Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Many people know that the cuckoo doesn't breed its own eggs. The female lays her eggs in the nest of other species, often times the meadow pipit, dunnock, sedge warbler, wagtail or the common redstart. These small birds brood the eggs and take care of the young cuckoos, which don't take long to grow bigger than their foster parents. Should they have any foster sisters or brothers, the cuckoo makes sure that they disappear. Adult cuckoos migrate to their winter homes starting in June. The young leave in August to tropical Africa. They have to figure out the route by themselves since they have never even seen their true parents. Cuckoos eat caterpillars. Even the hairy caterpillars which other birds avoid are eaten by the cuckoo. They merely spit out the hairs as a pellet. Furthermore, the bird gladly eats other insects such as beetles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The cuckoo is the only 'brood parasite' to breed in Britain (3). Individual females prefer certain foster birds, and lay eggs that closely mimic those of the foster species, 50 of which are known (3). A female will establish a territory encompassing a number of potential foster nests, and carefully observe activity, waiting until the nests are at the right stage. She then swiftly takes her chance, swooping down, ejecting an egg and laying one of her own (3). The unsuspecting host bird then incubates and feeds the impostor, who removes other eggs and young from the nest and often grows much larger than its foster parent (3). Female cuckoos usually lay fewer than 12 eggs in 12 different host nests each year (3). Cuckoos feed mainly on insects, spiders and worms (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A well-known harbinger of spring, the arrival of the cuckoo in Britain is eagerly awaited each April (3). Adult males have bluish-grey upperparts and a white belly with dark barring. Females occur in two forms, one is similar to the male but the breast is buff coloured with dark barring; the other form is reddish brown, and often wholly covered with dark bars (2). Juveniles are slate-grey with touches of reddish-brown (2). The familiar call 'cuck-oo, cuck-oo' is imitated by the common name; later in the year females produce a 'bubbling' call (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 32-34 cm, envergure 55-60 cm, poids 95-140 g.

Étant une espèce parasite de nombreux passereaux, il occupe des milieux aussi variés que ses hôtes, évitant seulement les zones très urbanisées. L’habitat est largement déterminé par le choix de la principale espèce hôte à parasiter pour l’élevage du jeune. La forte mobilité et la voix puissante du Coucou compensent ses faibles densités. Les femelles partagent des sites alimentaires où les chenilles sont abondantes ; le ou les territoires de ponte peuvent en être éloignés de plusieurs kilomètres. En plus des ressources alimentaires et des populations d’espèces hôtes, de nombreux perchoirs sont requis (arbres, rochers, poteaux et fils téléphoniques, etc.) : ils servent de postes de chant et d’observation, permettant la surveillance des étapes de la nidification des futurs hôtes.

Le Coucou gris se nourrit presque exclusivement d’insectes et notamment de chenilles, y compris les nombreuses espèces grégaires, velues et vivement colorées, évitées par la plupart des autres oiseaux. Les coléoptères arrivent en second dans son alimentation.

Mâle et femelle produisent des cris nuptiaux différents mais susceptibles d’attirer un partenaire. Lorsqu’elle est prête à pondre, celle-ci localise les nids à parasiter par des observations prolongées. Sur les sites pauvres en perchoirs, il semble qu’elle utilise un vol semblable à celui de l’Épervier pour provoquer une réaction des autres espèces et faciliter ainsi le repérage. Elle pond un unique œuf après en avoir dérobé un ou plusieurs. Son œuf est remarquablement petit par rapport à sa propre taille, facilitant ainsi le mimétisme au sein de la couvée parasitée. Le poussin du Coucou éclôt normalement avant ceux de l’espèce parasitée, probablement grâce à une préincubation dans l’oviducte de sa mère. Encore aveugle, il évacue les autres occupants, aidé en cela par le creux qu’il possède entre les épaules. Le jeune Coucou est ensuite nourri par ses parents adoptifs, et ce jusqu’à 6 semaines après avoir quitté le nid.

La ponte est déposée dans le nid d’autres espèces. La date varie selon le calendrier de ponte de ces dernières ; elle débute généralement fin avril. Chaque femelle Coucou pond tous ses œufs – ou la plus grande part – dans les nids d’une seule espèce. Elle dépose en tout une dizaine d’œufs (maximum 25). Plus de 100 espèces parasitées (Sylvidés, Turdidés…) sont répertoriées en Europe. L’incubation dure 12 jours et le jeune est volant à l’âge de 19 jours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Common cuckoos are found throughout the Old World, from Spain to Japan. Western populations migrate south to sub-Saharan Africa during the winter, eastern populations to the Philippine Islands and southeast Asia.

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native )

  • Gooders, J. 1982. Collins British Birds. London: William Collins Sons & Co Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Arrives in Britain during the second part of April from Africa south of the Sahara, and leaves in September (2). It is widespread in Britain and breeds throughout Europe, reaching as far east as Japan (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Cuculus canorus is approximately 33 cm in length. Adult males are generally gray above, including the throat and breast, while the underparts are white with close black bars. The tail, which is long and graduated, is black with white spots. The cuckoo has short legs and a non-hooked bill. A noticeable feature of C. canorus is that it has very pointed wings. The adult females are occasionally brown above, white below, and barred black. The juvenile cuckoos resemble the rare brown phase of the female. Juveniles are brown, barred, and have a white patch on the back of the neck. The voicing of C. canorus differs between males and females. The males have an unmistakable coocoo call, while the females have a babbling call. (Hammond and Everett 1980; Heinzel and Fitter 1972; Bruun 1970)

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 111.6 g.

Average basal metabolic rate: 0.838 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cuculus canorus can live almost anywhere, ranging from heaths and forests, to farmlands, open moorlands and marshes. (Hammond and Everett 1980; Gooders 1982)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occupies a broad variety of habitats, including all types of woodland, marshes, heaths and alpine areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

This cuckoo is an insectivore, eating mainly insects and their larvae. Hairy caterpillars, which are rejected by most birds, are eaten by C. canorus. The cuckoo is not poisoned after eating the caterpillar because before eating it, the cuckoo will bite one end of the caterpillar, slice the caterpillar using its beak, then shake the insect at one end until the toxic contents are released.

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Cuculus canorus preys on:
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
12.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Cuculus canorus is a brood parasite. The female cuckoo lays her egg in the nest of another species. The cuckoo egg closely resembles the egg of the host species' egg. The eggs of cuckoos are either spotted or solid in color, depending upon the color of the host species' egg. The egg mimicry is an adaptation to parasitism. When the host species leaves the nest unattended, the female cuckoo removes one of the host's eggs from the nest, then lays her own before the host returns. The cuckoo egg is incubated for about 12 ½ days and usually hatches before the host eggs. Once the cuckoo has hatched, it will eject the other eggs or young so that it will receive all the food brought by the "foster parents." The young cuckoo is fed and brooded by the host for 20- 23 days, and grows several times larger than the hosts. (Campbell and Lack 1985; Gooders 1982)

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cuculus canorus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACTCTATACTTAATCTTTGGTGCTTGAGCCGGTATGGTAGGAACAGCCCTGAGCCTACTTATTCGTGCAGAACTAGGACAACCAGGAACCCTCCTCGGAGACGACCAAATCTACAATGTAATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATCATAATTGGAGGATTCGGAAACTGACTAGTCCCACTTATAATTGGTGCCCCAGACATAGCATTCCCACGCATAAACAACATGAGCTTCTGACTTCTCCCCCCATCCTTCTTACTCTTACTAGCCTCTTCAACAGTAGAAGCGGGAGCAGGAACCGGATGAACAGTATACCCCCCATTAGCCGGCAACTTAGCCCACGCCGGGGCATCAGTAGACCTAGCCATCTTCTCCCTACACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATCAACTTCATCACAACAGCCATCAACATAAAACCTCCCGCACTGTCCCAATACCAAACACCCCTATTCGTATGATCAGTACTTATCACCGCCGTCCTACTCCTATTGTCCCTACCCGTACTAGCCGCCGGTATCACGATACTACTAACAGATCGCAATCTAAACACCACATTCTTCGACCCAGCAGGAGGAGGTGACCCCGTATTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cuculus canorus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5