Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Branta bernicla

Much smaller (22-26 inches) than most Canada Geese (Branta canadensis), the Brant’s gray back also makes it much darker than its larger relative. Whereas Canada Geese have a large white “chinstrap,” the Brant has a much smaller white patch on its black neck. This species may also be identified by its black chest, white breast, and light gray flanks. The Brant is widely distributed across the Northern Hemisphere. In North America, this species’ breeding range is restricted to coastal areas in northern Alaska, Greenland, and arctic Canada. Most Brant breeding in North America winter along the Pacific coast of the United States or in the Mid-Atlantic region, while those that breed in northeastern Canada and Greenland winter in Europe. In the Old World, Brant breed in Siberia and winter to Western Europe and East Asia. In summer, Brant breed near salt marshes, in river deltas, or on small islands near shore. During the winter, this species inhabits estuaries, mudflats, and protected bays. Brant primarily eat mosses and small non-woody plants on their breeding grounds; during the winter, this species subsists almost exclusively on eelgrass, a type of submerged seagrass. Due to the inaccessibility of their breeding grounds, most birdwatchers never observe Brant during the summer months. They are much more accessible in winter and during migration, when they may be found singly or in flocks on large coastal bodies of water. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The breeding range encompasses arctic North America and eastern Russia. In winter, brant occur along the Pacific coast from Alaska to Baja California and mainland Mexico, along the Atlantic coast from Massachusetts to North Carolina (mainly New Jersey to North Carolina), and from the British Isles to the Mediterranean area and south to coastal China.

BREEDS: arctic North America and Russia: Prince Patrick and Melville islands in the western Canadian high arctic and the Beaufort Sea islands to the coastal plain of Canada and Alaska, with small colonies on the north side of the Chukotka Peninsula in Russia and on Wrangel Island (Derksen and Ward 1993). In western North America, about 80% of the total black brant population nests in four major colonies on the Yukon-Kuskokwim delta in western Alaska (Derkson and Ward 1993). WINTERS: in North America, along the Pacific coast from Alaska to Baja California and mainland Mexico, along Atlantic from Massachusetts to North Carolina (mainly New Jersey to North Carolina); from British Isles to Mediterranean area, south to coastal China; occasional in Hawaii. A major shift in the winter distribution in western North America occurred during the 1950s and 1960s, with increased numbers using lagoons along the Mexican mainland and much decreased numbers wintering in California; since the mid-1960s, more than 80% of the counted winter population has occurred in Mexico (Derksen and Ward 1993). In the 1980s, an average of several thousand wintered in the Izembek Lagoon area of the Alaska Peninsula (Derksen and Ward 1993). Kasegaluk Lagoon on the Chukchi Sea in northwestern Alaska is an important migration stop during southward migration; as much as 49% of the entire Pacific flyway population may use the lagoon (Johnson 1993). Izembek Lagoon on the Alaska Peninsula is a critically important stop in spring and late summer, hosting at least the majority of the eastern Pacific population (Johnson and Herter 1989); nearly the entire black brant population spends as long as nine weeks there before departing for wintering areas to the south (Derksen and Ward 1993). Important summer molting areas occur on Alaska's north slope and Wrangel Island (Derksen and Ward 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Canadian Arctic south along Pacific and Atlantic coasts of North America
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 64 cm

Weight: 1370 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 62.5 cm., Wingspan: 105 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: In winter, this species occurs primarily in marine situations that are marshy, along lagoons and estuaries, and on shallow bays (AOU 1998), often in areas with eelgrass (e.g., see Wilson and Atkinson 1995). Areas dominated by large freshwater lakes and estuaries provide important summer molting areas (Derksen and Ward 1993).

Nesting occurs mostly on coastal tundra, in low and barren terrain; on islands, deltas, lakes, and sandy areas among puddles and shallows, and in vegetated uplands. In western North America, preferred nest sites are one peninsulas or islets in large wetland complexes, some of which are subject to tidal action (Derksen and Ward 1993). Nests are on the ground in a depression lined, or built up, with mosses and lichens. Adults with broods move from colony sites to rearing habitats along tidal flats (Derksen and Ward 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory, the main routes of migration being along Arctic coastlines (Snow and Perrins 1998). It arrives on the breeding grounds in early-June (Madge and Burn 1988, Scott and Rose 1996) where it may breed in small, loose colonies (Madge and Burn 1988, del Hoyo et al. 1992, Snow and Perrins 1998) or dispersed in single pairs (Snow and Perrins 1998) (especially in the high Arctic where the habitat is unsuitable for large groups) (Kear 2005a). There is a high degree of synchrony in egg laying and hatching (Johnsgard 1978), with the adults moulting c.10 days after the young hatch (mid-July to mid-August (Scott and Rose 1996)) during which they become flightless for c.21-30 days (Johnsgard 1978, Scott and Rose 1996). Most individuals moult near the breeding grounds (Scott and Rose 1996) although immatures, unsuccessful breeders (Johnsgard 1978) and some more southerly breeding groups (Flint et al. 1984) may undertake pre-moult migrations (Johnsgard 1978) and form large moulting concentrations well-away from nesting areas (Flint et al. 1984). After the post-breeding moult flocks leave the breeding grounds in early-September with some arriving in wintering areas as early as mid-September, others making stopovers on route and arriving later (Madge and Burn 1988). It leaves its wintering quarters again from mid-March to mid-April (Madge and Burn 1988). During the non-breeding season the species remains gregarious, gathering in groups of only a few to several thousands of individuals (Snow and Perrins 1998), although it is rarely found in very large flocks (Kear 2005a). Habitat Breeding The species breeds in coastal Arctic tundra (del Hoyo et al. 1992) in or close to wet coastal meadows with abundant grassy vegetation (Kear 2005a) and on tundra-covered flats with tidal streams (only just above the high tide line) (Johnsgard 1978). In some parts of its range it shows a preference for nesting on small grassy islands (Johnsgard 1978, Madge and Burn 1988, Kear 2005a) in tundra lakes and rivers, especially if nesting Sabine's Gulls Xema sabini (Kear 2005a), Snowy Owls Bubo scandiaca (Flint et al. 1984, Kear 2005a), Peregrine Falcons Falco peregrinus (Flint et al. 1984) or large raptors are present to deter predators (Kear 2005a). High Arctic nesters may also breed widely dispersed over icy tundra, well-away from water (Kear 2005a). Non-breeding Outside of the breeding season the species becomes predominantly coastal, inhabiting estuaries (del Hoyo et al. 1992, Kear 2005a), tidal mudlflats (Madge and Burn 1988, Kear 2005a), sandy shores (del Hoyo et al. 1992), coastal saltmarshes (Kear 2005a) (especially in the spring) (Scott and Rose 1996) and shallow muddy bays (Kear 2005a). In recent years the species has taken to grazing on coastal cultivated grasslands (Madge and Burn 1988, Scott and Rose 1996) and winter cereal fields (Scott and Rose 1996), but rarely occurs on freshwater wetlands except on passage (Madge and Burn 1988). Diet The species is mainly herbivorous (del Hoyo et al. 1992) although it may take animal matter (e.g. fish eggs, worms, snails and amphipods) (Johnsgard 1978). Breeding In its breeding habitat the diet of the species consists of mosses, lichens, aquatic plants (del Hoyo et al. 1992), sedges, tundra grass Dupontia spp., arrowgrass Triglochin spp. and saltmarsh grass Puccinellia spp. (Alaska) (Kear 2005a), although the young may also take insects and aquatic invertebrates (Johnsgard 1978). Non-breeding Outside of the breeding season the species predominantly takes marine microscopic and macroscopic algae (del Hoyo et al. 1992) (e.g. seaweeds, Ulva spp. (Kear 2005a)) and other aquatic plants linked with saline or brackish waters (del Hoyo et al. 1992) in the intertidal zone (e.g. especially eelgrass Zostera spp. (Madge and Burn 1988, Kear 2005a), as well as Ruppia maritima, Spartina alterniflora, Salicornia spp., and arrowgrass Triglochin spp.) (Kear 2005a). Breeding site The nest is a shallow depression (Flint et al. 1984, del Hoyo et al. 1992) on the ground (del Hoyo et al. 1992). Although the species often nests close to water (del Hoyo et al. 1992) typically within a few hundred metres of the tideline (Snow and Perrins 1998), high Arctic nesters may breed on icy tundra well away from water (Kear 2005a) (some nearly up to 10 km inland) (Snow and Perrins 1998) often near boulders where the snow clears first (Kear 2005a). Management information An investigation carried out in one of the species's wintering areas (UK) found that it was most likely to forage on dry, improved grasslands that had high abundances of the grass Lolium perenne, were between 5 and 6 ha in area, and were at a distance of up to 1.5 km inland or 4-5 km along the coast from coastal roosting sites (Vickery and Gill 1999). The species was found to show a preference for grasslands with short, dense swards c.5 cm in height, a characteristic that can be gained through summer management plans involving either mechanical cutting, livestock (sheep or cattle) grazing regimes, or cutting and then grazing (although over longer periods of time the selective grazing of sheep rather than cattle, and frequent rather than infrequent cutting may be more likely to enhance tillering and produce the short, dense sward favoured by this species) (Vickery and Gill 1999). Fertilising the grassland with nitrogen in the autumn at a rate of 50 kg N ha1 was found to increase the overall species use of the habitat by 21 % compared with unfertilised areas (Vickery and Gill 1999), and fertilising at a rate of 75 kg N ha1 was found to increase the overall species use of the habitat by 9-29 % and to remove any preference the geese showed for short sward heights (between 5 and 11 cm) (Vickery and Gill 1999). In other fertilising experiments grazing intensity of the species was found to increase linearly with increasing levels of fertiliser (from 0 kg N ha1 to 150 kg N ha1), although responses in grazing intensity at fertiliser levels lower than 50 kg N ha1 were found to be short-lived (c.2 months after fertiliser application) (Vickery and Gill 1999).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2479 specimens in 4 taxa.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.696 - 15.350
  Nitrate (umol/L): 0.554 - 14.675
  Salinity (PPS): 32.426 - 34.717
  Oxygen (ml/l): 5.817 - 6.500
  Phosphate (umol/l): 0.406 - 0.763
  Silicate (umol/l): 2.362 - 7.519

Graphical representation

Temperature range (°C): 10.696 - 15.350

Nitrate (umol/L): 0.554 - 14.675

Salinity (PPS): 32.426 - 34.717

Oxygen (ml/l): 5.817 - 6.500

Phosphate (umol/l): 0.406 - 0.763

Silicate (umol/l): 2.362 - 7.519
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summer: tundra Winter: saltwater bays and estuaries
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Spring migration in western North America occurs during a 4-month period starting in mid-February (Derksen and Ward 1993). Spring migration also may begin in February in the eastern United States. Migrants arrive in nesting areas between late May and early June.

Southward migration begins around mid-August in the west, late August-early September in the east. Adults with fledged young follow traditional routes from breeding areas to fall migration staging sites (in western North America-Asia, along the Siberian, Beaufort, Cuckchi, and Bering seas) (Derksen and Ward 1993). Migrants arrive along the U.S. Atlantic coast in mid-October.

Entire or majority of east Pacific brant population congregates in April and August-September at Izembek Lagoon on Alaska Peninsula. Fall departure from the lagoon occurs with favorable winds in late October or early November; these birds arrive in Baja California within 60-95 hours of their departure from Alaska (Derksen and Ward 1993).

Pale-bellied brant breeding in northeastern Canadian arctic winter in Ireland. Those wintering on the U.S. Atlantic coast breed on Southhampton Island and Foxe Basin. The pale-bellied form that breeds chiefly on high arctic islands in Canada winters in the Puget Sound area. Majority of dark-bellied western brant from northwestern Canada and Alaska winter farther south on the Pacific coast, mainly in Mexico (see Shields 1990). See Johnson and Herter (1989) for many further details on migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long distance in flocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Winter diet includes eelgrass, sea lettuce (ULVA) and sea cabbage (ENTEROMORPHA). Summer diet: grasses, algae, mosses, other plants. Also eats marine invertebrates. Creeping alkali grass and Hoppner sedge are important foods for adults and developing young in breeding areas in western North America (Derksen and Ward 1993). Accumulates nutritional reserves in winter and in staging areas; important foods in western North American staging areas include eelgrass, sea lettuce, and other marine algae; also eats roe of Pacific herring, crustaceans, and mollusks (Derksen and Ward 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Plant material mostly. Also will consume aquatic insects, mollusks, and worms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Storms accompanied by high tides may destroy large numbers of nests (Johnson and Herter 1989). The arctic fox is the most important predator of eggs and young in the Yukon-Kuskokwim delta colonies, where glaucous gulls and parasitic jaegers also take eggs and young (Derksen and Ward 1993).

Flightless period during summer molt lasted 23-24 days in northern Alaska (Taylor 1995, Auk 112:904-919).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

aquatic plants of shallow bays and estuaries; favorite food is marine eelgrass
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 28.7 years (wild) Observations: Called Brant in North America. One banded bird was 28.7 years of age (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg laying occurs in June-July. Female incubates an average of 3-4 eggs for 22-26 days. Male stands guard. Individual females produce up to one brood each year (do not renest if first attempt fails). Nestlings are precocial, tended by both adults, sometimes congregate in large creches, fledge in 45-50 days, remain with adults until following spring. Some first breed at two years, most at three years. Lifelong pair bond. Nesting often occurs in loose colonies. Large numbers of subadults and nonbreeders concentrate around nesting colonies and other areas during nesting season and molt period (Johnson and Herter 1989). Brant are long lived. Some live 20-25 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in loose colonies, pair formation occurs on wintering grounds. Nest is built on islands of tundra ponds. 3-5 eggs incubated by female for 22-26 days. Young can feed themselves, both parents look after them. Young fledge after 40-50 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Branta bernicla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCACAAAGACATTGGCACCCTGTACCTCATCTTCGGAGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTGCTAATCCGCGCAGAACTGGGACAACCAGGAACTCTCCTAGGTGATGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTTATGGTCATACCCATCATGATCGGAGGGTTCGGCAACTGATTAGTACCCCTCATAATCGGCGCCCCCGACATAGCATTCCCGCGAATAAATAACATAAGCTTTTGACTCCTCCCACCATCATTCCTCCTACTACTAGCCTCATCTACTGTAGAAGCTGGCGCCGGCACAGGCTGAACTGTCTACCCTCCCCTAGCAGGTAACCTCGCCCACGCCGGAGCTTCAGTAGATCTGGCTATTTTTTCACTTCACTTGGCCGGTGTCTCCTCTATCCTTGGGGCCATCAACTTTATTACCACAGCCATTAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTATTCGTCTGATCCGTCCTGATTACTGCCATCCTGCTCCTCCTATCACTCCCCGTACTTGCTGCCGGCATCACAATGCTACTAACCGACCGAAACCTAAATACCACATTCTTCGACCCAGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATTCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Branta bernicla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.560,000 individuals (Wetlands International 2006), while national population sizes have been estimated at
Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Spring subsistence harvest in western Alaska coupled with fox predation on reduced Yukon-Kuskokwim delta populations have limited the recovery of key nesting colonies in western North America (Derksen and Ward 1993). Declines in eelgrass may affect habitat use, bird condition, and reproductive success (Wilson and Atkinson 1995). Declines in British Columbia and Pacific states are due to degradation and loss of important staging and winter estuarine habitats caused by commercial and recreational development and disturbance (Derksen and Ward 1993). In Mexico, industrial and recreational development in several estuaries may further limit winter habitat (Derksen and Ward 1993).
Disturbance by humans also is a threat to birds wintering in Mexico (Derksen and Ward 1993). Habitats in Alaska, Russia, and northern Canada presently are relatively secure (Derksen and Ward 1993). Molting individuals are susceptible to disturbance by aircraft (see Taylor 1995, Auk 112:904-919).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
This species is threatened by hunting (Kear 2005a) and is susceptible to disturbance from vehicles in the UK (Burton et al. 2002) (although it is relatively tolerant of human disturbance, e.g. walkers, compared to other species) (Vickery and Gill 1999, Burton et al. 2002). In its winter range the species may be persecuted by farmers, as in recent years it has increasingly taken to grazing on cultivated grasslands and winter cereal fields near the coast (Scott and Rose 1996). The species may also be threatened in the future by reductions in food supplies following the return of a disease of the eelgrass Zostera marina (a staple food) (Scott and Rose 1996). The nesting success of breeding pairs in Svalbard is greatly reduced as a result of Arctic fox Vulpes lagopus predation (Madsen et al. 1992), and the species is susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Predators, especially arctic fox, can limit numbers and distribution of nesting brant and prevent or slow increases in brant colony size where colonies have been diminished by other mortality factors; removal or management of arctic fox at or near brant colonies may increase nest success and assist re-establishment or expansion of depleted brant colonies (Raveling 1989, Anthony et al. 1991). Control measures to eliminate foxes enhanced nesting success and nesting numbers at the Tutakoke River colony on the Yukon-Kuskokwim delta (Derksen and Ward 1993).

Disturbance should be kept to a minimum in summer molting areas and in traditional foraging areas; vessel and aircraft traffic should be regulated to eliminate excessive disturbance (Derksen and Ward 1993).

In northern breeding areas, development related to petroleum should be monitored and strategies developed for the protection of habitats that are not managed for waterfowl (Derksen and Ward 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Needs: Protect key nesting, staging, molting, and wintering habitats (especially eelgrass beds).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Subject to spring subsistence harvest in western Alaska (Derkson and Ward 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brant Goose

The brant or brent goose (Branta bernicla) is a species of goose of the genus Branta. The black brant is an American subspecies. The specific descriptor bernicla is from the same source as "barnacle" in barnacle goose, which looks similar but is not a close relation.

Appearance[edit]

Wintering at the Wadden Sea, Germany

The brant goose is a small goose with a short, stubby bill. It measures 55–66 cm (22–26 in) long, 106–121 cm (42–48 in) across the wings and weighs 0.88–2.2 kg (1.9–4.9 lb).[2][3][4] The under-tail is pure white, and the tail black and very short (the shortest of any goose).

The species is divided three subspecies:

Some DNA evidence suggests that these forms are genetically distinct; while a split into three separate species has been proposed, it is not widely accepted, with other evidence upholding their maintenance as a single species.

The body of the dark-bellied form is fairly uniformly dark grey-brown all over, the flanks and belly not significantly paler than the back. The head and neck are black, with a small white patch on either side of the neck. It breeds on the Arctic coasts of central and western Siberia and winters in western Europe, with over half the population in southern England, the rest between northern Germany and northern France.

The pale-bellied brant goose appears blackish-brown and light grey in colour. The body is different shades of grey-brown all over, the flanks and belly are significantly paler than the back and present a marked contrast. The head and neck are black, with a small white patch on either side of the neck. It breeds in Franz Josef Land, Svalbard, Greenland and northeastern Canada, wintering in Denmark, northeast England, Ireland and the Atlantic coast of the U.S. from Maine to Georgia.

The black brant appears blackish-brown and white in colour. This form is a very contrastingly black and white bird, with a uniformly dark sooty-brown back, similarly-coloured underparts (with the dark colour extending furthest back of the three forms) and a prominent white flank patch; it also has larger white neck patches, forming a near-complete collar. It breeds in northwestern Canada, Alaska and eastern Siberia, and wintering mostly on the west coast of North America from southern Alaska to California, but also some in east Asia, mainly Japan.

The Asian populations of the black brant populations had previous been regarded as a separate subspecies orientalis based on purported paler upperparts coloration; however, it is generally now believed that this is not correct.

A fourth form (known variously as gray brant, intermediate brant or grey-bellied brant goose) has been proposed, although no formal subspecies description has been made as yet, for a population of birds breeding in central Arctic Canada (mainly Melville Island), and wintering on Puget Sound on the American west coast around the U.S./Canada border. These birds are intermediate in appearance between black brant and pale-bellied brant, having brown upperparts and grey underparts which give less of a contrast with the white flank patch. Given that this population exhibits mixed characters, it has also been proposed that, rather than being a separate subspecies, it is actually a result of interbreeding between these two forms.

Habitat[edit]

In a defensive position

It used to be a strictly coastal bird in winter, seldom leaving tidal estuaries, where it feeds on eel-grass (Zostera marina) and the seaweed, sea lettuce (Ulva). In recent decades, it has started using agricultural land a short distance inland, feeding extensively on grass and winter-sown cereals. This may be behaviour learnt by following other species of geese. Food resource pressure may also be important in forcing this change, as the world population has risen over tenfold to 400,000-500,000 by the mid-1980s, possibly reaching the carrying capacity of the estuaries. In the breeding season, it uses low-lying wet coastal tundra for both breeding and feeding. The nest is bowl-shaped, lined with grass and down, in an elevated location, often in a small pond.

The brant goose is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References[edit]

  1. ^ BirdLife International (2012). "Branta bernicla". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Brant, Life History, All About Birds - Cornell Lab of Ornithology". Allaboutbirds.org. Retrieved 2011-10-18. 
  3. ^ "Brent Goose". Oiseaux-birds.com. Retrieved 2011-10-18. 
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  • Wildfowl by Madge and Burn, ISBN 0-7470-2201-1
  • Shields, G. F. (1990). Analysis of mitochondrial DNA of Pacific Black Brant. The Auk 107: 620-623.
  • Syroechkovski, E. E., Zöckler, C. & Lappo, E. (1998). Status of Brent Goose in northwestern Yakutia, East Siberia. Brit. Birds 91: 565-572.

Further reading[edit]

Identification[edit]

  • Ebels, E. B. (1997) Identification of brent geese: a new feature. Dutch Birding 19(5): 232-236 (highlights the difference in belly colour between the various forms)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes B. nigricans, formerly regarded as a distinct species. Populations from Yukon-Kuskokwim Delta, North Slope of Alaska, Anderson River (NWT), and Victoria Island are genetically homogeneous; Melville Island population is distinctive, apparently long isolated from other breeding populations (Shields, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!