGCACAGGATGAACCGTCTACCCACCCCTAGCAGGCAACCTAGCTCACGCCGGAGCATCAGTAGACCTAGCTATCTTCTCCCTCCATTTAGCCGGTGTTTCTTCCATCCTAGGAGCCATTAATTTTATTACTACAGCTATCAACATAAAACCCCCTGCATTATCACAATACCAAACTCCACTATTCGTATGATCTGTCCTAATTACTGCCATCTTACTCCTCCTATCACTGCCTGTACTCGCCGCCGGTATCACAATACTACTAACAGACCGAAACCTGAACACCACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTGTACCAACACCTGTTTTGATTCTTTGGACACCCAGAAGTATATATCCTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrocygna autumnalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5