Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Brief Summary

Biology

Whooper swans can be seen in Britain from November to March (3). During the migration they fly at high altitudes; a pilot flying at 8,000 feet once saw a flock of swans, thought to be whoopers (6). Although this species may occur in very large flocks numbering over 1000 individuals, they more typically occur in small groups (5). They feed on water plants, grass and cereals and may eat waste potatoes and sugar beet (5). During courtship, pairs face one another, with the wings held in a half-lifted and half-open position. The neck is then extended and bent repeatedly while both birds loudly vocalise (7). The pair produces a clutch of between three and seven eggs, which are incubated for 35 days. The young, known as cygnets, will have fully fledged after a further 87 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The whooper swan is a winter visitor to Britain. Its common name refers to the loud 'whooping' calls that it produces (5). This large white swan tends to hold its neck erect whilst swimming (3). In spring and summer, some adults may develop rusty 'stained' plumage on the neck and head caused by the iron-rich water on which they live (6). It can be distinguished from the smaller Bewick's swan in that the wedge-shaped yellow colouration of the bill extends beyond the nostrils, with the rest of the bill being black; in Bewick's swans the yellow patch is small and rounded (2). Juveniles have greyish brown plumage and a pink and black bill (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North America; accidental from Eurasia
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Iceland, Scotland, Scandinavia, and northern Russia east to Anadyrland and Kamchatka, and south to Poland, Caspian Sea, Turkestan, and Ussuriland (AOU 1983). NON-BREEDING: south to northern Africa, eastern Mediterranean region, southern Russia, India, southeastern China, and Japan (Sibley and Monroe 1990). Regular winter visitor to the western and central Aleutian Islands, Alaska (NGS 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic; winters to India and se China.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Whooper swans breed across northern Eurasia (5). Most of the whooper swans that spend the winter in Britain and Ireland originate from the population that breeds in Iceland (4). The population breeding in north-western Europe winters in Denmark and parts of Germany, and there are two western Siberian breeding populations; one winters in the eastern Mediterranean while the other migrates to the area around the Caspian Sea (4). In Britain a few pairs occasionally try to breed in Scotland, but with varying success (3). The British wintering population is mainly northern, with most birds occurring north of a line drawn between the Wirral to the Humber (5). Further south of this, only small flocks occur with the exception of the Ouse Washes and Anglesey (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is predominantly migratory (del Hoyo et al. 1992) and travels over land making brief stop overs (Snow and Perrins 1998). It breeds from mid-May in solitary pairs with well-defined territories (del Hoyo et al. 1992) (non-breeders remaining in flocks separate from breeding pairs) (Kear 2005a). Adults undergo a post-breeding moult period between late-July and early-August when they become flightless for c.30 days (Kear 2005a) (5-6 weeks) (Scott and Rose 1996), males starting to moult before the females (Kear 2005a). Non-breeding individuals moult at the same time as breeders, but whilst breeding pairs tend to moult in their breeding territories non-breeders moult in large congregations (Kear 2005a). After moulting the species begins to migrate south from late-September to October (the precise timing determined by weather conditions) (Kear 2005a) and arrives on the wintering grounds by October or November (Madge and Burn 1988). The species departs for the breeding grounds again from March to April (Kear 2005a) or early-May (Madge and Burn 1988). Outside of the breeding season the species is highly sociable, migrating in small flocks or family groups (Madge and Burn 1988) and congregating into flocks of up to 300-400 individuals in the winter (Johnsgard 1978, Madge and Burn 1988). The species roosts on areas of open water adjacent to its feeding areas (Madge and Burn 1988). Habitat Breeding The species breeds on islands in or along the banks of shallow freshwater pools, lakes, slow-flowing rivers (del Hoyo et al. 1992), marshes, swamps and bogs (Kear 2005a), showing a preference for habitats with abundant emergent vegetation (Kear 2005a) and reedbeds (Johnsgard 1978) in taiga (coniferous forest) zones (Johnsgard 1978, Kear 2005a), birch forest zones (Johnsgard 1978) and shrub/forest tundra (Kear 2005a) (generally avoiding open tundra) (Johnsgard 1978, del Hoyo et al. 1992). Non-breeders may also be found in flocks (Kear 2005a) along sheltered coasts (del Hoyo et al. 1992) on estuaries, lagoons and shallow bays during this season (Snow and Perrins 1998). Non-breeding On migration the species frequents lakes, estuaries and sheltered coasts (Kear 2005a). It traditionally winters on freshwater lakes and marshes (Kear 2005a), floodlands (Snow and Perrins 1998), brackish lagoons and coastal bays (Kear 2005a) although low-lying coastal agricultural land (del Hoyo et al. 1992) and wet pastures (Snow and Perrins 1998) are now used increasingly (Kear 2005a). Diet The species is predominantly herbivorous (del Hoyo et al. 1992), its diet consisting of the leaves, stems and roots (Johnsgard 1978) of aquatic plants (e.g. algae and Zostera, Ruppia and Potamogeton spp.), grasses (del Hoyo et al. 1992), sedges and horsetails (Equisetum spp.) (Kear 2005a). During the winter the species also takes agricultural grain, vegetables (e.g. potatoes and turnips (Johnsgard 1978)) and acorns (del Hoyo et al. 1992), and on the breeding grounds young birds often take adult and larval insects (Johnsgard 1978) (e.g. emerging chironomids) (Kear 2005a). Adults may also supplement their diet with marine and freshwater mussels (Kear 2005a). Breeding site The nest is a large mound of plant matter (del Hoyo et al. 1992) built on dry ground or in reedbeds (Johnsgard 1978) on small islands in or along the edges of lakes, pools or rivers (Madge and Burn 1988). The same nest mound may be used over several years although it is often repaired and new material is added (Kear 2005a). Management information A study carried out at a wintering site in Denmark found that large wind turbines (towers 68 m high with blades 66 m in diameter, blades sweeping the heights of 35-101 m) pose less of a collision risk to the species than wind turbines of a medium height (towers 45 m high with blades 48 m in diameter, blades sweeping the heights of 21-69 m) (Larsen and Clausen 2002).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.272 - 9.637
  Nitrate (umol/L): 1.327 - 9.948
  Salinity (PPS): 6.428 - 35.201
  Oxygen (ml/l): 6.343 - 8.081
  Phosphate (umol/l): 0.240 - 0.679
  Silicate (umol/l): 2.296 - 9.916

Graphical representation

Temperature range (°C): 8.272 - 9.637

Nitrate (umol/L): 1.327 - 9.948

Salinity (PPS): 6.428 - 35.201

Oxygen (ml/l): 6.343 - 8.081

Phosphate (umol/l): 0.240 - 0.679

Silicate (umol/l): 2.296 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Lakes, ponds, marshes, quiet rivers, reedbeds (Sibley and Monroe 1990). Shallow freshwater ponds and lakes, sheltered brackish and salt water (NGS 1987). Nests along seacoasts, tidal waters, lakes, rivers, and tundra (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.272 - 9.637
  Nitrate (umol/L): 1.327 - 9.948
  Salinity (PPS): 6.428 - 35.201
  Oxygen (ml/l): 6.343 - 8.081
  Phosphate (umol/l): 0.240 - 0.679
  Silicate (umol/l): 2.296 - 9.916

Graphical representation

Temperature range (°C): 8.272 - 9.637

Nitrate (umol/L): 1.327 - 9.948

Salinity (PPS): 6.428 - 35.201

Oxygen (ml/l): 6.343 - 8.081

Phosphate (umol/l): 0.240 - 0.679

Silicate (umol/l): 2.296 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whooper swans make use of a wider range of habitats than Bewick's swans (5). They are found on lowland farmland close to the coast, on flooded fields, mudflats, lakes and small ponds and lochs and will graze on farmland in winter (3) (5). They breed in boggy habitats with pools and small lakes where there are plenty of reeds and other sheltering vegetation (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 1,000,000 individuals

Comments: Estimate of 100,000 individuals world-wide (Madge and Burn 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 26.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cygnus cygnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATGGGCACCCTATACCTTATCTTCGGGGCATGAGCAGGAATAGTTGGCACCGCACTCAGCCTGTTAATCCGCGCAGAACTGGGACAACCAGGAACCCTCCTTGGTGACGACCAGATCTACAATGTAGTCGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATAGTCATGCCCATTATGATCGGGGGATTTGGTAACTGACTGGTCCCCCTTATAATCGGCGCTCCCGACATAGCATTCCCACGAATGAATAACATAAGCTTTTGACTCCTCCCACCATCATTTCTCCTGCTACTAGCCTCAGCCACCGTAGAAGCTGGCGCCGGTACAGGTTGAACCGTCTACCCACCCCTAGCAGGCAACCTAGCCCACGCTGGAGCTTCAGTAGACCTGGCCATTTTCTCACTTCACTTAGCTGGCATCTCCTCCATCCTTGGAGCCATCAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACTCCACTATTCGTCTGATCCGTCCTAATTACCGCCATCCTACTCCTCCTATCACTCCCTGTGCTCGCCGCAGGTATCACAATGCTATTAACCGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTATCAACACTTGTTCTGATTTTTCGGACACCCAGAAGTCTACATCCTAATCCTGCCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cygnus cygnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5