Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

Range Description

This species has an extremely large range, breeding from European Russia in the west to Japan and northern Siberia in the East. During winter, birds occur throughout Indonesia, the Philippines, Papua New Guinea and in northern and eastern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S Himalayas to s China and Taiwan; winters to Indonesia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subspecies and Distribution:


    * saturatus Blyth, 1843 - Kashmir through S Himalayas, Assam, N & E Myanmar (including Shan States) and Thailand to S China and Taiwan; winters from Malaysia and Philippines S to Lesser Sundas, New Guinea and Australia. * lepidus S. Müller, 1845 - Peninsular Malaysia, Sumatra (and satellite islands), Borneo, Java, Bali and Lesser Sundas (Lombok, Sumbawa, Flores, Pantar, Sumba, Timor).


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Cuculus saturatus saturatus
Catalog Number: USNM A14018
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): T. Peale
Year Collected: 1842
Locality: Mangsi Island, Balabac Strait, Balabac Island, Palawan Province, Palawan, Philippines, Asia
  • Type: Peale. 1848. U.S. Exploring Expedition. 8 (mamm. and orn.): 136, pl. xxxvii, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species lives in a range of forest types.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Insect, mainly caterpillars, greeshoppers, crickets, cicadas, beetles, flies and ants, fruit and the shoots and needles of pines

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Season coincides with that of theri warbler host. In India in May and June. In Nepal from March to August.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cuculus saturatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cuculus optatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACTTAATCTTTGGTGCTTGAGCCGGTATGGTAGGAACAGCCCTGAGCCTACTTATTCGTGCAGAACTAGGACAACCAGGAACCCTCCTCGGAGACGACCAAATCTACAATGTAATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATCATAATTGGAGGATTCGGAAACTGACTAGTCCCGCTTATAATTGGTGCCCCAGACATAGCATTCCCACGCATGAACAACATGAGCTTCTGACTTCTCCCCCCATCCTTCTTACTCTTACTAGCCTCTTCAACAGTAGAAGCAGGAGCAGGAACCGGATGAACAGTATACCCCCCATTAGCCGGCAACTTAGCCCACGCCGGAGCATCAGTAGACCTAGCCATCTTCTCCCTACACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATCAACTTCATCACAACAGCCATCAACATAAAACCTCCCGCACTGTCTCAATACCAAACACCCCTATTCGTATGATCAGTACTTATCACCGCCGTCCTACTCCTATTATCCCTACCCGTACTAGCCGCCGGTATCACGATACTACTAACAGATCGCAACCTAAACACCACATTCTTCGACCCAGCAGGAGGAGGTGACCCCGTATTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTCTACATCCTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cuculus optatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, though in Europe, the breeding population is estimated to number 250,000-500,000 breeding pairs, equating to 750,000-1,500,000 individuals (BirdLife International 2004), with Europe forming <5% of the global range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Himalayan cuckoo

The Himalayan cuckoo (Cuculus saturatus) is a species of cuckoo in the genus Cuculus. It breeds from the Himalayas eastward to southern China and Taiwan. It migrates to southeast Asia and the Greater Sunda Islands for the winter.

It was formerly known as "Oriental cuckoo" and contained several subspecies found over most of Asia. In 2005, it was determined that this "species" consists of three distinct lineages:

These are usually seen as distinct species nowadays. As the type specimen of the former "Oriental" cuckoo is a bird of the Himalayan population, the name saturatus applies to the Himalayan cuckoo if it is considered a species.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!