Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident from central Sonora, southern Arizona (breeds irregularly), Distrito Federal (Mexico), and central and southeastern Texas south through most of Middle America and South America west of Andes to western Ecuador, east of Andes to eastern Peru, Bolivia, northern Argentina, Paraguay, and southeastern Brazil; formerly bred in Puerto Rico; one breeding record for Tennessee, possibly based on escaped individuals. Possibly expanding range into eastern Texas and southwestern Louisiana (see McKenzie and Zwank 1988). In the U.S., occurs in winter primarily in southern coastal Texas (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 53 cm

Weight: 849 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Marismas Nacionales-San Blas Mangroves Habitat

This taxon is found in the Marismas Nacionales-San Blas mangroves ecoregion contains the most extensive block of mangrove ecosystem along the Pacific coastal zone of Mexico, comprising around 2000 square kilometres. Mangroves in Nayarit are among the most productive systems of northwest Mexico. These mangroves and their associated wetlands also serve as one of the most important winter habitat for birds in the Pacific coastal zone, by serving about eighty percent of the Pacific migratory shore bird populations.

Although the mangroves grow on flat terrain, the seven rivers that feed the mangroves descend from mountains, which belong to the physiographic province of the Sierra Madre Occidental. The climate varies from temperate-dry to sub-humid in the summer, when the region receives most of its rainfall (more than 1000 millimetres /year).

Red Mangrove (Rhizophora mangle), Black Mangrove (Avicennia germinans), Buttonwood (Conocarpus erectus) and White Mangrove trees (Laguncularia racemosa) occur in this ecoregion. In the northern part of the ecoregion near Teacapán the Black Mangrove tree is dominant; however, in the southern part nearer Agua Brava, White Mangrove dominates. Herbaceous vegetation is rare, but other species that can be found in association with mangrove trees are: Ciruelillo (Phyllanthus elsiae), Guiana-chestnut (Pachira aquatica), and Pond Apple (Annona glabra).

There are are a number of reptiles present, which including a important population of Morelet's Crocodile (Crocodylus moreletii) and American Crocodile (Crocodylus acutus) in the freshwater marshes associated with tropical Cohune Palm (Attalea cohune) forest. Also present in this ecoregion are reptiles such as the Green Iguana (Iguana iguana), Mexican Beaded Lizard (Heloderma horridum) and Yellow Bellied Slider (Trachemys scripta). Four species of endangered sea turtle use the coast of Nayarit for nesting sites including Leatherback Turtle (Dermochelys coriacea), Olive Ridley Turtle (Lepidochelys olivacea), Hawksbill Turtle (Eretmochelys imbricata) and Green Turtle (Chelonia mydas).

A number of mammals are found in the ecoregion, including the Puma (Puma concolor), Ocelot (Leopardus pardalis), Jaguar (Panthera onca), Southern Pygmy Mouse (Baiomys musculus), Saussure's Shrew (Sorex saussurei). In addition many bat taxa are found in the ecoregion, including fruit eating species such as the Pygmy Fruit-eating Bat (Artibeus phaeotis); Aztec Fruit-eating Bat (Artibeus aztecus) and Toltec Fruit-eating Bat (Artibeus toltecus); there are also bat representatives from the genus myotis, such as the Long-legged Myotis (Myotis volans) and the Cinnamon Myotis (M. fortidens).

There are more than 252 species of birds, 40 percent of which are migratory, including 12 migratory ducks and approximately 36 endemic birds, including the Bumblebee Hummingbird, (Atthis heloisa) and the Mexican Woodnymph (Thalurania ridgwayi). Bojórquez considers the mangroves of Nayarit and Sinaloa among the areas of highest concentration of migratory birds. This ecoregion also serves as wintering habitat and as refuge from surrounding habitats during harsh climatic conditions for many species, especially birds; this sheltering effect further elevates the conservation value of this habitat.

Some of the many representative avifauna are Black-bellied Whistling Duck (Dendrocygna autumnalis), Great Blue Heron (Ardea herodias), Roseate Spoonbill (Ajaia ajaja), Snowy Egret (Egretta thula), sanderling (Calidris alba), American Kestrel (Falco sparverius), Blue-winged Teal (Anas discors), Mexican Jacana (Jacana spinosa), Elegant Trogan (Trogan elegans), Summer Tanager (Piranga rubra), White-tailed Hawk (Buteo albicaudatus), Merlin (Falco columbarius), Plain-capped Starthroat (Heliomaster constantii), Painted Bunting (Passerina ciris) and Wood Stork (Mycteria americana).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Freshwater and brackish marshes, lagoons, and borders of ponds and streams; often forages in cultivated fields (AOU 1983); wet pastures. Rests in or beside water by day (Stiles and Skutch 1989). Perches readily in trees (Ridgely and Gwynne 1989). Nests in tree cavities (sometimes considerable distance from water), nest boxes, or on the ground in grassy areas or under brush/cactus near water; ground nesting most common where mammalian nest predators absent; sometimes nests on or in human-made structures. See McKenzie and Zwank (1988) for details on nest sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Marsh

Black-bellied Whistling Ducks nest in thickets or stands of mesquite, hackberry, willow, live oak, and other trees. They forage in fields, lawns, and shallow, freshwater ponds that often contain water hyacinth, water lilies, and cattails. In the tropics, they also use mangroves, rivers, and lagoons.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Mostly migratory in far north (Texas) and also at southern limit. Generally departs from Texas breeding areas October-November, return mainly March-April. In Costa Rica, pronounced movements reflect changing water levels (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats grain, seeds, some insects and mollusks, also leaves and shoots; forages in fields and in shallow water (Palmer 1976). Young eat various insects, spiders, snails, and other invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food

Black-bellied Whistling-Ducks eat mainly plants, including smartweed, grasses, swamp timothy, amaranth, sedges, bindweed, and nightshade. They also eat many agricultural crops including sorghum, millet, corn, rice, and wheat. They eat a smaller amount of aquatic animals such as snails, insects, and spiders. They typically forage at night, leaving roosts at sunset to fly to foraging areas. They feed in fields or by dabbling in shallow ponds.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious. Large flocks observed in wintering areas in Mexico and Central America (though formerly more abundant in interior Mexico than at present).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Dabbler

Black-bellied Whistling-Ducks have long legs and spend more time than other ducks walking on land or perching in trees. You may see them perched on fences, telephone lines, or in Spanish moss. They are gregarious year-round, forming flocks of up to 1,000 birds. They form lifelong pair bonds and breed in their first year of life. Males spar by chasing or nipping at each other, or with a threat display that involves stretching their neck forward and opening their bill. Pairs form in winter; courtship includes birds stretching their necks out horizontally, dipping their bill, and flicking water over the back. Females often lay eggs in the nests of other whistling-ducks—a behavior known as egg-dumping. Individuals are attracted to areas where corn and rice are grown and can cause damage to crops. Nest predators include raccoons, rat snakes, and bull snakes; ducklings may be killed by fire ants, bass, catfish, and gar. Great Horned Owls sometimes take adults.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Commonly feeds at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Most nesting occurs May-June in Texas; September-October breeding in Venezuela; adults with young April-August and December-February in Colombia (Hilty and Brown 1986); nests May-October in Costa Rica (Stiles and Skutch 1989). Clutch size is 9-18. Incubation, by both sexes, lasts 25-30 days. Young are tended by both sexes, leave nest at 1-2 days, first fly at 56-63 days. Apparently breeds in first year. Life-long pair-bond. Intraspecific dump nesting is common. Nest density of 16/ha was observed on islands in Tamaulipas, Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Dendrocygna autumnalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Dendrocygna autumnalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTATCTTTGGAGCATGAGCAGGAATAATCGGTACCGCACTCAGCTTGCTAATTCGTGCAGAACTGGGACAACCTGGAACCCTTCTAGGAGATGACCAAATTTACAACGTAATCGTCACTGCTCATGCCTTCGTAATAATTTTCTTCATAGTTATACCCATTATGATTGGAGGCTTCGGAAACTGACTGGTTCCCCTAATAATTGGCGCCCCCGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGGCTACTGCCACCATCATTCCTACTCCTCCTAGCTTCATCAACTGTAGAAGCGGGCGCCGGCACAGGATGAACCGTCTACCCACCCCTAGCAGGCAACCTAGCTCACGCCGGAGCATCAGTAGACCTAGCTATCTTCTCCCTCCATTTAGCCGGTGTTTCTTCCATCCTAGGAGCCATTAATTTTATTACTACAGCTATCAACATAAAACCCCCTGCATTATCACAATACCAAACTCCACTATTCGTATGATCTGTCCTAATTACTGCCATCTTACTCCTCCTATCACTGCCTGTACTCGCCGCCGGTATCACAATACTACTAACAGACCGAAACCTGAACACCACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTGTACCAACACCTGTTTTGATTCTTTGGACACCCAGAAGTATATATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is estimated to number 1,100,000-2,000,000 individuals.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food

Black-bellied Whistling-Ducks eat mainly plants, including smartweed, grasses, swamp timothy, amaranth, sedges, bindweed, and nightshade. They also eat many agricultural crops including sorghum, millet, corn, rice, and wheat. They eat a smaller amount of aquatic animals such as snails, insects, and spiders. They typically forage at night, leaving roosts at sunset to fly to foraging areas. They feed in fields or by dabbling in shallow ponds.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Susceptible to overharvest due to unwariness.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See McKenzie and Zwank (1988) for a discussion nest box design and use.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Sometimes a pest in sprouting rice fields (Costa Rica, Stiles and Skutch 1989). Often harvested for human consumption. Often kept in captivity around farmyards and pools (Panama, Ridgely and Gwynne 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black-bellied whistling duck

The black-bellied whistling duck (Dendrocygna autumnalis), formerly also called black-bellied tree duck, is a whistling duck that breeds from the southernmost United States and tropical Central to south-central South America. In the USA, it can be found year-round in parts of southeast Texas, and seasonally in southeast Arizona, and Louisiana's Gulf Coast. It is a rare breeder in such disparate locations as Florida, Arkansas, Georgia, and South Carolina. There is a large population of several hundred that winter each year in Audubon Park in uptown New Orleans, Louisiana. Since it is one of only two whistling-duck species native to North America, it is occasionally just known as the "whistling duck" in the southern USA.

Description[edit]

A black-bellied whistling duck in the water

The black-bellied whistling duck is a mid-sized waterfowl species. Length ranges from 47 to 56 cm (19 to 22 in), body mass from 652 to 1,020 g (1.437 to 2.249 lb) and wingspan ranges from 76 to 94 cm (30 to 37 in).[2][3] It has a long red bill, long head and longish legs, pale grey head and mostly grey-brown plumage. The belly and tail are black, and the body plumage, back of the neck and cap are a rich chestnut brown. The face and upper neck are grey, and they sport a thin but distinct white eye-ring. The extensive white in the wings is obvious in flight, less so on the ground; it is formed by the secondary remiges while the primaries are black; the wing-coverts are brown. Males and females look alike; juveniles are similar but have a grey bill and less contrasting belly.

The wing bar is unique among living whistling ducks. When on the ground, it may be hard to discern the light flanks present in many of these waterfowl. The fulvous whistling-duck (D. bicolor) is the only sympatric whistling duck that shows such a whitish flank stripe, and it differs from the black-bellied by having dark wings and a lighter belly rather than the other way around. Juvenile D. autumnalis are quite similar to young of the White-faced Whistling-duck (D. viduata), which have a darker bill and no white wing patch; even when sitting they never seem to show white along the sides, as their thin white vertical barring on the black flanks is very indistinct.

As the name implies, these are noisy birds with a clear whistling waa-chooo call.

Subspecies[edit]

There are two subspecies, which intergrade in Panama:

  • Northern black-bellied whistling duck, D. a. autumnalis – Southern USA to Panama
Larger, with a brown breast and upper back
  • Southern black-bellied whistling duck, D. a. discolor – Panama to Paraguay and adjacent regions[4]
Smaller, with grey breast and upper back

Ecology[edit]

Black-bellied whistling ducks rarely move long distances, but these birds were seen near Saltsburg in Pennsylvania. They may be vagrants or escaped from aviculture.

The black-bellied whistling duck is a common species that is "quite tame, even in the wild".[5] It is highly gregarious, forming large flocks when not breeding, and is largely resident apart from local movements. It usually nests in hollow trees. The habitat is quiet shallow freshwater ponds, lakes, and marshes, cultivated land or reservoirs with plentiful vegetation, where this duck feeds mainly at night on seeds and other plant food. Tree-lined bodies of water are of particular value and as the old common name suggests, they are quite fond of perching in trees. This species can also be seen "loafing" (doing nothing in particular except hanging around and socializing) in flocks on golf courses and other grassy areas near suitable waterways.

Diet[edit]

Feeding often occurs nocturnally, but they can be encountered eating at any hour of the day. Black-bellied whistling ducks ingest a wide variety of plant material, but also consume arthropods and aquatic invertebrates when available. They often feed on submerged vegetation by wading through shallow water. As its Latin name (autumnalis) implies, it is commonly seen gleaning recently harvested fields for leftover seeds and invertebrates brought up by the harvesters disturbing the soil.

Movements[edit]

The black-bellied whistling duck is mainly non-migratory. Birds in the extreme northern portions of their range (Arizona, Louisiana, and parts of Texas) move south in winter. At the heart of their range, there is a tendency to travel in flocks over the winter months, though this behavior is not a true long-range migration but rather local dispersal.

Reproduction[edit]

The black-bellied whistling duck is quite unique among ducks in their strong monogamous pair-bond. Its pairs often stay together for many years, a trait more often associated with geese and swans. Both parents share all tasks associated with the raising of young, from incubation to the rearing of ducklings. The ducks, primarily cavity nesters, prefer the confines of a hollow tree, but will nest on the ground when necessary. They also make use of chimneys, abandoned buildings, or nest boxes, the latter having been increasingly provided to them over recent decades, especially in southeast Texas and Mexico. Ducklings leap from nest cavities within two days of hatching, can feed themselves immediately, and stay with the parents for up to eight weeks.

Status and conservation[edit]

This species is not considered to be of conservation concern by the IUCN[1] and the National Audubon Society; its global population is estimated at 1,100,000-2,000,000 birds.[1]

Footnotes[edit]

  1. ^ a b c BirdLife International (2012). "Dendrocygna autumnalis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Black-bellied Whistling-Duck". eNature.com. Retrieved 4 Jun 2014. 
  3. ^ "Black-bellied whistling-duck". All About Birds. Cornell Lab of Ornithology. 
  4. ^ Bencke (2007)
  5. ^ Bull, Farrand (1977)

References[edit]

  • Bencke, Glayson Ariel (2007): Avifauna atual do Rio Grande do Sul, Brasil: aspectos biogeográficos e distribucionais ["The Recent avifauna of Rio Grande do Sul: Biogeographical and distributional aspects"]. Talk held on 2007-JUN-22 at Quaternário do RS: integrando conhecimento, Canoas, Rio Grande do Sul, Brazil. PDF abstract
  • Bull, John; Farrand, John Jr. (1977). National Audubon Society Field Guide to North American Birds (Eastern Region). New York: National Audubon Society. ISBN 0-679-42852-6. 
  • Madge, Steve; Burn, Hilary (1987). Wildfowl : an identification guide to the ducks, geese and swans of the world. London: Christopher Helm. ISBN 0-7470-2201-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Notes

"Cool facts"

The Black-bellied Whistling-Duck is a boisterous duck with a brilliant pink bill and an unusual, long-legged silhouette. In places like Texas and Louisiana, watch for noisy flocks of these gaudy ducks dropping into fields to forage on seeds, or loafing on golf course ponds. Listen for them, too—these ducks really do have a whistle for their call. Common south of the U.S., Black-bellied Whistling-Ducks occur in several southern states and are expanding northward.

The whistling-ducks were formerly known as tree-ducks, but only a few, such as the Black-bellied Whistling-Duck actually perch or nest in trees. They look most like ducks, but their lack of sexual dimorphism, relatively long-term pair bonds, and lack of complex pair-forming behavior more resembles geese and swans.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!