Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Many people know that the cuckoo doesn't breed its own eggs. The female lays her eggs in the nest of other species, often times the meadow pipit, dunnock, sedge warbler, wagtail or the common redstart. These small birds brood the eggs and take care of the young cuckoos, which don't take long to grow bigger than their foster parents. Should they have any foster sisters or brothers, the cuckoo makes sure that they disappear. Adult cuckoos migrate to their winter homes starting in June. The young leave in August to tropical Africa. They have to figure out the route by themselves since they have never even seen their true parents. Cuckoos eat caterpillars. Even the hairy caterpillars which other birds avoid are eaten by the cuckoo. They merely spit out the hairs as a pellet. Furthermore, the bird gladly eats other insects such as beetles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The cuckoo is the only 'brood parasite' to breed in Britain (3). Individual females prefer certain foster birds, and lay eggs that closely mimic those of the foster species, 50 of which are known (3). A female will establish a territory encompassing a number of potential foster nests, and carefully observe activity, waiting until the nests are at the right stage. She then swiftly takes her chance, swooping down, ejecting an egg and laying one of her own (3). The unsuspecting host bird then incubates and feeds the impostor, who removes other eggs and young from the nest and often grows much larger than its foster parent (3). Female cuckoos usually lay fewer than 12 eggs in 12 different host nests each year (3). Cuckoos feed mainly on insects, spiders and worms (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A well-known harbinger of spring, the arrival of the cuckoo in Britain is eagerly awaited each April (3). Adult males have bluish-grey upperparts and a white belly with dark barring. Females occur in two forms, one is similar to the male but the breast is buff coloured with dark barring; the other form is reddish brown, and often wholly covered with dark bars (2). Juveniles are slate-grey with touches of reddish-brown (2). The familiar call 'cuck-oo, cuck-oo' is imitated by the common name; later in the year females produce a 'bubbling' call (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Common cuckoos are found throughout the Old World, from Spain to Japan. Western populations migrate south to sub-Saharan Africa during the winter, eastern populations to the Philippine Islands and southeast Asia.

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native )

  • Gooders, J. 1982. Collins British Birds. London: William Collins Sons & Co Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Arrives in Britain during the second part of April from Africa south of the Sahara, and leaves in September (2). It is widespread in Britain and breeds throughout Europe, reaching as far east as Japan (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Cuculus canorus is approximately 33 cm in length. Adult males are generally gray above, including the throat and breast, while the underparts are white with close black bars. The tail, which is long and graduated, is black with white spots. The cuckoo has short legs and a non-hooked bill. A noticeable feature of C. canorus is that it has very pointed wings. The adult females are occasionally brown above, white below, and barred black. The juvenile cuckoos resemble the rare brown phase of the female. Juveniles are brown, barred, and have a white patch on the back of the neck. The voicing of C. canorus differs between males and females. The males have an unmistakable coocoo call, while the females have a babbling call. (Hammond and Everett 1980; Heinzel and Fitter 1972; Bruun 1970)

Average mass: 111.6 g.

Average basal metabolic rate: 0.838 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cuculus canorus can live almost anywhere, ranging from heaths and forests, to farmlands, open moorlands and marshes. (Hammond and Everett 1980; Gooders 1982)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occupies a broad variety of habitats, including all types of woodland, marshes, heaths and alpine areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This cuckoo is an insectivore, eating mainly insects and their larvae. Hairy caterpillars, which are rejected by most birds, are eaten by C. canorus. The cuckoo is not poisoned after eating the caterpillar because before eating it, the cuckoo will bite one end of the caterpillar, slice the caterpillar using its beak, then shake the insect at one end until the toxic contents are released.

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Cuculus canorus preys on:
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
12.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Cuculus canorus is a brood parasite. The female cuckoo lays her egg in the nest of another species. The cuckoo egg closely resembles the egg of the host species' egg. The eggs of cuckoos are either spotted or solid in color, depending upon the color of the host species' egg. The egg mimicry is an adaptation to parasitism. When the host species leaves the nest unattended, the female cuckoo removes one of the host's eggs from the nest, then lays her own before the host returns. The cuckoo egg is incubated for about 12 ½ days and usually hatches before the host eggs. Once the cuckoo has hatched, it will eject the other eggs or young so that it will receive all the food brought by the "foster parents." The young cuckoo is fed and brooded by the host for 20- 23 days, and grows several times larger than the hosts. (Campbell and Lack 1985; Gooders 1982)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cuculus canorus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACTCTATACTTAATCTTTGGTGCTTGAGCCGGTATGGTAGGAACAGCCCTGAGCCTACTTATTCGTGCAGAACTAGGACAACCAGGAACCCTCCTCGGAGACGACCAAATCTACAATGTAATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATCATAATTGGAGGATTCGGAAACTGACTAGTCCCACTTATAATTGGTGCCCCAGACATAGCATTCCCACGCATAAACAACATGAGCTTCTGACTTCTCCCCCCATCCTTCTTACTCTTACTAGCCTCTTCAACAGTAGAAGCGGGAGCAGGAACCGGATGAACAGTATACCCCCCATTAGCCGGCAACTTAGCCCACGCCGGGGCATCAGTAGACCTAGCCATCTTCTCCCTACACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATCAACTTCATCACAACAGCCATCAACATAAAACCTCCCGCACTGTCCCAATACCAAACACCCCTATTCGTATGATCAGTACTTATCACCGCCGTCCTACTCCTATTGTCCCTACCCGTACTAGCCGCCGGTATCACGATACTACTAACAGATCGCAATCTAAACACCACATTCTTCGACCCAGCAGGAGGAGGTGACCCCGTATTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cuculus canorus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

A widespread summer visitor (3). Included in the Birds of Conservation Concern Amber List (medium conservation concern) (6) and protected at all times under the Wildlife and Countryside Act 1981 (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 4200000-8600000 breeding pairs, equating to 12600000-25800000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 25000000-100000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The Breeding Bird Survey (BBS) has shown that the population of the cuckoo in Britain has declined steadily; this is thought to be due to a decrease in populations of key host species such as meadow pipit and dunnock (5), probably due to habitat-related factors (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No specific conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Cuckoo

The Common Cuckoo (Cuculus canorus) (formerly European Cuckoo) is a member of the cuckoo order of birds, Cuculiformes, which includes the roadrunners, the anis and the coucals.

This species is a widespread summer migrant to Europe and Asia, and winters in Africa. It is a brood parasite, which means it lays eggs in the nests of other bird species, particularly of Dunnocks, Meadow Pipits, and Eurasian Reed Warblers.

Contents

Taxonomy [edit]

The Common Cuckoo (formerly European Cuckoo) is a member of the cuckoo order of birds, the Cuculiformes, which also includes the roadrunners, the anis and the coucals.[1] The species' binomial name is derived from the Latin cuculus (the cuckoo) and canorus (melodious; from canere, meaning to sing).[2] The cuckoo family gets its common name and genus name by onomatopoeia for the call of the male Common Cuckoo.[3] The English word "cuckoo" comes from the Old French cucu and it first appears about 1240[4] in the poem Sumer Is Icumen In - "Summer has come in / Loudly sing, Cuckoo!" in modern English.

There are four subspecies worldwide:[5]

Lifespan and demography [edit]

Although the Common Cuckoo's global population appears to be declining, it is classified of being of Least Concern by the International Union for Conservation of Nature. It is estimated that the species numbers between 25 million and 100 million individuals worldwide, with around 12.6 million to 25.8 million of those birds breeding in Europe.[1] The maximum recorded lifespan of a Common Cuckoo in the United Kingdom is 6 years, 11 months and 2 days.[2]

Description [edit]

Common Cuckoo in flight

The Common Cuckoo is 32–34 centimetres (13–13 in) long from bill to tail (with a tail of 13–15 centimetres (5.1–5.9 in) and a wingspan of 55–60 centimetres (22–24 in).[3] The legs are short.[6] It is greyish with a slender body and long tail and can be mistaken for a falcon in flight, where the wingbeats are regular. During the breeding season, Common Cuckoos often settle on an open perch with drooped wings and raised tail.[6] There is a rufous colour morph, which occurs occasionally in adult females but more often in juveniles.[3]

All adult males are slate-grey; the grey throat extends well down the bird's breast with a sharp demarcation to the barred underparts.[7] The iris, orbital ring, the base of the bill and feet are yellow.[6] Grey adult females have a pinkish-buff or buff background to the barring and neck sides, and sometimes small rufous spots on the median and greater coverts and the outer webs of the secondary feathers.[7]

Rufous morph adult females have reddish-brown upperparts with dark grey or black bars. The black upperpart bars are narrower than the rufous bars, as opposed to rufous juvenile birds, where the black bars are broader.[7]

Common Cuckoos in their first autumn have variable plumage. Some are have strongly-barred chestnut-brown upperparts, while others are plain grey. Rufous-brown birds have heavily-barred upperparts with some feathers edged with creamy-white. All have whitish edges to the upper wing-coverts and primaries. The secondaries and greater coverts have chestnut bars or spots. In spring, birds hatched in the previous year may retain some barred secondaries and wing-coverts.[7] The most obvious identification features of juvenile Common Cuckoos are the white nape patch and white feather fringes.[6]

Common Cuckoos moult twice a year: a partial moult in summer and a complete moult in winter.[7] Males weigh around 130 grams (4.6 oz) and females 110 grams (3.9 oz).[2] The Common Cuckoo looks very similar to the Oriental Cuckoo, which is slightly shorter-winged on average.[7]

Photo of Sparrowhawk and cuckoo, looking similar
Cuckoo adult mimics Sparrowhawk, giving female time to lay eggs parasitically

A study using stuffed bird models found that small birds are less likely to approach Common Cuckoos that have barred underparts similar to the Eurasian Sparrowhawk, a predatory bird. Eurasian Reed Warblers were found more aggressive to cuckoos that looked less hawk-like, meaning that the resemblance to the hawk helps the cuckoo to access the nests of potential hosts.[8]

Hosts attack cuckoos more when they see neighbors mobbing cuckoos.[9] The existence of the two plumage morphs in females may be due to frequency-dependent selection if this learning applies only to the morph hosts see neighbors mob. In an experiment with dummy cuckoos of each morph and a sparrowhawk, reed warblers were more likely to attack both cuckoo morphs than the sparrowhawk, and even more likely to mob a certain cuckoo morph when they saw neighbors mobbing that morph, decreasing the reproductive success of that morph and selecting for the less common morph.[9]

The male's call, goo-ko, is usually given from an open perch. During the breeding season the male typically gives this call with intervals of 1–1.5 seconds, in groups of 10–20 with a rest of a few seconds between groups. The female has a loud bubbling call.[3] The song starts as a descending minor third early in the year in April, and the interval gets wider, through a major third to a fourth as the season progresses, and in June the cuckoo "forgets its tune" and may make other calls such as ascending intervals. Also the cuckoo seems to have a form of absolute pitch as it tends to sing in the key of C.[10]

Distribution and habitat [edit]

Essentially a bird of open land, the Common Cuckoo is a widespread summer migrant to Europe and Asia, and winters in Africa. Birds arrive in Europe in April and leave in September.[6]

The Common Cuckoo has also occurred as a vagrant in countries including Barbados, the United States of America, Greenland, the Faroe Islands, Iceland, Indonesia, Palau, Seychelles, Taiwan and China.[1]

Behaviour [edit]

Food and feeding [edit]

The Common Cuckoo's diet consists of insects, with hairy caterpillars, which are distasteful to many birds, being a specialty of preference. It also occasionally eats eggs and chicks.

Breeding [edit]

This Eurasian Reed Warbler is raising a Common Cuckoo.

The Common Cuckoo is a brood parasite; it lays its eggs in the nests of other birds. At the appropriate moment, the hen cuckoo flies down to the host's nest, pushes one egg out of the nest, lays an egg and flies off. The whole process takes about 10 seconds. A female may visit up to 50 nests during a breeding season. Common Cuckoos first breed at two years old.[2]

Eggs [edit]

More than 100 host species have been recorded: Meadow Pipit, Dunnock and Eurasian Reed Warbler are the most common hosts in northern Europe; Garden Warbler, Meadow Pipit, Pied Wagtail and European Robin in central Europe; Brambling and Common Redstart in Finland; and Great Reed Warbler in Hungary.[3]

Female Common Cuckoos are divided into gentes – populations favouring a particular host species' nest and laying eggs that match those of that species in color and pattern. Evidence from mitochondrial DNA analyses suggest that each gene may have multiple independent origins due to parasitism of specific hosts by different ancestors.[11] One hypothesis for the inheritance of egg appearance mimicry is that this trait is inherited from the female only, suggesting that it is carried on the sex-determining W chromosome (females are WZ, males ZZ). A genetic analysis of gentes supports this proposal by finding significant differentiation in mitochondrial DNA, but not in microsatellite DNA.[11] A second proposal for the inheritance of this trait is that the genes controlling egg characteristics are carried on autosomes rather than just the W chromosome. Another genetic analysis of sympatric gentes supports this second proposal by finding significant genetic differentiation in both microsatellite DNA and mitochondrial DNA.[12] Considering the tendency for Common Cuckoo males to mate with multiple females and produce offspring raised by more than one host species, it appears as though males do not contribute to the maintenance of Common Cuckoo gentes. However, it was found that only nine percent of offspring were raised outside of their father's presumed host species.[12] Therefore, both males and females may contribute to the maintenance of Common Cuckoo egg mimicry polymorphism.[11][12] It is notable that most non-parasitic cuckoo species lay white eggs, like most non-passerines other than ground-nesters.

photo of box of cuckoo and reed warbler eggs
Cuckoo eggs mimicking smaller eggs, in this case of Reed Warbler

As the Common Cuckoo evolves to lay eggs that better imitate the host's eggs, the host species adapts and is more able to distinguish the cuckoo egg. A study of 248 Common Cuckoo and host eggs demonstrated that female cuckoos that parasitised Common Redstart nests laid eggs that matched better than those that targeted Dunnocks. Spectroscopy was used to model how the host species saw the cuckoo eggs. Cuckoos that target Dunnock nests lay white, brown-speckled eggs, in contrast to the Dunnock's own blue eggs. The theory suggests that Common Redstarts have been parasitised by Common Cuckoos for longer, and so have evolved to be better than the Dunnocks at noticing the cuckoo eggs.[13]

Studies were made of 90 Great Reed Warbler nests in central Hungary. There was an "unusually high" frequency of Common Cuckoo parasitism, with 64% of the nests parasitised. Of the nests targeted by cuckoos, 64% contained one cuckoo egg, 23% had two, 10% had three and 3% had four Common Cuckoo eggs. In total, 58% of the Common Cuckoo eggs were laid in nests that were multiply parasitised. When laying eggs in nests already parasitised, the female cuckoos removed one egg at random, showing no discrimination between the Great Reed Warbler eggs and those of other cuckoos.[14]

It was found that nests close to cuckoo perches were most vulnerable: multiple parasitised nests were closest to the vantage points, and unparasitised nests were farthest away. Nearly all the nests "in close vicinity" to the vantage points were parasitised. More visible nests were more likely to be selected by the Common Cuckoos. Female cuckoos use their vantage points to watch for potential hosts and find it easier to locate the more visible nests while they are egg-laying.[15]

The Great Reed Warblers' responses to the Common Cuckoo eggs varied: 66% accepted the egg(s); 12% ejected them; 20% abandoned the nests entirely; 2% buried the eggs. 28% of the cuckoo eggs were described as "almost perfect" in their mimesis of the host eggs, and the warblers rejected "poorly mimetic" cuckoo eggs more often. The degree of mimicry made it difficult for both the Great Reed Warblers and the observers to tell the eggs apart.[14]

The egg measures 22 by 16 millimetres (0.87 in × 0.63 in) and weighs 3.2 grams (0.11 oz), of which 7% is shell.[2] Research has shown that the female Common Cuckoo is able to keep its egg inside its body for an extra 24 hours before laying it in a host's nest. This means the cuckoo chick can hatch before the host's chicks do, and it can eject the unhatched eggs from the nest. Scientists incubated Common Cuckoo eggs for 24 hours at the bird's body temperature of 40 °C (104 °F), and examined the embryos, which were found "much more advanced" than those of other species studied. The idea of 'internal incubation' was first put forward in 1802 and 18th and 19th Century egg collectors had reported finding that cuckoo embryos were more advanced than those of the host species.[16]

Chicks [edit]

A Chick of the Common Cuckoo in the nest of a Tree Pipit

The naked, altricial chick hatches after 11–13 days.[2] It methodically evicts all host progeny from host nests. It is a much larger bird than its hosts, and needs to monopolize the food supplied by the parents. The chick will roll the other eggs out of the nest by pushing them with its back over the edge. If the host's eggs hatch before the cuckoo's, the cuckoo chick will push the other chicks out of the nest in a similar way. At 14 days old, the Common Cuckoo chick is about three times the size of an adult Eurasian Reed Warbler.

The necessity of eviction behavior is unclear. One hypothesis is that competing with host chicks leads to decreased cuckoo chick weight, which is selective pressure for eviction behavior. An analysis of the amount of food provided to common cuckoo chicks by host parents in the presence and absence of host siblings showed that when competing against host siblings, cuckoo chicks did not receive enough food, showing an inability to compete.[17] Selection pressure for eviction behavior may come from cuckoo chicks lacking the correct visual begging signals, hosts distributing food to all nestlings equally, or host recognition of the parasite.[17][18] Another hypothesis is that decreased cuckoo chick weight is not selective pressure for eviction behavior. An analysis of resources provided to cuckoo chick in the presence and absence of host siblings also showed that the weights of cuckoos raised with host chicks were much smaller upon fledging than cuckoos raised alone, but within 12 days cuckoos raised with siblings grew faster than cuckoos raised alone and made up for developmental differences, showing a flexibility that would not necessarily select for eviction behavior.[19]

Species whose broods are parasitised by the Common Cuckoo have evolved to discriminate against cuckoo eggs but not chicks.[20] Experiments have shown that Common Cuckoo chicks persuade their host parents to feed them by making a rapid begging call that sounds "remarkably like a whole brood of host chicks." The researchers suggested that "the cuckoo needs vocal trickery to stimulate adequate care to compensate for the fact that it presents a visual stimulus of just one gape."[18] However, a cuckoo chick needs the amount of food of a whole brood of host nestlings, and it struggles to elicit that much from the host parents with only the vocal stimulus. This may reflect a tradeoff – the cuckoo chick benefits from eviction by receiving all the food provided, but faces a cost in being the only one influencing feeding rate. For this reason, cuckoo chicks exploit host parental care by remaining with the host parent longer than host chicks do, both before and after fledging.[18]

Common Cuckoo chicks fledge about 17–21 days after hatching,[2] compared to 12–13 days for Eurasian Reed Warblers.[21] If the hen cuckoo is out-of-phase with a clutch of Eurasian Reed Warbler eggs, she will eat them all so that the hosts are forced to start another brood.

The Common Cuckoo's behaviour was firstly observed and described by Aristotle and the combination of behaviour and anatomical adaptation by Edward Jenner, who was elected as Fellow of the Royal Society in 1788 for this work. It was first documented on film in 1922 by Edgar Chance and Oliver G Pike, in their film 'The Cuckoo's Secret'.[22]

A study in Japan found that young Common Cuckoos probably acquire species-specific feather lice from body-to-body contact with other cuckoos between the time of leaving the nest and returning to the breeding area in spring. A total of 21 nestlings were examined shortly before they left their hosts' nests and none carried feather lice. However, young birds returning to Japan for the first time were found just as likely as older individuals to be lousy.[23]

In culture [edit]

  • In Europe, hearing the call of the Common Cuckoo is regarded as the first harbinger of spring. Many local legends and traditions are based on this. In Scotland, a number of Gowk Stones exist, sometimes associated with the arrival of the first cuckoo of spring. "Gowk" is an old name for the Common Cuckoo in northern England,[4] derived from a harsh repeated "gowk" call the bird makes when excited.[3]
  • The well-known cuckoo clock features a mechanical bird and is fitted with bellows and pipes that imitate the call of the Common Cuckoo.
  • Common Cuckoos feature in a number of traditional rhymes. For instance,
'"In April the cuckoo comes, In May she'll stay, In June she changes her tune, In July she prepares to fly, Come August, go she must,"' quoted Peggy. 'But you haven't said it all,' put in Bobby. '"And if the cuckoo stays till September, It's as much as the oldest man can remember."'[24]

References [edit]

  1. ^ a b c d BirdLife International (2012). "Cuculus canorus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f g Robinson, R. A. (2005). "Cuckoo Cuculus canorus". BirdFacts: Profiles of Birds Occurring in Britain & Ireland. British Trust for Ornithology. BTO Research Report 407. Retrieved 12 August 2011. 
  3. ^ a b c d e f Snow, D. W.; Perrins, C. (1997). The Birds of the Western Palearctic (Abridged ed.). Oxford University Press. ISBN 0-19-854099-X. 
  4. ^ a b Lockwood, W. B. (1993). The Oxford Dictionary of British Bird Names. Oxford University Press. ISBN 978-0-19-866196-2. 
  5. ^ "Common Cuckoo (Cuculus canorus)". Internet Bird Collection. Lynx Edicions. Retrieved 20 August 2011. 
  6. ^ a b c d e Mullarney, K.; Svensson, L.; Zetterstrom, D.; Grant, P. (1999). Collins Bird Guide. HarperCollins. pp. 204–205. ISBN 0-00-219728-6. 
  7. ^ a b c d e f Baker, K. (1993). Identification Guide to European Non-Passerines. British Trust for Ornithology. pp. 273–275. ISBN 0-903793-18-0. BTO Guide 24. 
  8. ^ Welbergen, J.; Davies, N. B. (2011). "A parasite in wolf's clothing: hawk mimicry reduces mobbing of cuckoos by hosts". Behavioral Ecology 22 (3): 574–579. doi:10.1093/beheco/arr008. 
  9. ^ a b Thorogood, R.; Davies, N. B. (2012). "Cuckoos combat socially transmitted defenses of reed warbler hosts with a plumage polymorphism". Science 337: 578–580. doi:10.1126/science.1220759. 
  10. ^ Barrett, M. (1897). "The Cuckoo's Notes". The Musical Times and Singing Class Circular 38 (656): 697. doi:10.2307/3367962. JSTOR 3367962. 
  11. ^ a b c Gibbs, H. L.; Sorenson, M. D.; Marchetti, K.; Brooke, M. D.; Davies, N. B.; Nakamura, H. (2000). "Genetic evidence for female host-specific races of the common cuckoo". Nature 407: 183–186. doi:10.1038/35025058. 
  12. ^ a b c Fossoy, B. G.; Antonov, A.; Moksnes, A.; Roskfaft, E.; Vikan; Moller, A. P.; Shykoff, J. A.; Stokke (2011). "Genetic differentiation among sympatric cuckoohost races: Males matter". Proceedings of the Royal Society B 278: 1639–1645. doi:10.1098/rspb.2010.2090.  More than one of |first1= and |first= specified (help)
  13. ^ Brennand, E. (24 March 2011). "Cuckoo in egg pattern 'arms race'". BBC News. Retrieved 22 August 2011. 
  14. ^ a b Moskát, C.; Honza, M. (2002). "European Cuckoo Cuculus canorus parasitism and host's rejection behaviour in a heavily parasitized Great Reed Warbler Acrocephalus arundinaceus population". Ibis 144 (4): 614–622. doi:10.1046/j.1474-919X.2002.00085.x. 
  15. ^ Moskát, C.; Honza, M. (2000). "Effect of nest and nest site characteristics on the risk of cuckoo Cuculus canorus parasitism in the great reed warbler Acrocephalus arundinaceus". Ecography 23 (3): 335–341. doi:10.1111/j.1600-0587.2000.tb00289.x. 
  16. ^ Moskvitch, K. (24 September 2010). "Extra incubation time lets cuckoo chicks pop out early". BBC News. Retrieved 22 August 2011. 
  17. ^ a b Martín-Gálvez, D.; Soler, M.; Soler, J. J.; Martín-Vivaldi, M.; Palomino, J. J. (2005). "Food acquisition by common cuckoo chicks in rufous bush robin nests and the advantage of eviction behaviour". Animal Behavior 70: 1313–1321. doi:10.1016/j.anbehav.2005.03.031. 
  18. ^ a b c Davies, N. B.; Kilner, R. M.; Noble, D. G. (1998). "Nestling cuckoos, Cuculus canorus, exploit hosts with begging calls that mimic a brood". Proceedings of the Royal Society B 265 (1397): 673–678. doi:10.1098/rspb.1998.0346. PMC 1689031. 
  19. ^ Geltsch, N.; Hauber, M. E.; Anderson, M. G.; Ban, M.; Moskát, C. (2012). "Competition with a host nestling for parental provisioning imposes recoverable costs on parasitic cuckoo chick's growth". Behavioural Processes 90: 378–383. 
  20. ^ Davies, N. B.; de L. Brooke, M. (1989). "An experimental study of co-evolution between the Cuckoo, Cuculus canorus, and its hosts. II. Host egg markings, chick discrimination and general discussion". Journal of Animal Ecology 58 (1): 225–236. JSTOR 4996. 
  21. ^ Robinson, R. A. (2005). "Reed Warbler Acrocephalus scirpaceus". BirdFacts: Profiles of Birds Occurring in Britain & Ireland. British Trust for Ornithology. BTO Research Report 407. Retrieved 12 August 2011. 
  22. ^ "Oliver Pike". WildFilmHistory. Retrieved 25 September 2010. 
  23. ^ de L. Brooke, M.; Nakamura, H. (1998). "The acquisition of host-specific feather lice by common cuckoos (Cuculus canorus)". Journal of Zoology 244 (2): 167–173. doi:10.1111/j.1469-7998.1998.tb00022.x. 
  24. ^ Brazil, Angela (1915). A Terrible Tomboy. Project Gutenberg EBook #38619. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!