Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident from central Sonora, southern Arizona (breeds irregularly), Distrito Federal (Mexico), and central and southeastern Texas south through most of Middle America and South America west of Andes to western Ecuador, east of Andes to eastern Peru, Bolivia, northern Argentina, Paraguay, and southeastern Brazil; formerly bred in Puerto Rico; one breeding record for Tennessee, possibly based on escaped individuals. Possibly expanding range into eastern Texas and southwestern Louisiana (see McKenzie and Zwank 1988). In the U.S., occurs in winter primarily in southern coastal Texas (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 53 cm

Weight: 849 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Freshwater and brackish marshes, lagoons, and borders of ponds and streams; often forages in cultivated fields (AOU 1983); wet pastures. Rests in or beside water by day (Stiles and Skutch 1989). Perches readily in trees (Ridgely and Gwynne 1989). Nests in tree cavities (sometimes considerable distance from water), nest boxes, or on the ground in grassy areas or under brush/cactus near water; ground nesting most common where mammalian nest predators absent; sometimes nests on or in human-made structures. See McKenzie and Zwank (1988) for details on nest sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Mostly migratory in far north (Texas) and also at southern limit. Generally departs from Texas breeding areas October-November, return mainly March-April. In Costa Rica, pronounced movements reflect changing water levels (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats grain, seeds, some insects and mollusks, also leaves and shoots; forages in fields and in shallow water (Palmer 1976). Young eat various insects, spiders, snails, and other invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious. Large flocks observed in wintering areas in Mexico and Central America (though formerly more abundant in interior Mexico than at present).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Commonly feeds at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Most nesting occurs May-June in Texas; September-October breeding in Venezuela; adults with young April-August and December-February in Colombia (Hilty and Brown 1986); nests May-October in Costa Rica (Stiles and Skutch 1989). Clutch size is 9-18. Incubation, by both sexes, lasts 25-30 days. Young are tended by both sexes, leave nest at 1-2 days, first fly at 56-63 days. Apparently breeds in first year. Life-long pair-bond. Intraspecific dump nesting is common. Nest density of 16/ha was observed on islands in Tamaulipas, Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrocygna autumnalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTATCTTTGGAGCATGAGCAGGAATAATCGGTACCGCACTCAGCTTGCTAATTCGTGCAGAACTGGGACAACCTGGAACCCTTCTAGGAGATGACCAAATTTACAACGTAATCGTCACTGCTCATGCCTTCGTAATAATTTTCTTCATAGTTATACCCATTATGATTGGAGGCTTCGGAAACTGACTGGTTCCCCTAATAATTGGCGCCCCCGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGGCTACTGCCACCATCATTCCTACTCCTCCTAGCTTCATCAACTGTAGAAGCGGGCGCCGGCACAGGATGAACCGTCTACCCACCCCTAGCAGGCAACCTAGCTCACGCCGGAGCATCAGTAGACCTAGCTATCTTCTCCCTCCATTTAGCCGGTGTTTCTTCCATCCTAGGAGCCATTAATTTTATTACTACAGCTATCAACATAAAACCCCCTGCATTATCACAATACCAAACTCCACTATTCGTATGATCTGTCCTAATTACTGCCATCTTACTCCTCCTATCACTGCCTGTACTCGCCGCCGGTATCACAATACTACTAACAGACCGAAACCTGAACACCACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTGTACCAACACCTGTTTTGATTCTTTGGACACCCAGAAGTATATATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendrocygna autumnalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Susceptible to overharvest due to unwariness.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See McKenzie and Zwank (1988) for a discussion nest box design and use.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Sometimes a pest in sprouting rice fields (Costa Rica, Stiles and Skutch 1989). Often harvested for human consumption. Often kept in captivity around farmyards and pools (Panama, Ridgely and Gwynne 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-bellied Whistling Duck

The Black-bellied Whistling Duck or Black-bellied Whistling-Duck (Dendrocygna autumnalis), formerly also called Black-bellied Tree Duck, is a whistling duck that breeds from the southernmost United States and tropical Central to south-central South America. In the USA, it can be found year-round in parts of southeast Texas, and seasonally in southeast Arizona, and Louisiana's Gulf Coast. It is a rare breeder in such disparate locations as Florida, Arkansas, Georgia and South Carolina. There is a large population of several hundred that winter each year in Audubon Park in uptown New Orleans, Louisiana.

It is widely known as pijije (also pixixi or pichichi), chiriría or sirirí in Latin America, though this can also refer to other whistling-ducks and a qualifyer such as ala blanca or aliblanco ("white-winged") is usually added to signify this species. In Mexico, it is also called pato maízal ("cornfield duck") due to its habit of visiting such fields after harvest. And since it is one of only two whistling-duck species native to North America, it is occasionally just known as the "whistling duck" in the southern USA.

Contents

Description [edit]

Two D. a. discolor, the southern subspecies (note grey breast).
Also note the varying amount of white visible in sitting animals.

The Black-bellied Whistling Duck is a mid-sized waterfowl species. Length ranges from 47 to 56 cm (19 to 22 in), body mass from 652 to 1,020 g (1.44 to 2.2 lb) and wingspan ranges from 76 to 94 cm (30 to 37 in).[1][2] It has a long red bill, long head and longish legs, pale grey head and mostly grey-brown plumage. The belly and tail are black, and the body plumage, back of the neck and cap are a rich chestnut brown. The face and upper neck are grey, and they sport a thin but distinct white eye-ring. The extensive white in the wings is obvious in flight, less so on the ground; it is formed by the secondary remiges while the primaries are black; the wing-coverts are brown. Males and females look alike; juveniles are similar but have a grey bill and less contrasting belly.

The wing bar is in fact unique among living whistling ducks. But when on the ground, it may be hard to discern or look like the light flanks present in many of these waterfowl. The Fulvous Whistling-duck (D. bicolor) is the only sympatric whistling duck that shows such a whitish flank stripe however, and it differs from the Black-bellied by having dark wings and a lighter belly rather than the other way around. Juvenile D. autumnalis are quite similar to young of the White-faced Whistling-duck (D. viduata), which have a darker bill and no white wing patch; even when sitting they never seem to show white along the sides, as their thin white vertical barring on the black flanks is very indistinct.

As the name implies, these are noisy birds with a clear whistling waa-chooo call.

Subspecies [edit]

There are two subspecies, which intergrade in Panama:

Larger, with a brown breast and upper back
Smaller, with grey breast and upper back

Ecology [edit]

Black-bellied Whistling Ducks rarely move long distances, but these birds were seen near Saltsburg in Pennsylvania. They may be vagrants or escaped from aviculture.

The Black-bellied Whistling Duck is a common but wary species. It is highly gregarious, forming large flocks when not breeding, and is largely resident apart from local movements. It usually nests in hollow trees. The habitat is quiet shallow freshwater ponds, lakes, and marshes, cultivated land or reservoirs with plentiful vegetation, where this duck feeds mainly at night on seeds and other plant food. Tree-lined bodies of water are of particular value and as the old common name suggests, they are quite fond of perching in trees. This species can also be seen "loafing" (doing nothing in particular except hanging around and socializing) in flocks on golf courses and other grassy areas near suitable waterways.

Diet [edit]

Feeding often occurs nocturnally, but they can be encountered eating at any hour of the day. Black-bellied Whistling Ducks ingest a wide variety of plant material, but also consume arthropods and aquatic invertebrates when available. They often feed on submerged vegetation by wading through shallow water. As its Mexican name implies, it is commonly seen gleaning recently-harvested fields for leftover seed and invertebrates brought up by the harvesters disturbing the soil.

Movements [edit]

The Black-bellied Whistling Duck is mainly non-migratory. Birds in the extreme northern portions of their range (Arizona, Louisiana, and parts of Texas) move south in winter. At the heart of their range, there is a tendency to travel in flocks over the winter months, though this behavior is not a true long-range migration but rather local dispersal.

Reproduction [edit]

The Black-bellied Whistling Duck is quite unique among ducks in their strong monogamous pair-bond. Its pairs often stay together for many years, a trait more often associated with geese and swans. Both parents share all tasks associated with the raising of young, from incubation to the rearing of ducklings. The ducks, primarily cavity nesters, prefer the confines of a hollow tree, but will nest on the ground when necessary. They also make use of chimneys, abandoned buildings, or nest boxes, the latter having been increasingly provided to them over recent decades, especially in southeast Texas and Mexico. Ducklings leap from nest cavities within two days of hatching, can feed themselves immediately, and stay with the parents for up to eight weeks.

Status and conservation [edit]

This species is not considered to be of conservation concern by the IUCN[4] and the National Audubon Society; its global population is estimated at 1,550,000 birds.[citation needed]

Footnotes [edit]

  1. ^ [1]
  2. ^ [2]
  3. ^ Bencke (2007)
  4. ^ BLI (2004)

References [edit]

  • Bencke, Glayson Ariel (2007): Avifauna atual do Rio Grande do Sul, Brasil: aspectos biogeográficos e distribucionais ["The Recent avifauna of Rio Grande do Sul: Biogeographical and distributional aspects"]. Talk held on 2007-JUN-22 at Quaternário do RS: integrando conhecimento, Canoas, Rio Grande do Sul, Brazil. PDF abstract
  • BirdLife International (BLI) (2004). Dendrocygna autumnalis. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 11 May 2006. Database entry includes justification for why this species is of least concern
  • Madge, Steve & Burn, Hilary (1987): Wildfowl : an identification guide to the ducks, geese and swans of the world. Christopher Helm, London. ISBN 0-7470-2201-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!