Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Brief Summary

Biology

Whooper swans can be seen in Britain from November to March (3). During the migration they fly at high altitudes; a pilot flying at 8,000 feet once saw a flock of swans, thought to be whoopers (6). Although this species may occur in very large flocks numbering over 1000 individuals, they more typically occur in small groups (5). They feed on water plants, grass and cereals and may eat waste potatoes and sugar beet (5). During courtship, pairs face one another, with the wings held in a half-lifted and half-open position. The neck is then extended and bent repeatedly while both birds loudly vocalise (7). The pair produces a clutch of between three and seven eggs, which are incubated for 35 days. The young, known as cygnets, will have fully fledged after a further 87 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The whooper swan is a winter visitor to Britain. Its common name refers to the loud 'whooping' calls that it produces (5). This large white swan tends to hold its neck erect whilst swimming (3). In spring and summer, some adults may develop rusty 'stained' plumage on the neck and head caused by the iron-rich water on which they live (6). It can be distinguished from the smaller Bewick's swan in that the wedge-shaped yellow colouration of the bill extends beyond the nostrils, with the rest of the bill being black; in Bewick's swans the yellow patch is small and rounded (2). Juveniles have greyish brown plumage and a pink and black bill (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Iceland, Scotland, Scandinavia, and northern Russia east to Anadyrland and Kamchatka, and south to Poland, Caspian Sea, Turkestan, and Ussuriland (AOU 1983). NON-BREEDING: south to northern Africa, eastern Mediterranean region, southern Russia, India, southeastern China, and Japan (Sibley and Monroe 1990). Regular winter visitor to the western and central Aleutian Islands, Alaska (NGS 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; accidental from Eurasia
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic; winters to India and se China.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Whooper swans breed across northern Eurasia (5). Most of the whooper swans that spend the winter in Britain and Ireland originate from the population that breeds in Iceland (4). The population breeding in north-western Europe winters in Denmark and parts of Germany, and there are two western Siberian breeding populations; one winters in the eastern Mediterranean while the other migrates to the area around the Caspian Sea (4). In Britain a few pairs occasionally try to breed in Scotland, but with varying success (3). The British wintering population is mainly northern, with most birds occurring north of a line drawn between the Wirral to the Humber (5). Further south of this, only small flocks occur with the exception of the Ouse Washes and Anglesey (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Lakes, ponds, marshes, quiet rivers, reedbeds (Sibley and Monroe 1990). Shallow freshwater ponds and lakes, sheltered brackish and salt water (NGS 1987). Nests along seacoasts, tidal waters, lakes, rivers, and tundra (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is predominantly migratory (del Hoyo et al. 1992) and travels over land making brief stop overs (Snow and Perrins 1998). It breeds from mid-May in solitary pairs with well-defined territories (del Hoyo et al. 1992) (non-breeders remaining in flocks separate from breeding pairs) (Kear 2005a). Adults undergo a post-breeding moult period between late-July and early-August when they become flightless for c.30 days (Kear 2005a) (5-6 weeks) (Scott and Rose 1996), males starting to moult before the females (Kear 2005a). Non-breeding individuals moult at the same time as breeders, but whilst breeding pairs tend to moult in their breeding territories non-breeders moult in large congregations (Kear 2005a). After moulting the species begins to migrate south from late-September to October (the precise timing determined by weather conditions) (Kear 2005a) and arrives on the wintering grounds by October or November (Madge and Burn 1988). The species departs for the breeding grounds again from March to April (Kear 2005a) or early-May (Madge and Burn 1988). Outside of the breeding season the species is highly sociable, migrating in small flocks or family groups (Madge and Burn 1988) and congregating into flocks of up to 300-400 individuals in the winter (Johnsgard 1978, Madge and Burn 1988). The species roosts on areas of open water adjacent to its feeding areas (Madge and Burn 1988). Habitat Breeding The species breeds on islands in or along the banks of shallow freshwater pools, lakes, slow-flowing rivers (del Hoyo et al. 1992), marshes, swamps and bogs (Kear 2005a), showing a preference for habitats with abundant emergent vegetation (Kear 2005a) and reedbeds (Johnsgard 1978) in taiga (coniferous forest) zones (Johnsgard 1978, Kear 2005a), birch forest zones (Johnsgard 1978) and shrub/forest tundra (Kear 2005a) (generally avoiding open tundra) (Johnsgard 1978, del Hoyo et al. 1992). Non-breeders may also be found in flocks (Kear 2005a) along sheltered coasts (del Hoyo et al. 1992) on estuaries, lagoons and shallow bays during this season (Snow and Perrins 1998). Non-breeding On migration the species frequents lakes, estuaries and sheltered coasts (Kear 2005a). It traditionally winters on freshwater lakes and marshes (Kear 2005a), floodlands (Snow and Perrins 1998), brackish lagoons and coastal bays (Kear 2005a) although low-lying coastal agricultural land (del Hoyo et al. 1992) and wet pastures (Snow and Perrins 1998) are now used increasingly (Kear 2005a). Diet The species is predominantly herbivorous (del Hoyo et al. 1992), its diet consisting of the leaves, stems and roots (Johnsgard 1978) of aquatic plants (e.g. algae and Zostera, Ruppia and Potamogeton spp.), grasses (del Hoyo et al. 1992), sedges and horsetails (Equisetum spp.) (Kear 2005a). During the winter the species also takes agricultural grain, vegetables (e.g. potatoes and turnips (Johnsgard 1978)) and acorns (del Hoyo et al. 1992), and on the breeding grounds young birds often take adult and larval insects (Johnsgard 1978) (e.g. emerging chironomids) (Kear 2005a). Adults may also supplement their diet with marine and freshwater mussels (Kear 2005a). Breeding site The nest is a large mound of plant matter (del Hoyo et al. 1992) built on dry ground or in reedbeds (Johnsgard 1978) on small islands in or along the edges of lakes, pools or rivers (Madge and Burn 1988). The same nest mound may be used over several years although it is often repaired and new material is added (Kear 2005a). Management information A study carried out at a wintering site in Denmark found that large wind turbines (towers 68 m high with blades 66 m in diameter, blades sweeping the heights of 35-101 m) pose less of a collision risk to the species than wind turbines of a medium height (towers 45 m high with blades 48 m in diameter, blades sweeping the heights of 21-69 m) (Larsen and Clausen 2002).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.272 - 9.637
  Nitrate (umol/L): 1.327 - 9.948
  Salinity (PPS): 6.428 - 35.201
  Oxygen (ml/l): 6.343 - 8.081
  Phosphate (umol/l): 0.240 - 0.679
  Silicate (umol/l): 2.296 - 9.916

Graphical representation

Temperature range (°C): 8.272 - 9.637

Nitrate (umol/L): 1.327 - 9.948

Salinity (PPS): 6.428 - 35.201

Oxygen (ml/l): 6.343 - 8.081

Phosphate (umol/l): 0.240 - 0.679

Silicate (umol/l): 2.296 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whooper swans make use of a wider range of habitats than Bewick's swans (5). They are found on lowland farmland close to the coast, on flooded fields, mudflats, lakes and small ponds and lochs and will graze on farmland in winter (3) (5). They breed in boggy habitats with pools and small lakes where there are plenty of reeds and other sheltering vegetation (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 1,000,000 individuals

Comments: Estimate of 100,000 individuals world-wide (Madge and Burn 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 26.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cygnus cygnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cygnus cygnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATGGGCACCCTATACCTTATCTTCGGGGCATGAGCAGGAATAGTTGGCACCGCACTCAGCCTGTTAATCCGCGCAGAACTGGGACAACCAGGAACCCTCCTTGGTGACGACCAGATCTACAATGTAGTCGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATAGTCATGCCCATTATGATCGGGGGATTTGGTAACTGACTGGTCCCCCTTATAATCGGCGCTCCCGACATAGCATTCCCACGAATGAATAACATAAGCTTTTGACTCCTCCCACCATCATTTCTCCTGCTACTAGCCTCAGCCACCGTAGAAGCTGGCGCCGGTACAGGTTGAACCGTCTACCCACCCCTAGCAGGCAACCTAGCCCACGCTGGAGCTTCAGTAGACCTGGCCATTTTCTCACTTCACTTAGCTGGCATCTCCTCCATCCTTGGAGCCATCAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACTCCACTATTCGTCTGATCCGTCCTAATTACCGCCATCCTACTCCTCCTATCACTCCCTGTGCTCGCCGCAGGTATCACAATGCTATTAACCGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTATCAACACTTGTTCTGATTTTTCGGACACCCAGAAGTCTACATCCTAATCCTGCCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1N - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range, relatively numerous, threats localized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Amber List (medium conservation concern) (3). Receives general protection in Great Britain under Schedule 1 of the Wildlife and Countryside Act and listed under Annex I of the EC Birds Directive. Listed as a Species of European Conservation Concern (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.180,000 individuals (Wetlands International 2006), while the population in Russia has been estimated at c.10,000-100,000 breeding pairs and c.1,000-10,000 wintering individuals (Brazil 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Threatened by hunting and wetland destruction locally (Madge and Burn 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The species is threatened by habitat degradation and loss (such as the reclamation of coastal and inland wetlands) (Kear 2005a) especially in the Asian part of its breeding range (del Hoyo et al. 1992). Threats to its habitats include agricultural expansion (Kear 2005a), wetland drainage for irrigation (Ma and Cai 2002, Kear 2005a), overgrazing by livestock (e.g. sheep) (Ma and Cai 2002, Kear 2005a), vegetation cutting for winter livestock feed (Ma and Cai 2002), the development of roads (Ma and Cai 2002, Kear 2005a), mining (Ma and Cai 2002) (e.g. strip mining of sediment) (Gardarsson 2006), hydroelectric dam construction, disturbance from tourism (Ma and Cai 2002) and chronic oil pollution from oil exploration (Nikolaeva et al. 2006), exploitation (Ma and Cai 2002) and transportation (Nikolaeva et al. 2006). The species may suffer heavy losses from future oil spills (Nikolaeva et al. 2006), flying accidents (Kear 2005a) (such as collisions with overhead lines (Kear 2005a) or wind turbines (Larsen and Clausen 2002)), poisoning (Kear 2005a) from lead shot ingestion (Spray and Milne 1988) and natural disasters such as droughts or heavy snowstorms (Ma and Cai 2002), and is susceptible to avian influenza, so may be threatened by future outbreaks of the disease (Melville and Shortridge 2006). The species is also threatened by hunting (del Hoyo et al. 1992, Ma and Cai 2002, Kear 2005a), nest destruction and by subsistence egg collecting (Gudmundsson 1979, Ma and Cai 2002, Nikolaeva et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known threats facing this species include the risk of flying into overhead wires (7). As this swan overwinters in such large numbers in Britain, and because a handful of pairs attempt to breed in this country, it is included in the Amber list of Birds of Conservation Concern (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

44% of the British population of whooper swans and 19% of the Irish population occur within Special Protection Areas (SPAs) and so this species receives a level of protection at these sites. However, as this bird tends to feed away from these protected areas, suitable management in the countryside surrounding these areas must be considered (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Whooper Swan

The whooper swan (pronounced hooper), Cygnus cygnus, is a large Northern Hemisphere swan. It is the Eurasian counterpart of the North American trumpeter swan. An old name for the whooper swan is 'Elk'; it is so called in Francis Willughby and John Ray's Ornithology of 1676.

Description[edit]

The whooper swan is similar in appearance to the Bewick's swan. However, it is larger, at a length of 140–165 cm (55–65 in) and a wingspan of 205–275 cm (81–108 in). Weight typically is in the range of 7.4–14 kg (16–31 lb), with an average of 9.8–11.4 kg (22–25 lb) for males and 8.2–9.2 kg (18–20 lb) for females. The verified record mass was 15.5 kg (34 lb) for a wintering male from Denmark. It is considered to be amongst the heaviest flying birds.[2][3] Among standard measurements, the wing chord is 56.2–63.5 cm (22.1–25.0 in), the tarsus is 10.4–13 cm (4.1–5.1 in) and the bill is 9.2–11.6 cm (3.6–4.6 in).[4] It has a more angular head shape and a more variable bill pattern that always shows more yellow than black (Bewick's swans have more black than yellow).

Three whooper swans and one mute swan

Distribution and behaviour[edit]

Whooper swans require large areas of water to live in, especially when they are still growing, because their body weight cannot be supported by their legs for extended periods of time. The whooper swan spends much of its time swimming, straining the water for food, or eating plants that grow on the bottom.[5]

Whooper swans have a deep honking call and, despite their size, are powerful fliers. Whooper swans can migrate hundreds or even thousands of miles to their wintering sites in southern Europe and eastern Asia. They breed in subarctic Eurasia, further south than Bewicks in the taiga zone. They are rare breeders in northern Scotland, particularly in Orkney, and no more than five pairs have bred there in recent years; a handful of pairs have also bred in Ireland in recent years. This bird is an occasional vagrant to the Indian Subcontinent[6] and western North America. Icelandic breeders overwinter in the United Kingdom and Ireland, especially in the wildfowl nature reserves of the Royal Society for the Protection of Birds and of the Wildfowl and Wetlands Trust.

Whooper swans pair for life, and their cygnets stay with them all winter; they are sometimes joined by offspring from previous years. Their preferred breeding habitat is wetland, but semi-domesticated birds will build a nest anywhere close to water. Both the male and female help build the nest, and the male will stand guard over the nest while the female incubates. The female will usually lay 4–7 eggs (exceptionally 12). The cygnets hatch after about 36 days and have a grey or brown plumage. The cygnets can fly at an age of 120 to 150 days.

When whooper swans prepare to go on a flight as a flock, they use a variety of signaling movements to communicate with each other. These movements include head bobs, head shakes, and wing flaps and influence whether the flock will take flight and if so, which individual will take the lead.[7] Whooper swans that signaled with these movements in large groups were found to be able to convince their flock to follow them 61% of the time.[7] In comparison, swans that did not signal were only able to create a following 35% of the time.[7] In most cases, the whooper swan in the flock that makes the most movements (head bobs) is also the swan that initiates the flight of the flock – this initiator swan can be either male or female, but is more likely to be a parent than a cygnet.[7] Additionally, this signaling method may be a way for paired mates to stay together in flight. Observational evidence indicates that a swan whose mate is paying attention to and participates in its partner’s signals will be more likely to follow through with the flight. Thus, if a whooper swan begins initiating flight signals, it will be less likely to actually carry through with the flight if its mate is not paying attention and is therefore less likely to join it.[7]

Very noisy; the calls are strident, similar to those of Bewick’s Swan but more resonant and lower-pitched on average: kloo-kloo-kloo in groups of three or four.

Influence[edit]

Whooper swans are much admired in Europe.[5] The whooper swan is the national bird of Finland and is featured on the Finnish 1 euro coin. The whooper swan is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

The global spread of H5N1 reached the UK in April 2006 in the form of a dead whooper swan found in Scotland.[8]

Musical utterances by whooper swans at the moment of death have been suggested as the origin of the swan song legend.[citation needed]

References[edit]

  1. ^ BirdLife International (2012). "Cygnus cygnus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Brazil, Mark, The Whooper Swan. Christopher Helm Ornithology (2003), ISBN 978-0-7136-6570-3
  3. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  4. ^ Madge, Steve, Waterfowl: An Identification Guide to the Ducks, Geese, and Swans of the World. Houghton Mifflin Harcourt (1992), ISBN 978-0-395-46726-8
  5. ^ a b Mondadori, Arnoldo, ed. (1988). Great Book of the Animal Kingdom. New York: Arch Cape Press. p. 182. 
  6. ^ "Whooper Swan sighted in Himachal Wetland after 113 years. | Hill Post". Hillpost.in. 2013-01-30. Retrieved 2013-10-05. 
  7. ^ a b c d e Black, J. "Preflight Signaling in Swans: A Mechanism for Group Cohesion and Flock Formation". Ethology: 143–157. 
  8. ^ "Bird flu swan was from outside UK". BBC News. April 11, 2006. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Considered conspecific with C. BUCCINATOR by some authors (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!