Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Distribution

Range

Coastal nw Mexico to extreme nw Peru, Suriname, Trinidad.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Moist Pacific Coast Mangroves Habitat

This taxon occurs in the Moist Pacific Coast mangroves, an ecoregion along the Pacific coast of Costa Rica with a considerable number of embayments that provide shelter from wind and waves, thus favouring mangrove establishment. Tidal fluctuations also directly influence the mangrove ecosystem health in this zone. The Moist Pacific Coast mangroves ecoregion has a mean tidal amplitude of three and one half metres,

Many of the streams and rivers, which help create this mangrove ecoregion, flow down from the Talamanca Mountain Range. Because of the resulting high mountain sediment loading, coral reefs are sparse along the Pacific coastal zone of Central America, and thus reef zones are chiefly found offshore near islands. In this region, coral reefs are associated with the mangroves at the Isla del Caño Biological Reserve, seventeen kilometres from the mainland coast near the Térraba-Sierpe Mangrove Reserve. The Térraba-Sierpe, found at the mouths of the Térraba and Sierpe Rivers, is considered a wetland of international importance.

Because of high moisture availability, the salinity gradient is more moderate than in the more northern ecoregion such as the Southern dry Pacific Coast ecoregion. Resulting mangrove vegetation is mixed with that of marshland species such as Dragonsblood Tree (Pterocarpus officinalis), Campnosperma panamensis, Guinea Bactris (Bactris guineensis), and is adjacent to Yolillo Palm (Raphia taedigera) swamp forest, which provides shelter for White-tailed Deer (Odocoileus virginianus) and Mantled Howler Monkeys (Alouatta palliata). Mangrove tree and shrub taxa include Red Mangrove (Rhizophora mangle), Mangle Caballero (R. harrisonii) R. racemosa (up to 45 metres in canopy height), Black Mangrove (Avicennia germinans) and Mangle Salado (A. bicolor), a mangrove tree restricted to the Pacific coastline of Mesoamerica.

Two endemic birds listed by IUCN as threatened in conservation status are found in the mangroves of this ecoregion, one being the Mangrove Hummingbird (Amazilia boucardi EN), whose favourite flower is the Tea Mangrove (Pelliciera rhizophorae), the sole mangrove plant pollinated by a vertebrate. Another endemic avain species to the ecoregion is the  Yellow-billed Cotinga (Carpodectes antoniae EN).  Other birds clearly associated with the mangrove habitat include Roseate Spoonbill (Ajaia ajaja), Gray-necked Wood Rail (Aramides cajanea), Rufous-necked Wood Rail (A. axillaris), Mangrove Black-hawk (Buteogallus anthracinus subtilis),Striated Heron (Butorides striata), Muscovy Duck (Cairina moschata), Boat-billed Heron (Cochlearius cochlearius), American White Ibis (Eudocimus albus), Amazon Kingfisher (Chloroceryle amazona), Mangrove Cuckoo (Coccyzus minor), Yellow Warbler (Setophaga petechia), and Black-necked Stilt (Himantopus mexicanus VU) among other avian taxa.

Mammals although not as numerous as birds, include species such as the Lowland Paca (Agouti paca), Mantled Howler Monkey (Alouatta palliata), White-throated Capuchin (Cebus capucinus), Silky Anteater (Cyclopes didactylus), Central American Otter (Lontra longicaudis annectens), White-tailed Deer (Odocoileus virginianus), feeds on leaves within A. bicolor and L. racemosa forests. Two raccoons: Northern Raccoon (Procyon lotor) and Crab-eating Raccoon (P. cancrivorus) can be found, both on the ground and in the canopy consuming crabs and mollusks. The Mexican Collared Anteater (Tamandua mexicana) is also found in the Moist Pacific Coast mangroves.

There are a number of amphibians in the ecoregion, including the anuran taxa: Almirante Robber Frog (Craugastor talamancae); Chiriqui Glass Frog (Cochranella pulverata); Forrer's Grass Frog (Lithobates forreri), who is found along the Pacific versant, and is at the southern limit of its range in this ecoregion. Example salamanders found in the ecoregion are the Colombian Worm Salamander (Oedipina parvipes) and the Gamboa Worm Salamander (Oedipina complex), a lowland organism that is found in the northern end of its range in the ecoregion. Reptiles including the Common Basilisk Lizard (Basiliscus basiliscus), Boa Constrictor (Boa constrictor), American Crocodile (Crocodilus acutus), Spectacled Caiman (Caiman crocodilus), Black Spiny-tailed Iguana (Ctenosaura similis) and Common Green Iguana (Iguana iguana) thrive in this mangrove ecoregion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Bocas del Toro-San Bastimentos Island-San Blas Mangroves Habitat

This taxon is found in the Bocas del Toro-San Bastimentos Island-San Blas mangroves ecoregion, but not necessarily exclusive to this region. The Bocas del Toro-San Bastimentos Island-San Blas mangroves is one of the ecoregions of Panama, situated on the Caribbean coast of northern Panama. Precipitation in this region, entirely in the form of rainfall, amounts to approximately 6000 mm per annum. This ecoregion is largely comprised of mangrove swamps and contains an extensive coral reef system that protects the mangroves by moderating ocean wave action; in turn the mangroves trap sediment and promote water clarity than enhance coral reef development. Extensive submerged areas of this ecoregion are considered seagrass meadows, a highly biodiverse marine ecosystem that has high primary productivity as well as considerable species richness In the shallower waters are found manatee along with numerous corals, sponges, pipefishes and baracuda. The deeper coastal waters are habitat for dolphins, most notably at Dolphin Bay, somewhat south of Bastimentos Island.

The dominant shoreline ecoregion feature is the presence of Red Mangrove trees, whose submerged roots stabilize the shoreline. The near coastal zone and low elevation upland areas of this ecorefion also support a host of other flora, as well as birds, mammals, amphibians and arthropods.

Birdlife at the coastal upland and rich coastal riparian zone and other near shore upland habitats is quite diverse. A notable terrestrial bird endemic to the Bocas del Toro region is the Brown Parakeet. Another notable bird found in this ecoregion is the Pale-billed woodpecker, Campephilus guatemalensis, a large bird, who is found at the southern limit of his range here. The White-fronted nunbird, Monasa morphoeus, is a near passerine species found at the moist lowland forest edge, including secondary growth. Another bird found here that is tolerant of degraded forest is the Crimson-fronted parakeet, Aratinga finschi. A specialist bird to the mangroves and also dense somewhat upland areas of Bocas is the Rufous-necked wood-rail, Aramides axillaris. The Bare-necked umbrella bird is normally found at the higher elevation margin of the Bocas area, but can often be found in the near coastal fringe in non-breeding season.

Mammalian species include the Collared-peccary, who may be found in mainland Bocas del Toro lowland moist forest or grasslands. Also found here is the critically endangered Pygmy three-toed sloth, Bradypus pygmaeus, whose extant population of no more than a few hundred animals is restricted to the tiny (3.4 km2) island of Isla Escudo de Veraguas. There are also Central American red brocket, Mazama temama, a species of forest deer widespead in Mesoamerica.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aramides axillaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGACATTCATCAATCGATGACTATTCTCAACCAATCACAAAGATATCGGAACACTTTACCTAATCTTCGGAACATGAGCCGGCATAATTGGCACCGCTCTTAGCCTGCTCATCCGAGCAGAACTAGGACAACCCGGCAGCCTCTTAGGAGATGACCAAATCTATAATGTAATCGTTACTGCCCATGCCTTCGTAATAATCTTTTTTATAGTAATACCCATTATGATCGGAGGATTCGGCAACTGACTAGTCCCACTCATAATTGGAGCCCCAGATATAGCATTTCCTCGCATAAATAATATAAGTTTCTGACTCCTCCCACCCTCCTTCTTACTACTTCTGGCTTCTTCCACAGTAGAAGCAGGAGCAGGCACGGGCTGAACAGTTTACCCCCCATTAGCCGGTAATCTAGCCCATGCAGGAGCCTCAGTAGACCTAGCCATCTTCTCTCTTCACCTAGCAGGTGTCTCATCCATCCTAGGCGCCATCAATTTCATCACAACCGCCATCAACATAAAACCGCCCGCCCTATCTCAATATCAAACCCCATTATTCGTATGATCCGTCCTTATTACCGCAGTATTACTACTACTATCTCTCCCTGTCCTAGCCGCTGGTATCACCATGTTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCAGCCGGAGGAGGAGACCCAATCCTATATCAACACCTTTTCTGATTTTTCGGACACCCGGAAGTCTACATCCTATTTTTACCAGGGTTCGGAATCATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aramides axillaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 50,000-499,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rufous-necked Wood Rail

The Rufous-necked Wood Rail (Aramides axillaris) is a species of bird in the Rallidae family. It is found in Belize, Colombia, Costa Rica, Ecuador, El Salvador, French Guiana, Guyana, Honduras, Mexico, Nicaragua, Panama, Peru, Suriname, Trinidad and Tobago, and Venezuela. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical moist lowland forests, and subtropical or tropical mangrove forests.

In July, 2013, a specimen of the species was spotted at Bosque del Apache National Wildlife Refuge in New Mexico. Many bird enthusiasts and watchers traveled to the state to view it.[2]

References[edit]

  1. ^ BirdLife International (2012). "Aramides axillaris". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Tropic bird goes astray, sparks NM birding frenzy." Associated Press. 23 July 2013. http://news.yahoo.com/tropic-bird-goes-astray-sparks-nm-birding-frenzy-073710442.html


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!