Overview

Brief Summary

Biology

This goose feeds on aquatic vegetation and grasses. It has become an agricultural pest in some areas where it moves from water bodies to fields in order to feed (3). Although often aggressive, this goose is gregarious, occurring in flocks during winter and breeding colonially on larger water bodies (5). The nest, a down-lined scrape, is typically situated among vegetation (5). During early April between 5 and 6 (up to 11) white eggs are laid. The female incubates the eggs for 28-30 days, while the male guards the nest close-by (5). Both sexes care for the young, which fledge after around 9 weeks, and stay with the parents throughout the winter (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

The Canada goose was introduced to England around 300 years ago. It is now the most familiar goose in Britain (3). This large goose has a long black neck, and a black head with a prominent white patch, which forms a strap around the throat that extends onto the face (2). The body is brown, with paler underparts. The sexes are similar in appearance; juveniles can be identified as the throat-strap is brownish, and the head and neck are duller (2). This vocal goose produces a range of deep honking calls (2), a loud 'aa-honk' in flight and hissing sounds when threatened (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Branta canadensis

The Canada Goose is the goose species most familiar to people living across much of North America, often occurring in large numbers in lakes and parks near cities and towns. This large goose may be anywhere from 30 to 43 inches long with a large body and short tail. Canada Geese may be identified by their brown backs, pale bellies, black necks, and large white “chinstrap. ” Male and female Canada Geese are similar to one another in all seasons. The Canada Goose breeds widely across North America. Migratory breeding populations breed across Canada and winter in the northern half of the United States, while many populations living in human-altered environments are non-migratory. The Canada Goose has also been introduced in Britain, Ireland, and portions of western continental Europe. Wild-type Canada Geese breed in lakes and freshwater marshes, wintering in similar habitats. Non-migratory Canada Geese are habitat generalists, living in ponds and lakes as well as human-altered environments (including golf courses, city parks, and reservoirs). This species subsists primarily on plant matter, including aquatic vegetation and terrestrial grasses. Canada Geese are often present in large numbers where ducks and other waterfowl are fed by humans. Canada Geese may be best observed foraging for food; both on land, where they may be seen walking on the shore or on grass further inland; or in the water, where they may be seen submerging their upper bodies to seek out aquatic vegetation. They may also be observed in the in large “V”-shaped flocks flying on migration or between bodies of water. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Characteristics

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeds from central and southeastern Alaska east across northern Canada and southern Victoria Island to western Melville Peninsula, northeastern Manitoba, northern Ontario, northern Quebec, and southern Baffin Island (recently naturally established in western Greenland) south to southwestern British Columbia, northeastern California, northern Utah, south-central Wyoming, South Dakota, Kansas, northern Arkansas, western Kentucky, southern Ohio, Pennsylvania, northern Virginia, and Maryland. Breeding populations in the southern prairie states were extirpated, but many have become reestablished. Birds in eastern states south of Great Lakes and Massachusetts result from relatively recent natural southward extension of breeding range and to great extent from introductions. Feral populations resulting from introductions may occur almost anywhere in the United States (AOU 2004).

Winters from the southern part of the breeding range through most of the United States and into northern Mexico. Introduced and established in Great Britain, Iceland, southern Scandinavia, and New Zealand. Accidental in Hawaii, Greater Antilles, and the Bahamas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Canada Geese are found throughout North America. There are four subspecies (or populations); each is found in a different area of North America. These subspecies are the southern, northern, western and Aleutian-Canadian populations. The southern population ranges from 60 degrees north latitude to the Rockies and Atlantic Ocean. The northern population ranges north of 60 degrees north latitude in the Arctic and Subarctic. Canada geese travel to the southern parts of the United States during the winter. The western population is found along the coasts of Alaska and British Columbia. The Aleutian-Canadian population is rarely found. A general trend in all subspecies is that they they spend summers in the northern parts of North America, especially Canada, and migrate south to areas of the United States in the winter months.

Biogeographic Regions: nearctic (Native )

  • Ogilvie, M. 1978. Wild Geese. Vermillion, SD: Buteo Books.
  • Owen, M. 1980. Wild Geese of the World: Their Life History and Ecology. London: BT Batsford Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

This species has a large range, breeding across tundra in much of Canada, Alaska, U.S.A., and parts of the northern U.S.A., and wintering in southern North America, including Mexico. Introduced populations are now resident in much of the U.S.A. south of the normal breeding range, as well as in a number of western European countries. The subspecies asiatica, which occurred in the Bering Sea region, has been extinct since around 1914 (Fuller 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Canada Geese are found in the Nearctic region throughout North America. There are four sub-species (or populations) found in different areas of North America. These sub-species are the southern, northern, western and Aleutian-Canadian populations. The southern population ranges from 60 degrees north latitude to the Rocky Mountains and Atlantic Ocean. The northern population ranges north of 60 degrees north latitude in the Arctic and Subarctic. The western population is found along the coasts of Alaska and British Columbia. The Aleutian-Canadian population is rarely found.

All subspecies spend summers in the northern parts of North America, especially Canada, and migrate south to areas of the United States in the winter months.

Biogeographic Regions: nearctic (Native )

  • Ogilvie, M. 1978. Wild Geese. Vermillion, SD: Buteo Books.
  • Owen, M. 1980. Wild Geese of the World: Their Life History and Ecology. London: BT Batsford Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Canada goose is widely distributed throughout North America; it
occurs in or at least migrates through every state and province.
General distributions of each population during breeding and wintering
seasons are given below [1,14,15]:

B. c. moffitti - breeds from central Alberta and British Columbia south to
the central northwestern states; winters in the Southwest
B. c. canadensis - breeds on Baffin Island, Labrador, Newfoundland,
Anticosti Island, and the Magdalen Islands;
winters in New England and the Maritime Provinces
B. c. interior - breeds in Quebec, Ontario, Manitoba; winters in the
Midwest and from Delaware to North Carolina
B. c. occidentalis - breeds on Prince William Sound, Cook Inlet;
winters from Washington to California
B. c. fulva - breeds and winters along coast of Alaska and British
Columbia
B. c. maxima - breeds and winters on refuges in the farm belt states,
typically Oklahoma and Kansas
B. c. taverneri - breeds throughout interior Alaska; winters from
Washington to California
B. c. hutchinsii - breeds on western Baffin Island and surrounding islands;
winters on the North Platte River in Nebraska and in
Oklahoma and Texas
B. c. parvipes - breeds from central Alaska across northern Canada;
winters in the same areas as B. c. hutchinsii
B. c. leucopareira - breeds on the Aleutian Islands; winters from
Washington to California
B. c. minima - breeds along coastal Alaska; winters from Washington
to California
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 14. Johnsgard, Paul A. 1975. Waterfowl of North America. Bloomington, IN: Indiana University Press. 575 p. [19985]
  • 15. Krohn, W. B.; Bizeau, E. G. 1980. The Rocky Mountain population of the western Canada goose: its distribution, habitats and management. Special Scientific Report 229. Washington, DC: U.S. Fish and Wildlife Service. 93 p. [19909]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY
AB BC MB NB NF NT NS ON PE PQ
SK YT MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

After its introduction as an ornamental species, the Canada goose did not spread away from parks and stately homes until after the Second World War (3). It has since increased greatly in numbers, and its range has expanded throughout Britain (3), although it is not as common in Scotland and Wales (5). Its natural range occurs throughout Canada and northern USA. It has also been introduced to Ireland, Sweden, Finland and Norway (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Branta canadensis individuals have a black neck, bill, and head with a white strap under the chin and occasional white patches elsewhere. The body is usually brownish-gray although colors vary in some of the subspecies. In some of the smaller subspecies the body is dark brown in color where as in some of the larger subspecies, the body is a light gray tone. Underneath, the colors are much lighter and almost white on the tail. During flight the tail shows a white semi-circle just above the black tail. Females may be slightly smaller than males, although both are similar to each other in color pattern. The bill of Branta canadensis tapers from the base where it is high to the end where it has narrowed. The bill has lamellae, or teeth around the outside that are a used as a cutting tool. The legs are close together with very black feet. These geese have very large wings (127 to 173 cm wingspan) that can also be used as weapons. The weight of Branta canadensis varies depending on the subspecies.

Goslings (young Canada geese) are yellow with some greenish-gray colorings on top of their heads and backs. As with the adult color pattern, there is some variation among the different subspecies. Goslings of the darker subspecies have a brownish olive or blunt yellow coloring while those of the lighter subspecies are lighter and brighter in color. These colors fade as the gosling grows into the adult color pattern. All goslings have black or blue-gray bills and legs that become darker as they age.

Range mass: 1100 to 8000 g.

Range length: 90 to 200 cm.

Range wingspan: 127 to 173 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Robbins, C., B. Bruun, H. Zim. 2001. A guide to field identification: Birds of North America. New York: St. Martin's Press.
  • Kortright, F. 1942. The Ducks, Geese and Swans of North America. Washington, DC: The American Wildlife Institute.
  • Van Wormer, J. 1968. The World of the Canadian Goose. Philadelphia: Lippincott.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Canada geese have black necks, bills, and heads with a white strap under their chins and occasional white patches on other parts of their body. The body of Canada geese is usually brownish-gray although subspecies have slightly different colors. In some of the smaller subspecies the body is dark brown in color whereas, in some of the larger subspecies, the body is a light gray. The subspecies also differ in their average weights. Underneath, the colors are much lighter and almost white on the tail. During flight the tail shows a white semi-circle just above the black tail. Females look similar to males, but may be slightly smaller.

Canada geese have strong, tapered bills that are bordered with lamellae. Lamellae are teeth-like projections of the bill that are used to cut vegetation. Their feet are black. These geese have large wings that can be used as weapons by thrashing them at intruders. The wingspan of Canada geese ranges from 127 to 173 cm.

Goslings, or young Canada geese, are yellow with some greenish-gray coloring on top of their heads and backs. Goslings in different subspecies are slightly differently colored. Goslings of the darker subspecies have a brownish olive or blunt yellow coloring while those of the lighter subspecies are lighter and brighter in color. These colors fade as the gosling grows into the adult color pattern. All goslings have black or blue-gray bills and legs that become darker as they age.

Range mass: 1100 to 8000 g.

Range length: 90 to 200 cm.

Range wingspan: 127 to 173 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Robbins, C., B. Bruun, H. Zim. 2001. A guide to field identification: Birds of North America. New York: St. Martin's Press.
  • Kortright, F. 1942. The Ducks, Geese and Swans of North America. Washington, DC: The American Wildlife Institute.
  • Van Wormer, J. 1968. The World of the Canadian Goose. Philadelphia: Lippincott.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 114 cm

Weight: 4741 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the brant (BRANTA BERNICLA) in having a broad white chin strap rather than a small whitish patch on either side of the neck. Differs from the barnacle goose (BRANTA LEUCOPSIS) by the lack of a mostly white face and by having plain dark wings instead of blue-gray upperparts barred with black (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Canada Geese are found near waterways in open, grassy habitats such as grasslands, chaparral, and arctic tundra. They also inhabit man-made habitats that are open and grassy, such as golf courses, agricultural land, airports, and parks.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: tundra ; savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

swamps, marshes, meadows, lakes and shorelines
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Various habitats near water, from temperate regions to tundra. In migration and winter, coastal and freshwater marshes, lakes, rivers, fields, etc. On Admiralty Island, Alaska, commonly perches in trees. In the eastern U.S., common on lawns adjacent to water in urban-suburban areas.

Breeds in open or forested areas near lakes, ponds, large streams, inland and coastal marshes. The nest is built on the ground or on an elevated place (muskrat house, abandoned heron's nest, rocky cliffs, etc.) (Terres 1980). Usually returns to nesting territory used in previous year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Canada Geese are found near waterways in open, grassy habitats such as grasslands, chaparral, and arctic tundra. They also inhabit man-made habitats that are open and grassy, such as golf courses, agricultural land, airports, and parks.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: tundra ; savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, shrub

Because Canada geese nest in a wide variety of sites, their cover
requirements are not very specialized or specific. Nesting sites that
offer good visibility of the surrounding area, protection from
predators, and are fairly close to the water (within 1 to 94 meters) are
usually adequate enough to support a viable population of geese [4,19].
It is possible that fidelity to nesting sites is so strong that the type
of cover chosen, whether shrub or grassland, is almost irrelevent in
parts of Alaska [3]. Instead, nesting success may depend heavily on the
absence of predators.
  • 3. Campbell, Bruce H. 1990. Factors affecting the nesting success of dusky Canada geese, B. c. occidentalis, on the Copper River Delta, Alaska. Canadian Field-Naturalist. 104(4): 567-574. [19904]
  • 4. Cooper, James A. 1978. The history and breeding biology of the Canada geese of Marshy Point, Manitoba. Wildlife Monographs No. 61. Washington, DC: The Wildlife Society. 87 p. [18122]
  • 19. Petersen, Margaret R. 1990. Nest-site selection by emperor geese and cackling Canada geese. Wilson Bulletin. 102)3_: 413-426. [19910]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: tundra

Canada geese occupy a variety of habitats and have diverse nesting
habits. They will usually return to the same nesting spots every year.
The northern populations breed by open tundra, while southern
populations breed near lakes or rivers and forests or open land [17].
Tundra nesters prefer firm ground on small islands surrounded by open
water with good visibility to detect predators [14]. Canada geese
prefer to nest on dry ground but near water and feeding areas. In some
areas reeds are preferred for nesting while bulrush is used more
frequently in others [14]. Canada geese can nest on the ground; on
muskrat lodges; in old nests of eagles, herons, and osprey; on cliffs or
haystacks; or on nesting platforms [1,17]. They also frequent
agricultural land, inland or coastal marshes, and gravel pits.
Reservoirs and lakes surrounded by grasslands and agricultural land are
the most important breeding grounds for western Canada geese in southern
Alberta [15]. This same population uses rivers, reservoirs, and
impoundments in Montana; and marshes, river islands, flooded
bottomlands, and reservoirs in Idaho [15].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 14. Johnsgard, Paul A. 1975. Waterfowl of North America. Bloomington, IN: Indiana University Press. 575 p. [19985]
  • 15. Krohn, W. B.; Bizeau, E. G. 1980. The Rocky Mountain population of the western Canada goose: its distribution, habitats and management. Special Scientific Report 229. Washington, DC: U.S. Fish and Wildlife Service. 93 p. [19909]
  • 17. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

K038 Great Basin sagebrush
K047 Fescue - oatgrass
K048 California steppe
K049 Tule marshes
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K056 Wheatgrass - needlegrass shrubsteppe
K063 Foothills prairie
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K070 Sandsage - bluestem prairie
K071 Shinnery
K072 Sea oats prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem - sacahuista prairie
K078 Southern cordgrass prairie
K090 Live oak - sea oats

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES17 Elm-ash-cottonwood
FRES19 Aspen-birch
FRES28 Western hardwoods
FRES29 Sagebrush
FRES31 Shinnery
FRES32 Texas savanna
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

Canada geese primarily use wetland areas dominated by emergent
vegetation such as cattail (Typha spp.), bulrush (Scirpus spp.), sedge
(Carex spp.), and reed (Phragmites spp.). They also inhabit communities
dominated by prostrate willow (Salix spp.), dwarf birch (Betula nana),
and Labrador tea (Ledum palustre) [1,19].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 19. Petersen, Margaret R. 1990. Nest-site selection by emperor geese and cackling Canada geese. Wilson Bulletin. 102)3_: 413-426. [19910]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

16 Aspen
217 Aspen
222 Black cottonwood - willow

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 886 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 5.940 - 13.008
  Nitrate (umol/L): 2.446 - 3.533
  Salinity (PPS): 30.572 - 33.176
  Oxygen (ml/l): 6.169 - 7.377
  Phosphate (umol/l): 0.377 - 0.659
  Silicate (umol/l): 1.811 - 6.162

Graphical representation

Temperature range (°C): 5.940 - 13.008

Nitrate (umol/L): 2.446 - 3.533

Salinity (PPS): 30.572 - 33.176

Oxygen (ml/l): 6.169 - 7.377

Phosphate (umol/l): 0.377 - 0.659

Silicate (umol/l): 1.811 - 6.162
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Britain, the Canada goose can be found on ornamental lakes, as well as ponds and flooded grasslands (5) and reservoirs, gravel pits, canal and river banks (6). In North America it inhabits lakes and marshes in wooded areas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Found year-round in central part of range. Flocks of family groups migrate together.

The percentage of the population wintering in the north is now higher than in the past, due at least in part to increased availability of planted corn. A large percentage of geese that spend a winter in the Carolinas winter in more northerly locations (e.g., Chesapeake) in subsequent winters (Ecology 72:523).

Some western geese, mainly prebreeders and unsuccessful nesters, make molt migrations to and from molting areas during and after the brood-rearing season; apparently, molters of Pacific and Rocky Mountain populations that leave those regions go to the Northwest Territories of Canada (Krohn and Bizeau 1980). See Johnson and Herter (1989) for information on migration of various subspecies.

In the Mississippi Valley population, fall and spring migration is concentrated in a corridor in central Illinois and southeastern Wisconsin; a major spring staging area is the Kaskaskia River Valley in central Illinois; chronology of departure from wintering areas and of fall migration vary annually (Tacha et al. 1991). See Samuel et al. (1991) for information on fall and winter distribution in the Mississippi Flyway.

Atlantic Flyway population consists of migrant geese and a resident population which generally migrates only short distances; migrant population breeds primarily in Labrador, northern Quebec, and James Bay area and winters south to North Carolina, western Pennsylvania, the western Carolinas, and Mississippi Flyway states.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

When on land, Branta canadensis eat a variety of grasses including Bermuda grass, salt grass and wild barley. Geese are able to grab a hold of each blade and pull it out with their bills by jerking their heads. They also eat wheat, beans, rice, and corn. In the water, the birds stick their head and upper part of their body into the water leaving their tail and back end extending in the air. They stretch their neck out, under the water, and slide their bills across the bottom silt. They also eat a number of aquatic plants such as eel grass, sea lettuce and sago.

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; algae

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Grazes on marsh grasses, sprouts of winter wheat (spring), grain (fall); eats clover, cattails, bulrushes, algae, pond- weed, and other plants. Feeds in shallows, marshes, fields. Also eats mollusks and small crustaceans (Terres 1980). Subspecies OCCIDENTALIS of west coastal North America: exogenous sources of lipid and protein are important to energy and nutrient requirements of nesting geese (Condor 95:193-210).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

When on land, Canada geese eat a variety of grasses including Bermuda grass, salt grass, and wild barley. Geese are able to grab hold of each blade and pull it out with their bills by jerking their heads. They also eat wheat, beans, rice, and corn. In the water, the birds stick their head and upper part of their body into the water leaving their tail and back end extending in the air. They stretch their neck out, under the water, and slide their bills across the bottom silt. They also eat a number of aquatic plants such as eel grass, sea lettuce, and sago.

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; algae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Canada geese eat roots, tubers, and leaves of various food plants which
are usually locally abundant. Some foods include cordgrass (Spartina
spp.), saltgrass (Distichlis spp.), pondweed (Potamogeton spp.), wigeon
grass (Ruppia spp.), bulrush, sedge, cattail, glasswort (Salicornia
spp.), spikerush (Eleocharis spp.), giant burreed (Sparganium
eurycarpum), smartweed (Polygonum spp.), common harnwort (Ceratophyllum
demersum), clover (Trifolium spp.), brome (Bromus spp.), foxtail
(Alopecurus spp.), orchardgrass, bluegrass (Poa spp.), fescue (Festuca
spp.), horsetail (Equisetum spp.), and bird's foot trefoil (Lotus
corniculatus) [1,14]. Canada geese also consume a lot of crops such as
alfalfa (Medicago sativa), corn (Zea mays), millet, rye (Secale spp.),
barley (Hordeus spp.), sorghum (Sorghum spp.), oats (Avena spp.), and
wheat (Triticum spp.) [1,6].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 6. Craven, Scott R. 1984. Fall food habits of Canada geese in Wisconsin. Journal of Wildlife Management. 48(1): 169-173. [19906]
  • 14. Johnsgard, Paul A. 1975. Waterfowl of North America. Bloomington, IN: Indiana University Press. 575 p. [19985]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

As well as dispersing the seeds of the plants they eat, Canada Geese are important prey for many predators in the ecosystems in which they live.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unguarded nests and eggs are targets for predators such as gulls, common ravens, American crows, skunks, domestic dogs, and many others. Males send out an alarm by flying into the air and honking as a predator approaches. This alerts not only his mate but others nesting nearby. Females lower their bodies onto the nest and stretch out their necks to camouflage the nest.

Canada geese are also a common game bird, hunted regularly by humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

As well as dispersing the seeds of the plants they eat, Canada Geese are important prey for many predators in the ecosystems in which they live.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Unguarded nests and eggs are targets for predators such as Laricidae, Corvus corax, Corvus brachyrhynchos, Mephitis mephitis, Canis lupus familiaris, and many others. Males send out an alarm by flying into the air and honking as a predator approaches. This alerts not only his mate but others nesting nearby. Females lower their bodies onto the nest and stretch out their necks to camouflage the nest.

Canada geese are also a common game bird, hunted regularly by humans.

Known Predators:

  • gulls (Laridae)
  • common ravens (Corvus_corax)
  • American crows (Corvus_brachyrhynchos)
  • striped skunks (Mephitis_mephitis)
  • domestic dogs (Canis_lupus_familiaris)
  • humans (Homo_sapiens)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Canada goose predators include humans; ravens,crows, and magpies
(Corvidae); gulls (Larus spp.); parasitic jaeger (Stercorarius
parasitucus); foxes (Vulpes, Urocyon, Aplex); brown bear (Ursus arctos);
coyote (Canis latrans); raccoon (Procyon lotor); badger (Taxidea taxus);
and bobcat (Felis rufus) [3,13].
  • 3. Campbell, Bruce H. 1990. Factors affecting the nesting success of dusky Canada geese, B. c. occidentalis, on the Copper River Delta, Alaska. Canadian Field-Naturalist. 104(4): 567-574. [19904]
  • 13. Hanson, W. C.; Eberhardt, L. L. 1971. A Columbia River Canada goose population, 1950-1970. Wildlife Monographs No. 28. Washington, DC: The Wildlife Society. 61 p. [18164]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Branta canadensis is prey of:
Laridae
Corvus corax
Corvus brachyrhynchos
Homo sapiens
Mephitis mephitis
Canis lupus familiaris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Branta canadensis preys on:
algae
Larus californicus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Mean annual survival rate for Rocky Mountain birds banded on nesting areas: 53% for immatures, 64% for adults (Krohn and Bizeau 1980).

In winter, flocks foraged up to 48 km from roost in Texas (Glazener 1946).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

No specific information on Canada goose behavior or activity following
fire has been found. However, fire is used frequently to rejuvenate
southern marshes for waterfowl [12]. In Louisiana late winter marsh
fires provide early spring food for geese when they need it the most.
Shallow marshes and low ridges can be burned in early fall to provide
winter foods that continue to grow throughout the winter [12]. For more
specific information about the effects of fire on plants important to
Canada geese consult this database under the genera Phragmites, Scirpus,
Carex, and Typha.
  • 12. Givens, Lawrence S. 1962. Use of fire on southeastern wildlife refuges. In: Proceedings, 1st annual Tall Timbers fire ecology conference; 1962 March 1-2; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 121-126. [19344]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Pair Data - usually monogamous for life; faithful to natal areas
Nesting season - March through June
Clutch - four to six eggs; may renest if first clutch is destroyed
Incubation - varies between populations; 24 to 29 days
Fledge - varies with populations; 42 to 86 days
[1,14,15]
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 14. Johnsgard, Paul A. 1975. Waterfowl of North America. Bloomington, IN: Indiana University Press. 575 p. [19985]
  • 15. Krohn, W. B.; Bizeau, E. G. 1980. The Rocky Mountain population of the western Canada goose: its distribution, habitats and management. Special Scientific Report 229. Washington, DC: U.S. Fish and Wildlife Service. 93 p. [19909]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Canada geese have good eyesight, which is necessary for flight. They must move their heads in order to see all the way around themselves. However, their eyes are close to their crowns on the side of their heads, enabling them to see more than 180 degrees (closer to 270 degrees) horizontally and vertically. They have mostly monocular vision. Canada geese have excellent hearing and the ears are located on the side of its head. Canada geese often use body movements to communicate with each other. These geese also have the ability to make at least 10 different calls

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

variety of grasses, wheat, beans, rice and corn and aquatic plants
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Canada geese have good eyesight, which is necessary for flight. They must move their heads in order to see all the way around themselves. However, their eyes are close to their crowns on the side of their heads, enabling them to see more than 180 degrees (closer to 270 degrees) horizontally and vertically. They have mostly monocular vision. Canada geese have excellent hearing and the ears are located on the side of its head. Canada geese often use body movements to communicate with each other. These geese also have the ability to make at least 10 different calls

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: May be active day or night during migration. Usually feeds in early morning and late afternoon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

It is not clear exactly how long the average Canada goose can live, but there have been two geese that were reported to have lived very long lives. One of them lived to be 24 years old and another reached 23. In captivity, two geese were reported to live to 42 years old. Probably most Canada geese die within their first year of life, as nestlings, fledglings, and during their first migration.

Range lifespan

Status: wild:
24 (high) years.

Range lifespan

Status: captivity:
42 (high) years.

Average lifespan

Status: wild:
364 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

It is not clear exactly how long the average Canada goose can live, but there have been two geese that were reported to have lived very long lives. One of them lived to be 24 years old and another reached 23. In captivity, two geese were reported to live to 42 years old. Probably most Canada geese die within their first year of life, as nestlings, fledglings, and during their first migration.

Range lifespan

Status: wild:
24 (high) years.

Range lifespan

Status: captivity:
42 (high) years.

Average lifespan

Status: wild:
364 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 42 years Observations: One anecdotal report indicated an animal that lived 80 years in captivity (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Canada geese are monogamous. Pairs form during the winter, during migration or on their wintering grounds, for the next breeding season. Mated pairs may stay together for more than one year, sometimes staying together for life.

Males fight over females with their wings and bills. The winner approaches the female with his head down and neck undulating. He makes hissing and honking noises. The pairs mate either before or after they have found a nesting location. Mating, occurs in the spring on the water. The female is usually partially submerged or completed submerged while copulation takes place.

Mating System: monogamous

The average clutch size is five eggs, although this size ranges from 2 to 9 eggs. The incubation period lasts 23 to 30 days.

Females incubate the eggs, choose the location for nesting, and even build the nest without males. Males defend the territory, nest, and eggs from intruders, such as other geese. Female Canada geese pick nesting sites that are isolated but have good visibility. This allows them to readily see danger approaching and to be difficult to get at. The nesting area also must have open water with low banks so they can have access to water plants and places to get into or out of the water. Swamps, marshes, meadows, lakes, and other such areas are among some of their favorite nesting spots. The Canadian and Alaskan shorelines have expanses of tundra habitat that provide good nesting sites. Canada geese are often seen nesting on small islands that don't have very tall grasses or on muskrat houses (which are similar to small islands).

Nests are very simple and are made quickly. Materials that are used are weeds, twigs, grass, moss, needles, and other such materials. After some collection and building, female geese round out a curve or depression with their bodies. They drop the materials around themselves and move the items to get the best fit. From time to time they round out the center with their chests or feet. If there are no items of vegetation the nest may only be a depression in the ground shaped by their chests and feet. Once the eggs are laid, the nest is lined with feathers and down. Down insulates against extreme warmth as well as cold, stabilizing egg temperature.

Incubation must occur immediately after the last eggs are laid. The incubation period lasts 23 to 30 days. The female turns the eggs regularly to promote proper development and changes their position in the nest to maintain even incubation temperatures. The offspring hatches via an egg tooth on top of its beak to crack open the shell. Goslings keep cracking open the shells until they are completely free between 24 and 48 hours later. All of the eggs in the clutch are fully hatched within 24 hours. Goslings within a clutch usually have a sex ratio of 1:1. Hatchlings fledge in 68 to 78 days after hatching.

Breeding interval: Canada geese breed once yearly.

Breeding season: Females start laying eggs during the first weeks of March and continue as late as June in parts of the Arctic.

Range eggs per season: 2 to 9.

Average eggs per season: 5.

Range time to hatching: 23 to 30 days.

Range fledging age: 68 to 78 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 5.

After the eggs hatch, the family group (the offspring and parents) leave the nest and begin to travel together to feed and seek shelter. Both males and females feed and guard their young. Upon hatching, young Canada geese are able to follow their parents around and leave the nest.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster.
  • Van Wormer, J. 1968. The World of the Canadian Goose. Philadelphia: Lippincott.
  • 1998. "Canada Geese (*Branta canadensis*)" (On-line). Accessed March 12, 2000 at http://www.rhrwildlife.com/cgee.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size 2-11 (usually 5-6). Incubation 25-30 days, by female (Harrison 1978). Nestlings precocial. Young tended by both adults, remain with adults until next spring. Some individuals begin breeding at 2 years, most by age 3 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Canada geese are monogamous, one female and one male mate. Pairs form during the winter, during migration or on their wintering grounds, for the next breeding season. Mated pairs may stay together for more than one year, sometimes staying together for life.

Males fight over females with their wings and bills. The winner approaches the female with his head down and neck undulating. He makes hissing and honking noises. The pairs mate either before or after they have found a nesting location.

Mating System: monogamous

The average clutch sizes are 5 eggs although this size ranges from 2 to 9 eggs. The incubation period lasts 23 to 30 days. Incubation must occur immediately after the last eggs are laid.

Females choose the location for nesting and even build the nest without the males. The males defend the territory, nest, and eggs from intruders, such as other geese. Female Canada geese pick nesting sites that have good visibility but are isolated. This allows them to readily see danger approaching and to be difficult to get at. The nesting area also must have open water with low banks so they can have access to water plants and places to get into or out of the water. Swamps, marshes, meadows, lakes, and other such areas are among some of their favorite nesting spots. The Canadian and Alaskan shorelines have expanses of tundra habitat that provide good nesting sites. Canada Geese are are often seen nesting on small islands that don't have very tall grasses or on muskrat houses (which are similar to small islands).

Nests are very simple and are made quickly. Materials that are used are weeds, twigs, grass, moss, needles, and other such materials. After some collection and building, female geese round out a curve or depression with their bodies. They drop the materials around themselves and move the items to get the best fit. From time to time they round out the center with their chests or feet. If there are no items of vegetation the nest may only be a depression in the ground shaped by their chests and feet. Once the eggs are laid, the nest is lined with feathers and down. Down insulates against extreme warmth as well as cold, stabilizing egg temperature.

Females have to leave the nest to eat, rest, swim, and preen. Young geese hatch with the use of an egg tooth on top of its beak to crack open the shell. Goslings keep cracking open the shells until they are completely free between 24 and 48 hours later. All of the eggs in the clutch are fully hatched with in 24 hours. The goslings with in a clutch usually have a gender ratio that is equally males and females.

Breeding interval: Canada geese breed once yearly.

Breeding season: Females start laying eggs during the first weeks of March and continue as late as June in parts of the Arctic.

Range eggs per season: 2 to 9.

Average eggs per season: 5.

Range time to hatching: 23 to 30 days.

Range fledging age: 68 to 78 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

After the eggs hatch, the family group (the offspring and parents) leave the nest and begin to travel together to feed and seek shelter. Both males and females feed and guard their young. Upon hatching, young Canada geese are able to follow their parents around and leave the nest.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster.
  • Van Wormer, J. 1968. The World of the Canadian Goose. Philadelphia: Lippincott.
  • 1998. "Canada Geese (*Branta canadensis*)" (On-line). Accessed March 12, 2000 at http://www.rhrwildlife.com/cgee.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Feather structure insulates: Canada goose
 

Down feathers of geese insulate through special architecture.

   
  "Feather keratin occurs in a 'b-sheet' configuration which differs from the a-helices that occur in mammalian keratins. . . We have measured the properties of individual down feathers from ducks, geese and penguins and found that their properties are similar to flight feathers and, indeed, the man-made polymers used in artificial insulation fibres. The message is that the architecture of down feathers is probably more important than material properties in determining their advantages over synthetic materials. . .Recently, we have begun to explore the toughness of feather keratin by using instrumented clippers and scissors. The fracture toughness of β-keratin has proved to be very high, around 10 kJ m-2." (Bonser 2007)
  Learn more about this functional adaptation.
  • Cameron, G. J.; Wess, T. J.; Bonser, R. H. C. 2003. Young’s modulus varies with differential orientation of keratin in feathers. Journal of Structural Biology. 143(2): 118-123.
  • Bonser, Richard. 2008. Mechanical properties of keratin.
    http://www.rdg.ac.uk/biomim/personal/richard/keratin.htm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Branta canadensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 130 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTTTCTACTAACCACAAAGATATCGGCACCCTATACCTCATCTTCGGAGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTATTAATCCGCGCAGAACTAGGACAACCAGGGACTCTCCTAGGCGACGACCAAATTTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTTATAGTCATACCCATCATGATCGGAGGATTCGGCAACTGATTAGTACCCCTCATAATCGGCGCCCCCGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCACCATCATTCCTCTTACTACTAGCCTCATCCACTGTAGAAGCTGGCGCCGGTACAGGCTGAACTGTATACCCTCCCCTGGCAGGTAACCTCGCCCACGCCGGGGCTTCAGTAGACCTGGCTATTTTCTCGCTTCACTTAGCCGGTGTCTCCTCCATCCTTGGGGCCATCAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTGTTCGTCTGATCCGTCCTAATCACTGCCATCCTACTCCTCCTATCGCTCCCCGTACTCGCCGCCGGCATCACAATGCTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGGGGAGACCCAATCCTGTACCAGCACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTGATTCTGCCCGGATTCGGGATCATCTCACACGTAGTCACGTACTACTCAGGCAAAAAAGAACCTTTCGGCTATATGGGAATAGTCTGAGCCATACTATCCATCGGCTTCCTAGGATTCATCGTCTGAGCCCACCACATATTTACAGTAGGAATAGACGTTGATACCCGAGCCTACTTTACGTCAGCCACTATGATCATCGCCATCCCAACCGGAATCAAAGTATTTAGCTGACTAGCCACCCTGCACGGAGGAACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTTATCTTCCTATTTACCATTGGAGGACTGACAGGAATCGTCCTTGCAAACTCTTCCCTAGACATCGCCCTGCACGACACGTACTACGTAGTTGCCCACTTCCACTACGTCCTGTCCATGGGAGCCGTCTTTGCCATTCTAGCAGGATTTACCCACTGATTCCCGCTACTCACTGGATTCACTCTACATCAAACATGAGCGAAAGCCCACTTCGGAGTAATATTTACAGGAGTAAACCTAACGTTCTTCCCCCAACACTTCCTAGGCCTAGCAGGAATGCCCCGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACCGTTTCCTCCATCGGCTCCTTAATCTCAATAGTAGCCGTAATCATGCTAATATTCATCATCTGAGAGGCCCTCTCAGCTAAACGAAAAGTCCTACAACCAGAACTAACTGCCACAAACGTTGAATGAATCCACGGCTGCCCTCCTCCATACCACACTTTCGAGGAACCAGCCTTTGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Branta canadensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 132
Specimens with Barcodes: 427
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

In 1918 when the Migratory Bird Treaty was passed, spring shooting was prohibited in the United States and Canada. This regulated the hunting season to three and a half months of the year. The hunting regulations currently in place are for shooting season limits and bag limits in relation to the amount of birds currently in the population. A quota system was put in place in 1960 to regulate the number of geese shot in a given year.

One subspecies, Aleutian-Canadian Geese, were listed as endangered by the U.S. Fish and Wildlife Service in 1967. This was due to the introduction of a non-native arctic fox species to their nesting islands. They became predatory on the naturally defenseless geese. This introduction caused the population to decline to approximately 800 individuals. However, in 1990, due to increasing numbers, the U.S. Fish and Wildlife Service changed the listing to threatened. The state of Alaska also changed the species listing from endangered to a species of special concern. Aleutian-Canadian Geese are now recorded around 15,000 individuals and nesting on eight islands.

On the other hand, some populations have grown so numerous, there are many organizations who are trying to regulate the populations of these geese. They see this as necessary because if the goose population continues to rise at its current rate, they will present a very serious problem to their surrounding environment in only a few years. Other organizations believe that the methods and ideas of these organizations are cruel and unnecessary. These groups believe that the growing population is not nearly as threatening as some believe and that they are actually at great risk because of the excessive hunting and death by pesticides that geese populations experience.

US Migratory Bird Act: protected

US Federal List: threatened

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In 1918 when the Migratory Bird Treaty was passed, spring shooting was prohibited in the United States and Canada. This regulated the hunting season to three and a half months of the year. The hunting regulations currently in place are for shooting season limits and bag limits in relation to the amount of birds currently in the population. A quota system was put in place in 1960 to regulate the number of geese shot in a given year.

One subspecies, Aleutian-Canadian Geese, were listed as endangered by the U.S. Fish and Wildlife Service in 1967. This was due to the introduction of a non-native arctic fox species to their nesting islands. They became predatory on the naturally defenseless geese. This introduction caused the population to decline to approximately 800 individuals. However, in 1990, due to increasing numbers, the U.S. Fish and Wildlife Service changed the listing to threatened. The state of Alaska also changed the species listing from endangered to a species of special concern. Aleutian-Canadian Geese are now recorded around 15,000 individuals and nesting on eight islands.

On the other hand, some populations have grown so numerous, there are many organizations who are trying to regulate the populations of these geese. They see this as necessary because if the goose population continues to rise at its current rate, they will present a very serious problem to their surrounding environment in only a few years. Other organizations believe that the methods and ideas of these organizations are cruel and unnecessary. These groups believe that the growing population is not nearly as threatening as some believe and that they are actually at great risk because of the excessive hunting and death by pesticides that geese populations experience.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: threatened

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent
changes in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

None [21]
  • 21. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Widespread introduced species (3). Protected in close season. May be shot from 1 September to 31 January (to 20 February in areas below high water mark). General licence permits sale of captive-bred birds and their eggs (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
(Wetlands International 2006)

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Although hunting and other direct mortality takes a substantial toll, this species has increased its range and population since the 1940s (Mowbray et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Pesticide use is a potential threat; for example, 1600 died in a wheat field that had been sprayed with parathion (see Franson 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Methods for reducing goose problems on lawns include habitat modification (such as planting vegetation that reduces long-distance visibility or that interferes with take-offs or landings, draining bodies of water, or eliminating palatable vegetation), use of fear-provoking stimuli, and hunting (see Converse 1985, Conover and Chasko 1985, Conover 1991, and Conover and Kania 1991 for further information on resident nuisance geese in the northeastern U.S.). See Conover (1989) for information on the use of methiocarb to reduce damage to grain fields and winter cover crops. See Cummings et al. (1991) for information on the use of dimethyl anthranilate and methyl anthranilate to repell Canada geese from grassy areas. In Wisconsin, farmers rated mylar flags and human effigies as fully successful or at least helpful in reducing crop damage; Av-Alarm (a sonic deterrent) also was effective but not well accepted by farmers (Heinrich and Craven 1990). See Aguilar et al. (1991) for an evaluation of goose alarm or distress calls and screamer shells to disperse wintering urban geese.

See Reese et al. (1987) for recommendations on construction of artificial nesting islands.

Tacha et al. (1991) found no evidence to support the existence of manageable subpopulations in the Mississippi Valley population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Needs: Protect migratory population in Atlantic Flyway while reducing size of nuisance resident population (USFWS 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: cool-season, shrub, warm-season

Techniques for establishing grasslands for waterfowl in the prairie
pothole region have been described [7]. Fires are also recommended in
these areas to rejuvenate cool- and warm-season grasses. In central
North Dakota cool-season natives should be burned from late March to
mid-May or from mid-August to mid-September. Warm-season natives should
be burned from mid-May to mid-June [7]. Fire can also be used to
maintain grass/forb communities important to geese and prevent the
succession to shrub communities [18].
  • 7. Duebbert, Harold F.; Jacobson, Erling T.; Higgins, Kenneth F.; Podoll, Erling B. 1981. Establishment of seeded grasslands for wildlife habitat in the praire pothole region. Special Scientific Report-Wildlife No. 234. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 21 p. [5740]
  • 18. Miller, Howard A. 1963. Use of fire in wildlife management. In: Proceedings, 2d annual Tall Timbers fire ecology conference; 1963 March 14-15; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 19-30. [17921]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

Canada geese have become a nuisance in the Atlantic flyway states by
overrunning golf courses, beaches, parks, playing fields, and yards
[20]. A chemical repellant, methiocarb, has been applied to grass to
prevent geese from grazing some of these areas [5]. The methiocarb
makes the geese sick but so far has not proved fatal, although the toxic
effects are still under investigation. Canada geese have been killed in
great numbers (more than 200) from the application of the pesticide
parathion in Texas [10]. Golden and bald eagles (Aquila chrysaetos;
Haliaeetus leucocephalus) have been seen feeding on parathion-killed
carcasses. Parathion is widely used near Canada geese wintering grounds
in Texas. Crop depredation from grazing Canada geese is a problem in
the eastern states. Seeding rates of winter wheat can be increased by
34 to 68 kg/ha to compensate for reduced stem densities [9].
  • 5. Conover, Michael R. 1985. Alleviating nuisance Canada goose problems through methicarb-induced aversive conditioning. Journal of Wildlife Management. 49(3): 631-636. [19905]
  • 9. Flegler, Earl J, Jr.; Prince, Harold H.; Johnson, Wilbur C. 1987. Effects of grazing by Canada geese on winter wheat yield. Wildlife Society Bulletin. 15: 402-405. [19907]
  • 10. Flickinger, E. L.; Juenger, G.; Roffe, T. J.; [and others]
  • 20. Howard, R.; Moore, Alick. 1980. A complete checklist of the birds of the world. Oxford: Oxford University Press. 701 p. [24537]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Canada geese can become a nuisance, especially when normally migratory birds become resident. They can overgraze lawns and crops, leading to erosion. On lawns, their feces can annoy humans. Build-up of fecal matter can lead to reduced water quality, by fostering bacteria and adding much nitrogen and phosphorus.

Canada geese can be an exceptional annoyance in Atlantic flyway states by crowding in on golf courses, beaches, parks, playing fields, and yards. In the eastern states, Canada Geese have been very harmful to local crops and have forced farmers to plant a lot more winter wheat to compensate for the damage done by these geese.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Canada Geese have been hunted by humans for hundreds of years. Native Americans hunted them in the spring migration. Eskimos hunted them by taking advantage of the molt that leaves them flightless. Even early white settlers took advantage of these birds and hunted them for food. These birds are still being hunted today in the United States and Canada.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Sport hunting accounts for more than 86% of the mortality of fledged geese in Rocky Mountain region (Krohn and Bizeau 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Canada geese can be an exceptional annoyance in Atlantic flyway states by crowding on golf courses, beaches, parks, playing fields, and yards, where their buildup of droppings can be a health risk and change nearby water quality. In the eastern states, Canada Geese have been very harmful to local crops and have forced farmers to plant a lot more winter wheat to compensate for the damage done by these geese.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Canada Geese have been hunted by humans for hundreds of years. Native Americans hunted them in the spring migration. Eskimos hunted them by taking advantage of the molt that leaves them flightless. Even early white settlers took advantage of these birds and hunted them for food. These birds are still being hunted today in the United States and Canada.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Canada goose

For the outerwear manufacturer, see Canada Goose (clothing).

The Canada goose (Branta canadensis) is a goose with a black head and neck, white patches on the face, and a brown body. Native to arctic and temperate regions of North America, it also occasionally migrates to northern Europe, and has been introduced to Britain, New Zealand, Argentina, Chile, and the Falkland Islands.[2]

Extremely successful at living in human-altered areas, Canada geese have proven able to establish breeding colonies in urban and cultivated areas, which provide food and few natural predators, and are well known as a common park species. Their success has led to them sometimes being considered a pest species because of their depredation of crops and issues with their noise, droppings, and habit of begging for food, especially in their introduced range. Canada geese are also among the most commonly hunted waterfowl in North America.

Taxonomy and etymology[edit]

The Canada goose was one of the many species described by Carl Linnaeus in his 18th-century work Systema Naturae.[3] It belongs to the Branta genus of geese, which contains species with largely black plumage, distinguishing them from the grey species of the Anser genus. The specific epithet canadensis is a New Latin word meaning "from Canada". According to the Oxford English Dictionary, the first citation for the 'Canada goose' dates back to 1772.[4][5][6] The Canada goose is also colloquially referred to as the "Canadian goose".[7]

The cackling goose was originally considered to be the same species or a subspecies of the Canada goose, but in July 2004 the American Ornithologists' Union's Committee on Classification and Nomenclature split the two into two species, making cackling goose into a full species with the scientific name Branta hutchinsii. The British Ornithologists' Union followed suit in June 2005.[8]

The AOU has divided the many subspecies between the two species. The subspecies of the Canada goose were listed as:

  • Atlantic Canada goose, Branta canadensis canadensis
  • Interior Canada goose, Branta canadensis interior
  • Giant Canada goose, Branta canadensis maxima
  • Moffitt's Canada goose, Branta canadensis moffitti
  • Vancouver Canada goose, Branta canadensis fulva
  • Dusky Canada goose, Branta canadensis occidentalis
  • part of "lesser complex", Branta canadensis parvipes

The distinctions between the two geese have led to confusion and debate among ornithologists. This has been aggravated by the overlap between the small types of Canada goose and larger types of cackling goose. The old "lesser Canada goose" was believed to be a partly hybrid population, with the birds named taverneri considered a mixture of minima, occidentalis and parvipes. In addition, it has been determined that the barnacle goose is a derivative of the cackling goose lineage, whereas the Hawaiian goose is derived from the Canada goose.

Description[edit]

Yellow plumage of gosling

The black head and neck with a white "chinstrap" distinguish the Canada goose from all other goose species, with the exception of the cackling goose and barnacle goose, but the latter has a black breast, and also grey, rather than brownish, body plumage.[9]

There are seven subspecies of this bird, of widely varying sizes and plumage details, but all are recognizable as Canada geese. Some of the smaller races can be hard to distinguish from the cackling goose, which slightly overlap in mass. However, most subspecies of the cackling goose (exclusive of Richardson's cackling goose, B. hutchinsii hutchinsii) are considerably smaller. The smallest cackling goose, B. h. minima, is scarcely larger than a mallard. In addition to the size difference, cackling geese also have a shorter neck and smaller bill, which can be useful when small Canada geese co-mingle with relatively large cackling geese. Of the "true geese" (i.e. the genera Anser or Branta), the Canada Goose is on average the largest living species, although some other species that are geese in name, if not of close relation to these genera, are on average heavier such as the spur-winged goose and Cape Barren goose.

Canada geese range from 75 to 110 cm (30 to 43 in) in length and has a 127–185 cm (50–73 in) wingspan.[10] Among standard measurements, the wing chord can range from 39 to 55 cm (15 to 22 in), the tarsus can range from 6.9 to 10.6 cm (2.7 to 4.2 in) and the bill can range from 4.1 to 6.8 cm (1.6 to 2.7 in). The largest subspecies is the B. c. maxima, or the "giant Canada goose", and the smallest (with the separation of the cackling goose group) is B. c. parvipes, or the "lesser Canada goose".[11] An exceptionally large male of race B. c. maxima, which rarely exceed 8 kg (18 lb), weighed 10.9 kg (24 lb) and had a wingspan of 2.24 m (7.3 ft). This specimen is the largest wild goose ever recorded of any species.[12]

The male Canada goose usually weighs 2.6–6.5 kg (5.7–14.3 lb), averaging amongst all subspecies 3.9 kg (8.6 lb). The female looks virtually identical but is slightly lighter at 2.4–5.5 kg (5.3–12.1 lb), averaging amongst all subspecies 3.6 kg (7.9 lb), and generally 10% smaller in linear dimensions than the male counterparts.[13] The female also possesses a different, and less sonorous, honk than the male.

Distribution and habitat[edit]

Canada geese on Spokane River, Washington
Flock in flight

This species is native to North America. It breeds in Canada and the northern United States in a variety of habitats. The Great Lakes region maintains a very large population of Canada geese. Canada geese occur year-round in the southern part of their breeding range, including most of the eastern seaboard and the Pacific coast. Between California and South Carolina in the southern United States and northern Mexico, Canada geese are primarily present as migrants from further north during the winter.[14]

By the early 20th century, over-hunting and loss of habitat in the late 19th century and early 20th century had resulted in a serious decline in the numbers of this bird in its native range. The giant Canada goose subspecies was believed to be extinct in the 1950s until, in 1962, a small flock was discovered wintering in Rochester, Minnesota, by Harold Hanson of the Illinois Natural History Survey.[15] In 1964, the Northern Prairie Wildlife Research Center was built near Jamestown. Its first director, Harvey K. Nelson, talked Forrest Lee into leaving Minnesota. Forrest Lee would head the center’s Canada goose production and restoration program. Forrest soon had 64 pens with 64 breeding pairs of screened, high-quality birds. The project involved private, state and federal resources and relied on the expertise and cooperation of many individuals. By the end of 1981, more than 6,000 giant Canada geese had been released at 83 sites in 26 counties in North Dakota.[16] With improved game laws and habitat recreation and preservation programs, their populations have recovered in most of their range, although some local populations, especially of the subspecies occidentalis, may still be declining.[citation needed]

In recent years, Canada goose populations in some areas have grown substantially, so much so that many consider them pests for their droppings, bacteria in their droppings, noise, and confrontational behavior. This problem is partially due to the removal of natural predators and an abundance of safe, man-made bodies of water near food sources, such as those found on golf courses, in public parks and beaches, and in planned communities. Due in part to the interbreeding of various migratory subspecies with the introduced non-migratory giant subspecies, Canada geese are frequently a year-around feature of such urban environments.[17]

Contrary to its normal migration routine, large flocks of Canada geese have established permanent residence in Esquimalt, British Columbia, on Chesapeake Bay, in Virginia's James River regions, and in the Triangle area of North Carolina (Raleigh, Durham, Chapel Hill), and nearby Hillsborough. Some Canada geese have taken up permanent residence as far south as Florida, in places such as retention ponds in apartment complexes. Large resident populations of Canada geese are also present in much of the San Francisco Bay Area in Northern California.

Outside North America[edit]

Eurasia[edit]

Canada goose nesting in Wales

Canada geese have reached northern Europe naturally, as has been proved by ringing recoveries. The birds include those of the subspecies parvipes, and possibly others. Canada geese are also found naturally on the Kamchatka Peninsula in eastern Siberia, eastern China, and throughout Japan.[citation needed]

Canada geese have also been introduced in Europe, and have established populations in Great Britain, Ireland, the Netherlands, Belgium, France, Germany, Scandinavia, and Finland. Most European populations are non-migratory, but those in more northerly parts of Sweden and Finland migrate to the North Sea and Baltic coasts.[18] Semi-tame feral birds are common in parks, and have become a pest in some areas. In the early 17th century, explorer Samuel de Champlain sent several pairs of geese to France as a present for King Louis XIII. The geese were first introduced in Britain in the late 17th century as an addition to King James II's waterfowl collection in St. James's Park. They were introduced in Germany and Scandinavia during the 20th century, starting in Sweden in 1929. In Britain they were spread by hunters, but remained uncommon until the mid-20th century. Their population grew from 2200–4000 birds in 1953 to an estimated 82,000 in 1999, as changing agricultural practices and urban growth provided new habitat. European birds are mostly descended from the subspecies canadensis, likely with some contributions from the subspecies maxima.[19]

New Zealand[edit]

Canada geese were introduced as a game bird into New Zealand in 1905. They have become a problem in some areas by fouling pastures and damaging crops. They were protected under the Wildlife Act 1953 and the population was managed by Fish and Game New Zealand who culled excessive bird numbers. In 2011 the government removed the protection status, allowing anyone to kill the birds.[20]

Behavior[edit]

A flock of feeding Canada geese calling

Problems playing this file? See media help.
Flying in New Jersey

Like most geese, the Canada goose is naturally migratory with the wintering range being most of the United States. The calls overhead from large groups of Canada geese flying in V-shaped formation signal the transitions into spring and autumn. In some areas, migration routes have changed due to changes in habitat and food sources. In mild climates from California to the Great Lakes, some of the population has become non-migratory due to adequate winter food supply and a lack of former predators.[citation needed]

Males exhibit agonistic behaviour both on and off breeding and nesting grounds. This behavior rarely involves interspecific killing. One documented case involved a male defending its nest from a brant goose that wandered into the area, the following attack lasted for one hour until the death of the Brant. The cause of death was suffocation or drowning in mud as a direct result of the Canada goose's pecking the head of the Brant into the mud. Researchers attributed it to high hormone levels and the Brant's inability to leave the nesting area.[21]

Diet[edit]

Canada geese are primarily herbivores,[14] although they sometimes eat small insects and fish.[22] Their diet includes green vegetation and grains. The Canada goose eats a variety of grasses when on land. It feeds by grasping a blade of grass with the bill, then tearing it with a jerk of the head. The Canada goose also eats beans and grains such as wheat, rice, and corn when they are available. In the water, it feeds from silt at the bottom of the body of water. It also feeds on aquatic plants, such as seaweeds.[12] In urban areas, they are also known to pick food out of garbage bins.

Reproduction[edit]

Canada goose goslings

During the second year of their lives, Canada geese find a mate. They are monogamous, and most couples stay together all of their lives. If one dies, the other may find a new mate. The female lays from 2–9 eggs with an average of five and both parents protect the nest while the eggs incubate, but the female spends more time at the nest than the male.[12]

Its nest is usually located in an elevated area near water such as streams, lakes, ponds and sometimes on a beaver lodge. Its eggs are laid in a shallow depression lined with plant material and down.

The incubation period, in which the female incubates while the male remains nearby, lasts for 24–28 days after laying. As the annual summer molt also takes place during the breeding season, the adults lose their flight feathers for 20–40 days, regaining flight at about the same time as their goslings start to fly.[23]

As soon as the goslings hatch they are immediately capable of walking, swimming and finding their own food (a diet similar to the adult geese). Parents are often seen leading their goslings in a line, usually with one adult at the front, and the other at the back. While protecting their goslings, parents often violently chase away nearby creatures, from small blackbirds to lone humans that approach, after warning them by giving off a hissing sound and will then attack with bites and slaps of the wings if the threat does not retreat or has seized a gosling. Most of the species that prey on eggs will also take a gosling. Although parents are hostile to unfamiliar geese, they may form groups of a number of goslings and a few adults, called crèches.[citation needed]

The offspring enter the fledging stage any time from 6 to 9 weeks of age. They do not leave their parents until after the spring migration, when they return to their birthplace.[14]

Migration[edit]

Resting in a pond during spring migration, Ottawa, Ontario

Canada geese are known for their seasonal migrations. Most Canada geese have staging or resting areas where they join up with others. Their autumn migration can be seen from September to the beginning of November.[citation needed] The early migrants have a tendency to spend less time at rest stops and go through the migration much faster. The later birds usually spend more time at rest stops. Some geese will return to the same nesting ground year after year and lay eggs with their mate, raising them in the same way each year. This is recorded from the many tagged geese which frequent the East Coast.

Canada geese fly in a distinctive V-shaped flight formation, with an altitude of 1 km (3,000 feet) for migration flight. The maximum flight ceiling of Canada geese is unknown, but they have been reported at 9 km (29,000 feet).[24]

Flying in the V formation has been the subject of study by researchers. The front position is rotated since flying in front consumes the most energy. Canada geese leave the winter grounds more quickly than the summer grounds. Elevated thyroid hormones, such as T3 and T4, have been measured in geese just after a big migration. This is believed because of the long days of flying in migration the thyroid gland sends out more T4 which will help the body cope with the longer journey. The increased T4 levels are also associated with increased muscle mass (hypertrophy) of the breast muscle, also because of the longer time spent flying. It is believed that the body sends out more T4 to help the goose's body with this long task by speeding up the metabolism and temperature at which the body works.[25] Also, other studies show levels of stress hormones like corticosterone rise dramatically in these birds during and after a migration.[26]

Survival[edit]

The life span in the wild of geese that survive to adulthood ranges 10–24 years.[12]

Predators[edit]

Known predators of eggs and goslings include coyotes,[27] Arctic foxes (Vulpes lagopus), northern raccoons (Procyon lotor), red foxes (Vulpes vulpes), large gulls (Larus ssp.), common raven (Corvus corax), American crows (Corvus brachyrhynchos) and both brown (Ursus arctos) and American black bears (Ursus americanus).[14][28][29][30][31]

Once they reach adulthood, due to their large size and often aggressive behavior, Canada geese are rarely preyed on, although prior injury may make them more vulnerable to natural predators.[32] Beyond humans, adults can be taken by coyotes[33] and gray wolves (Canis lupus).[34] Avian predators known to kill adults as well as young geese include snowy owls (Bubo scandiacus), golden eagles (Aquila chrysaetos) and bald eagles (Haliaeetus leucocephalus) and, though rarely on large adult geese, great horned owls (Bubo virginianus), peregrine falcons (Falco peregrinus) and gyrfalcons (Falco rusticolus).[14][30] Adults are quite vigorous at displacing potential predators from the nest site, with predator prevention usually falling to the larger male of the pair.[35][36][37] Males usually attempt to draw attention of approaching predators and will toll (mob terrestrial predators without physical contact) often in accompaniment with males of other goose species. Eagles of both species frequently cause geese to fly off in mass from some distance, though in other instances geese may seem unconcerned at perched bald eagles nearby, seemingly only reacting if the eagle is displaying active hunting behavior.[38] Canada geese are quite wary of humans where they are regularly harvested but can otherwise become habituated to fearlessness towards humans, especially where they are fed by them.[39]

Salinity[edit]

Salinity plays a role in the growth and development of goslings. Moderate to high salinity concentrations without fresh water results in slower development, growth and saline-induced mortality. Goslings are susceptible to saline-induced mortality before their nasal salt glands become functional, with the majority occurring before the sixth day of life.[40]

Disease[edit]

Canada geese are susceptible to avian bird flus, such as H5N1. A study was carried out using the HPAI virus, a H5N1 virus, the results found that the geese are susceptible to the virus and would prove useful for monitoring the spread of the virus, attributed to the high mortality of the infected birds. The study found that prior exposure to other viruses may result in some resistance to H5N1.[41]

Relationship with humans[edit]

In North America, non-migratory Canada goose populations have been on the rise. The species is frequently found on golf courses, parking lots and urban parks, which would have previously hosted only migratory geese on rare occasions. Owing to its adaptability to human-altered areas, it has become the most common waterfowl species in North America. In many areas, non-migratory Canada geese are now regarded as pests by humans. They are suspected of being a cause of an increase in high fecal coliforms at beaches.[42] An extended hunting season, deploying noise makers, and hazing by dogs have been used in an attempt to disrupt suspect flocks.[43]

Since 1999, the United States Department of Agriculture Wildlife Services agency has been engaged in lethal culls of Canada geese primarily in urban or densely populated areas. The agency responds to municipalities or private land owners, such as golf courses, who find the geese obtrusive or object to their waste.[44] Addling goose eggs and destroying nests are promoted as humane population control methods.[45]

Canada goose is protected in Canada under the Migratory Birds Convention Act, 1994.[46] Commercial transaction (such as buying or trading) are prohibited. The possession, hunting, and interfering with the activity of the animals are restricted by law.[47] Environment Canada's Wildlife Enforcement Officers have the responsibility for enforcing the legislation.

Geese have a tendency to attack humans when they feel themselves or their goslings to be threatened. First the geese will stand erect, spread their wings and produce a hissing sound. Next, the geese will charge. They may then bite or attack with their wings.[48]

Aircraft strikes[edit]

Canada geese have been implicated in a number of bird strikes by aircraft. Their large size and tendency to fly in flocks may exacerbate their impact. In the United States, the Canada goose is the second most damaging bird strike to airplanes, with the most damaging being turkey vultures.[49] Canada geese can cause fatal crashes when they strike an aircraft's engine. In 1995, a U.S. Air Force E-3 Sentry aircraft at Elmendorf AFB, Alaska struck a flock of Canada geese on takeoff, losing power in both port side engines. It crashed 2 miles (3.2 km) from the runway, killing all 24 crew members. The accident sparked efforts to avoid such events, including habitat modification, aversion tactics, herding and relocation, and culling of flocks.[50][51][52] In 2009, a collision with a flock of migratory Canada geese resulted in US Airways Flight 1549 suffering a total power loss after takeoff. The pilot brought the plane to an emergency 'splash'-landing in the Hudson River, causing only minor injuries.[53][54][55]

Population[edit]

In 2000, the North American population for the geese was estimated to be between 4 million and 5 million birds.[56] A 21-year study in Wichita, Kansas, found the number of geese increase from 1,600 to 18,000 birds.[56]

References[edit]

  1. ^ BirdLife International (2012). "Branta canadensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Long, John L. (1981). Introduced Birds of the World. Agricultural Protection Board of Western Australia. pp. 21–493. 
  3. ^ Linnaeus, C. (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata (in Latin). Holmia: Laurentius Salvius. 
  4. ^ Gill, Frank; Minturn, Wright (2006). Birds of the World: Recommended English Names. Christopher Helm. 
  5. ^ Gill, F.; Donsker, D., eds. (2012). "IOC World Bird Names (v. 3.1)". Retrieved May 1, 2012. 
  6. ^ "Canada goose (bird)". Britannica Online Encyclopedia. Encyclopædia Britannica, Inc. Retrieved 11 March 2013. 
  7. ^ "Canada goose or canadian goose, n.". The American Heritage Dictionary of the English Language (4th ed.). Houghton Mifflin Company. 2000. OCLC 43499541. 
  8. ^ Stackhouse, Mark. "The New Goose". 
  9. ^ Audubon Society
  10. ^ Ogilvie, Malcolm; Young, Steve (2004). Wildfowl of the World. New Holland Publishers. ISBN 978-1-84330-328-2. 
  11. ^ Madge, Steve; Burn, Hilary (1988). Waterfowl: An Identification Guide to the Ducks, Geese, and Swans of the World. Boston: Houghton Mifflin. ISBN 0-395-46727-6. 
  12. ^ a b c d Dewey, T.; Lutz, H. (2002). "Branta canadensis". Animal Diversity Web. Retrieved 2007-11-18. 
  13. ^ Mowbray, Thomas B., Craig R. Ely, James S. Sedinger and Robert E. Trost. 2002. Canada Goose (Branta canadensis), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: [1]
  14. ^ a b c d e Mowbray, Thomas B.; Ely, Craig R.; Sedinger, James S. and Trost, Robert E. (2002). "Canada Goose (Branta canadensis)". In Poole, A. The Birds of North America. Ithaca: Cornell Lab of Ornithology. 
  15. ^ Hanson, Harold C. (1997). The Giant Canada Goose (2nd. ed.). Southern Illinois University Press. ISBN 978-0-8093-1924-4. 
  16. ^ "Obituary: Forrest Lee". The Bismarck Tribune (Bismarck, North Dakota). February 7, 2013. 
  17. ^ "Why Do Canada Geese Like Urban Areas?". The Humane Society of the United States. Retrieved 20 February 2014. 
  18. ^ Svensson, Lars (2009). Birds of Europe (2nd ed.). Princeton University Press. pp. 20–21. ISBN 978-0-691-14392-7. 
  19. ^ David, Cabot (2010). Wildfowl. Collins New Naturalist Library 110. HarperCollins UK. ISBN 0007405146. 
  20. ^ "Canada geese protection status changed". Beehive. New Zealand Government. 17 March 2011. Retrieved 24 March 2011. 
  21. ^ Krauss, David A.; Salame, Issa (2012). "Interspecific Killing of a Branta bernicla (Brant) by a Male Branta canadensis (Canada Goose)". Northeastern Naturalist (Northeastern Naturalist Humboldt Field Research Institute) 19 (4): 701. doi:10.1656/045.019.0415. Retrieved August 2, 2013. 
  22. ^ Angus, Wilson. "Identification and range of subspecies within the Canada and Cackling Goose Complex (Branta canadensis & B. hutchinsii)". 
  23. ^ Johnsgard, Paul A. (2010) [1978]. Ducks, Geese, and Swans of the World (revised online ed.). Lincoln, Nebraska: University of Nebraska Press. p. 79. 
  24. ^ "Canada Geese at Blackwater". U.S. Fish & Wildlife Service. Retrieved 2 August 2013. 
  25. ^ John, T. M.; George, J. C. (1978). "Circulatory levels of thyroxine (T4) and triiodothyronine (T3) in the migratory Canada goose". Physiological Zoology 51 (4): 361–370. JSTOR 30160961. 
  26. ^ Landys, Mėta M.; Wingfield, John C.; Ramenofsky, Marilyn (2004). "Plasma corticosterone increases during migratory restlessness in the captive white-crowned sparrow Zonotrichia leucophrys gambelli" (PDF). Hormones and Behavior 46 (5): 574–581. doi:10.1016/j.yhbeh.2004.06.006. PMID 15555499. 
  27. ^ "Chicago Area Is Home to Growing Numbers of Coyotes". Illinois Department of Natural Resources. Retrieved April 23, 2011. 
  28. ^ Campbell, R. W., N. K. Dawe, I. McTaggart-Cowan, J. M. Cooper, G. W. Kaiser, and M. C. E. McNall. 1990. The birds of British Columbia, Vol. 1: introduction and loons through waterfowl. R. Br. Columbia Mus. Victoria.
  29. ^ Hughes, J. R. 2002. Reproductive success and breeding ground banding of Atlantic Population Canada Geese in northern Québec 2001. Unpubl. rep. Atlantic Flyway Council.
  30. ^ a b Barry, T. W. 1967. The geese of the Anderson River delta, Northwest Territories. Phd Thesis. Univ. of Alberta, Edmonton.
  31. ^ Macinnes, C. D. and R. K. Misra. 1972. Predation on Canada Goose nests at McConnell River, Northwest Territories. J. Wildl. Manage. 36:414-422.
  32. ^ Sargeant, A. B. and D. G. Raveling. 1992. Mortality during the breeding season. Pages 396-422 in Ecology and management of breeding waterfowl. (Batt, B. D. J., A. D. Afton, M. G. Anderson, C. D. Ankney, D. H. Johnson, and et al., Eds.) Univ. of Minnesota Press, Minneapolis.
  33. ^ Hanson, W. C. and L. L. Eberhardt. 1971. The Columbia River Canada Goose Population 1950-1970. Wildl. Monogr. 28.
  34. ^ Raveling, D. G. and H. G. Lumsden. 1977. Nesting ecology of Canada Geese in the Hudson Bay Lowlands of Ontario: evolution and population regulation. Fish Wildl. Res. Rep. no. 98. Ontario Min. Nat. Resour.
  35. ^ Bent, A. C. 1925. Life histories of North American wild fowl, Pt. 2. U.S. Natl. Mus. Bull. 130.
  36. ^ Palmer, R. S. 1976. Handbook of North American birds, Vol. 2: Waterfowl. Pt. 1. Yale Univ. Press, New Haven, CT.
  37. ^ Collias, N. E. and L. R. Jahn. 1959. Social behavior and breeding success in Canada Geese (Branta canadensis) confined under semi-natural conditions. Auk 76:478-509.
  38. ^ Mcwilliams, S. R., J. P. Dunn, and D. G. Raveling. 1994. Predator-prey interactions between eagles and Cackling Canada and Ross' geese during winter in California. Wilson Bull. 106:272-288.
  39. ^ Bartelt, G. A. 1987. Effects of disturbance and hunting on the behavior of Canada goose family groups in east central Wisconsin. J. Wildl. Manage. 51:517-522.
  40. ^ Stolley, Doris; Bissonette, John; Kadlec, John (1999). "Effects of saline environments on the survival of wild goslings (Branta canadensis)". The American Midland Naturalist 142: 181. doi:10.1674/0003-0031(1999)142[0181:EOSEOT]2.0.CO;2. Retrieved August 2, 2013. 
  41. ^ Pasick, John; Berhane, Yohannes; Embury-Hyatt, Carissa; Copps, John; Kehler, Helen; Handel, Katherine; Babiuk, Shawn; Hooper-McGrevy, Kathleen; Li, Yan; Le, Quynh; Phuong, Song (2007). "Susceptibility of Canada geese (Branta canadensis) to highly pathogenic avian influenza virus (H5N1)". Emerging Infectious Diseases (U.S. National Center for Infectious Diseases) 13 (12): 1821–7. doi:10.3201/eid1312.070502. PMC 2876756. PMID 18258030. Retrieved August 2, 2013. 
  42. ^ http://www.portal.state.pa.us/portal/server.pt/gateway/PTARGS_0_1105191_0_0_18/State%20Parks%20Again%20Offering%20Early%20Canada%20Goose%20Hunting.pdf
  43. ^ Woodruff, Roger A.; Green, Jeffrey S. (1995). "Livestock Herding Dogs: A Unique Application for Wildlife Damage Management". Great Plains Wildlife Damage Control Workshop Proceedings (Ardmore, Oklahoma: Noble Foundation) 12: 43–45. 
  44. ^ Board of Park Commissioners (Seattle) Meeting Minutes July 12, 2001
  45. ^ Gregg MacDonald, Fairfax County Times (May 6, 2008). "Goose egg addling stirs concern in Reston". Retrieved 2009-06-10. 
  46. ^ Frequently Asked Questions – Canada Geese
  47. ^ Bird strikes plummet at Vancouver airport
  48. ^ Division of Wildlife (Ohio) Goose Attacks
  49. ^ "Bird Plus Plane Equals Snarge". Wired. 
  50. ^ "CVR transcript Boeing E-3 USAF Yukla 27 - 22 SEP 1995". Accident investigation. Aviation Safety Network. 22 September 1995. Retrieved January 16, 2009. 
  51. ^ "1995 AWACS crash". CNN. September 23, 1995. Archived from the original on 28 June 2011. Retrieved July 25, 2011. 
  52. ^ http://www.af.mil/news/airman/1297/bash.htm Air Force News article on Yukla 27
  53. ^ Barbara Barrett (2009-06-08). "DNA shows jet that landed in Hudson struck migrating geese". McClatchy Newspapers. Retrieved 2009-06-08. 
  54. ^ Maynard, Micheline (15 January 2009). "Bird Hazard Is Persistent for Planes". The New York Times. Retrieved 23 February 2010. 
  55. ^ "Third Update on Investigation into Ditching of US Airways Jetliner into Hudson River" (Press release). NTSB. February 4, 2009. Retrieved February 5, 2009. 
  56. ^ a b Maccarone, Alan D.; Cope, Charles (2004). "Recent trends in the winter population of Canada geese (Branta canadensis) in Wichita, Kansas: 1998–2003". Transactions of the Kansas Academy of Science (Kansas Academy of Science) 107: 77. doi:10.1660/0022-8443(2004)107[0077:RTITWP]2.0.CO;2. Retrieved August 2, 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Various authorities recognize 8-12 or more subspecies. Generally tundra populations comprise small birds, whereas southern birds are much larger, with intermediate-sized birds in intermediate localities. Within these size groupings, birds from the Pacific coast tend to be much darker than are eastern birds. However, reintroductions from mixed stocks have greatly muddied the traits of many southern populations. (DeBenedictus, Birding, Dec. 1991). Northern populations of small Canada Goose have been variously treated as three separate species: B. hutchinsii, B. minima, and B. leucopareia; as a single species, B. hutchinsii; or as one or more subspecies of B. canadensis (AOU 1983). B. hutchinsii is now recognized based on genetic studies, including recent work with mitochondrial DNA (AOU 2004). Mitochondrial DNA data indicate that Canada goose subspecies fall clearly into two sister groups, large-bodied and small-bodied, which share no mtDNA types (Van Wagner and Baker 1990, Quinn et al. 1991); in contrast, nuclear-gene-encoded protein evidence associates all the subspecies very closely (Van Wagner and Baker 1986, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

Canada goose
cackling goose

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for Canada goose is Branta
canadensis (Linnaeus) [17,21]. There are eleven subspecies of
Canada goose [1,14,20]:

B. canadensis ssp. moffitti - western or Great Basin Canada goose
B. canadensis ssp. canadensis - Atlantic Canada goose
B. canadensis ssp. interior - Hudson Bay, Todd, or interior Canada goose
B. canadensis ssp. occidentalis - dusky Canada goose
B. canadensis ssp. fulva - Vancouver or Queen Charlotte Canada goose
B. canadensis ssp. maxima - giant Canada goose
B. canadensis ssp. taverneri - Taverner's or Alaskan Canada goose
B. canadensis ssp. hutchinsii - Richardson's or Baffin Island Canada goose
B. canadensis ssp. parvipes - lesser or Athabasca Canada goose
B. canadensis ssp. leucopareira - Aleutian Canada goose
B. canadensis ssp. minima - cackling Canada goose

The Canada goose hybridizes with the snow goose (Chen caerulescens) [20].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 14. Johnsgard, Paul A. 1975. Waterfowl of North America. Bloomington, IN: Indiana University Press. 575 p. [19985]
  • 17. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]
  • 20. Howard, R.; Moore, Alick. 1980. A complete checklist of the birds of the world. Oxford: Oxford University Press. 701 p. [24537]
  • 21. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!