Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

Range

S Himalayas to s China and Taiwan; winters to Indonesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widespread, breeding in the Himalayas from northern Pakistan through Nepal and northern India to South-East Asia, southern China, Taiwan and Hainan (Payne 2005). Birds migrate through South-East Asia and winter in Indonesia and the Philippines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species has an extremely large range, breeding from Finland in the west to Japan and northern Siberia in the East. During winter, birds occur throughout Indonesia, the Philippines, Papua New Guinea and in northern and eastern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Cuculus saturatus saturatus
Catalog Number: USNM A14018
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): T. Peale
Year Collected: 1842
Locality: Mangsi Island, Balabac Strait, Balabac Island, Palawan Province, Palawan, Philippines, Asia
  • Type: Peale. 1848. U.S. Exploring Expedition. 8 (mamm. and orn.): 136, pl. xxxvii, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species lives in a range of forest types at high densities of c.1 calling male per km2 on the breeding grounds (Payne 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species lives in a range of forest types.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cuculus optatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACTTAATCTTTGGTGCTTGAGCCGGTATGGTAGGAACAGCCCTGAGCCTACTTATTCGTGCAGAACTAGGACAACCAGGAACCCTCCTCGGAGACGACCAAATCTACAATGTAATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATCATAATTGGAGGATTCGGAAACTGACTAGTCCCGCTTATAATTGGTGCCCCAGACATAGCATTCCCACGCATGAACAACATGAGCTTCTGACTTCTCCCCCCATCCTTCTTACTCTTACTAGCCTCTTCAACAGTAGAAGCAGGAGCAGGAACCGGATGAACAGTATACCCCCCATTAGCCGGCAACTTAGCCCACGCCGGAGCATCAGTAGACCTAGCCATCTTCTCCCTACACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATCAACTTCATCACAACAGCCATCAACATAAAACCTCCCGCACTGTCTCAATACCAAACACCCCTATTCGTATGATCAGTACTTATCACCGCCGTCCTACTCCTATTATCCCTACCCGTACTAGCCGCCGGTATCACGATACTACTAACAGATCGCAACCTAAACACCACATTCTTCGACCCAGCAGGAGGAGGTGACCCCGTATTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTCTACATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cuculus optatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cuculus saturatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2007
    Least Concern
  • 2004
    Not Recognized
  • 2000
    Not Recognized
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2007
    Least Concern
  • 2004
    Not Recognized
  • 2000
    Not Recognized
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but is thought to be large as the species is described as 'common and widespread' in at least parts of its range (Payne 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified. In Europe, the breeding population is estimated to number 250,000-500,000 breeding pairs, equating to 750,000-1,500,000 individuals (BirdLife International 2004), but Europe forms <5% of the global range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Himalayan Cuckoo

The Himalayan Cuckoo (Cuculus saturatus) is a species of cuckoo in the genus Cuculus. It breeds from the Himalayas eastward to southern China and Taiwan. It migrates to southeast Asia and the Greater Sunda Islands for the winter.

It was formerly known as "Oriental Cuckoo" and contained several subspecies found over most of Asia. In 2005, it was determined that this "species" consists of three distinct lineages:

These are usually seen as distinct species nowadays. As the type specimen of the former "Oriental" Cuckoo is a bird of the Himalayan population, the name saturatus applies to the Himalayan Cuckoo if it is considered a species.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!