Articles on this page are available in 3 other languages: Chinese (Simplified) (7), Spanish (11), Dutch (1) (learn more)

Overview

Brief Summary

Bewick's swans are called 'small swans' in Dutch. Even though they are big birds, they are smaller than mute and whooper swans. Bewick's swans have more than 25,000 feathers on their body, providing excellent insulation when they are in northern Russia where they nest. They move south in the winter, where the grass is more tender than the withered tundra grass hidden under the snow. This swan is named after the illustrator Thomas Bewick.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cygnus columbianus

Somewhat smaller (53 inches) and slimmer than the Mute Swan (Cygnus olor), the Tundra Swan is most easily identified by its size, black bill, and long straight neck. Other field marks include an all-white body, black legs, and short tail. Male and female Tundra Swans are alike at all seasons. Tundra Swans inhabit a large portion of the Northern Hemisphere. The North American subspecies breeds in coastal Alaska and northwestern Canada southeast to the Hudson Bay. Swans breeding in the western part of this range spend the winter along the Pacific coast of the United States and in the mountain west; swans breeding further east winter along the Atlantic coast from New Jersey to South Carolina. In the Old World, this species breeds in northern Siberia, wintering south to Western Europe and northern China. In summer, Tundra Swans breed in coastal lakes and ponds on the arctic tundra. During the winter, this species may be found in a variety of wetland habitats, including estuaries, lakes, and rivers. Tundra Swans primarily eat plant material, including aquatic grasses, seeds, and tubers. Due to the relative inaccessibility of this species’ breeding grounds, most birdwatchers never observe Tundra Swans during the summer months. In winter, they may be most easily observed while foraging for food, when they may be seen walking on the shore or on grass further inland. They also feed on the water, where they may be seen submerging their upper bodies to seek out aquatic vegetation. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are six species of swan. Swans are some of the largest birds on Earth and can both fly and swim. Tundra Swans get their name from the fact that they spend spring and summer in cold arctic areas. In winter they fly as far south as northern Mexico.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sebastian Velvez

Supplier: Life on Earth

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

More info for the term: tundra

The tundra swan (C. columbianus ssp. columbianus) breeds from northern
Alaska (Point Barrow and Cape Prince of Wales), south to St. Lawrence
Island and the Alaska Peninsula, and east near the Arctic Coast to
Baffin Island, Hudson Bay, and Churchill and the Belcher islands.
Bewick's swan breeds from Russia east along the Arctic Coast to northern
Siberia. It occasionally occurs in Alaska and the Pacific Northwest
coast [1,6].

Cygnus columbianus ssp. columbianus winters in two regions. Populations
in Alaska and Yukon Territory chiefly winter in the Central Valley of
California, but some birds winter along Pacific coastal regions from
southern Alaska to California and east to Utah, southern Arizona, and
southern New Mexico. Tundra swans of the rest of the range migrate
southwards to winter in the interior Great Lakes region or on coastal
marshes from Maryland south to North Carolina, Florida, and Texas. The
tundra swan occasionally winters as far north as Maine [1,8]. Bewick's
swan winters in Eurasia in the British Isles, northern Europe, the
Caspian Sea, Japan, Korea, and the coast of China [1].

During migration, the tundra swan (C. columbianus ssp. columbianus)
occurs widely throughout interior North America on large bodies of
water. It is primarily found in the Great Basin, upper Mississippi
Valley, and the Great Lakes region, but also occurs in the Appalachian
Mountains in southern Pennsylvania and northern West Virginia [1].
  • 1. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 6. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 8. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America


AK AZ AR CA CO DE ID
IA MD MI MN MO MT NJ
NM NY NC ND OH OR PA
SC SD TX UT VA WA WI WY


AB BC MB NT ON PE PQ SK YK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: Alaska and Canadian low Arctic; northern Russia east along Arctic coast to northern Siberia. WINTERS: mainly on Pacific and Atlantic coasts of North America from southern British Columbia to California and from New Jersey to South Carolina; Eurasia south to British Isles, northern Europe, southeastern Asia. Accidental in Hawaii, Puerto Rico, and elsewhere (AOU 1998). In the U.S., primary wintering areas include the Atlantic coast from northern South Carolina to southern New Jersey, the vicinity of the Great Salt Lake, and central and northern California (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Size

Length: 132 cm

Weight: 7100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

lakes, ponds, and streams and often frequent salt water bays and estuaries
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory and travels on a narrow front via specific routes using well-known stop-over sites (Madge and Burn 1988) between its Arctic breeding and temperate wintering grounds (del Hoyo et al. 1992). It arrives on the breeding grounds from early-May to late-June (Madge and Burn 1988) (depending on local conditions [Kear 2005a]) where it breeds well-dispersed (Snow and Perrins 1998) in single pairs (del Hoyo et al. 1992), occasionally nesting semi-colonially in optimum habitats (Madge and Burn 1988, Kear 2005a). After breeding the species undergoes a flightless moulting period lasting for c.30 days between late-June and early-September, gathering in flocks on open waters (Madge and Burn 1988, Scott and Rose 1996). Family groups leave the breeding grounds from early-September to late-October (Madge and Burn 1988) and arrive on the wintering grounds from mid-October onwards (Madge and Burn 1988). During this autumn migration some groups may remain at stop-over sites until moved on by cold weather (Madge and Burn 1988). The return northward migration occurs from early-March, with the species travelling in small parties that disperse on arrival in the Arctic (Madge and Burn 1988). The species is gregarious outside of the breeding season, often gathering into large flocks of hundreds or thousands of individuals on the wintering grounds (Madge and Burn 1988, Kear 2005a). The species forages by day (where undisturbed [del Hoyo et al. 1992]) and roosts at night on open water (Kear 2005a). Habitat Breeding The species breeds near shallow pools, lakes (del Hoyo et al. 1992) and broad slow-flowing rivers (del Hoyo et al. 1992, Kear 2005a) with emergent littoral vegetation and pondweeds (e.g. Potamogeton spp.) connected to coastal delta areas (Kear 2005a) in open, moist, low-lying sedge-grass or moss-lichen (Kear 2005a) Arctic tundra (del Hoyo et al. 1992). It rarely nests in shrub tundra, and generally avoids forested areas (Kear 2005a). Non-breeding On migration the species frequents shallow ponds (Kear 2005a), lowland and upland lakes (Madge and Burn 1988, Kear 2005a), reservoirs (Madge and Burn 1988), riverine marshes, shallow saline lagoons (Kear 2005a) and sheltered coastal bays and estuaries (Madge and Burn 1988). During the winter it inhabits brackish and freshwater marshes (Madge and Burn 1988), rivers, lakes, ponds (Kear 2005a) and shallow tidal estuarine areas (del Hoyo et al. 1992, Kear 2005a) with adjacent grasslands (del Hoyo et al. 1992), flooded pastures (Kear 2005a) or agricultural arable fields (del Hoyo et al. 1992, Kear 2005a) below 100 m (Snow and Perrins 1998). Diet The species is predominantly herbivorous (del Hoyo et al. 1992), its diet consisting of the seeds, fruits, leaves, roots, rhizomes and stems of aquatic plants (e.g. Potamogeton, Zostera and Glyceria spp.), grasses (del Hoyo et al. 1992), sedges, reeds (Phragmites and Typha spp. [Kear 2005a]) and herbaceous tundra vegetation (Kear 2005a). During the winter the species complements its diet with agricultural grain and vegetables (del Hoyo et al. 1992) (e.g. potatoes [del Hoyo et al. 1992] and sugar beet [Kear 2005a]), and may also take estuarine invertebrates such as molluscs, amphipods (e.g. Corophium spp.) and polycheate worms on tidal mudflats prior to migration (Kear 2005a). Breeding site The nest is a large mound of plant matter positioned on elevated ground (del Hoyo et al. 1992) such as a ridge or hummock, often at some distance from feeding poolsto reduce to the risk of flooding (Kear 2005a). The species may re-use a nest from the previous year or build a new one, and although it is not colonial, many pairs may nest close together in optimum habitats (e.g. 5-16 pairs per 10 km2 [Kear 2005a]). Management information An experiment carried out in the Sacramento National Wildlife Refuge, California found that in wetland habitats where clay hardpans underlie wetland sediments tilling (plowing) the soil may be an effective means of reducing lead shot availability to waterfowl (Thomas et al. 2001). Plowing was found to reduce the amount of shot available to depths of 20-30 cm (below the foraging zone of the species [Thomas et al. 2001]).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, tundra

Tall emergent vegetation provides shelter and cover for tundra swans.
Adult swans remove vegetation around the nest until the nest is
surrounded by open water [2,10].
  • 2. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Palmer, Ralph S., editor. 1976. Handbook of North American birds. vol. 2. New Haven, CT: Yale University Press. 521 p. [21242]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: fresh, heath, marsh, tundra

Breeding habitat - Tundra swans usually breed on or near tundra ponds,
lakes, and sluggish rivers, and less often near sheltered tidal waters.
They tend to avoid areas near exposed marine coasts [1,8,10].

Nest sites - Tundra swans often select islets in tundra ponds and lakes
as nest sites [10]. Nests are also commonly located on the main shores
of lakes or ponds, heath tundras, hummocks in marshes or tidal meadows,
or more rarely, level stretches in marsh or meadow areas [2,15]. The
nest is an elaborate platform, 12 to 18 inches (30-45 cm) high, composed
of mosses, grasses, and sedges. It resembles a muskrat house surrounded
by a moat. In making the nest, the vegetation is plucked from around
the nest site, creating a circle of open water up to 15 feet (4.6 m) in
diameter [2]. In optimum habitat, several pairs of swans may have nests
very widely spaced but still in view of one onother [10].

Winter habitat - In winter, tundra swans use extensive shallow fresh and
brackish water. They are less frequently found on salt water. Migrants
occur at ponds, lakes, flooded lowlands, slow-moving streches of rivers,
and estuaries [8,10].
  • 1. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 2. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 8. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]
  • 10. Palmer, Ralph S., editor. 1976. Handbook of North American birds. vol. 2. New Haven, CT: Yale University Press. 521 p. [21242]
  • 15. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the term: tundra

Tundra swans are generally found in wetland areas among aquatic and
emergent vegetation. They are commonly found feeding in extensive beds
of pondweeds (Potamogeton spp.) [10]. Other plant species found in
wetland areas occupied by tundra swans include willows (Salix spp.),
wild celery (Valisineria americana), smartweed (Polygonum persicaria),
muskgrasses (Characeae spp.), bulrushes (Scirpus spp.), horsetail
(Equisetum spp.), and sedges (Carex spp.) [10].

REFERENCES :
NO-ENTRY
  • 10. Palmer, Ralph S., editor. 1976. Handbook of North American birds. vol. 2. New Haven, CT: Yale University Press. 521 p. [21242]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K001 Spruce - cedar - hemlock forest
K008 Lodgepole pine - subalpine forest
K015 Western spruce - fir forest
K020 Spruce - fir - Douglas-fir forest
K021 Southwestern spruce - fir forest
K025 Alder - ash forest
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES26 Lodgepole pine
FRES28 Western hardwoods
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

16 Aspen
204 Black spruce
217 Aspen
218 Lodgepole pine
222 Black cottonwood - willow
223 Sitka spruce
225 Western hemlock - Sitka spruce
235 Cottonwood - willow

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Lakes, sloughs, rivers, sometimes fields, in migration. Open tundra marshy lakes and ponds and sluggish streams in summer. Shallow lakes, ponds, and estuaries in winter. Breeds on tundra near open water. Usually nests on islets or along shoreline of ponds, but may nest as far as 1/2 mile from water. The nest is a mound (1-2 ft x 2-3 ft) of mosses, grasses, and sedges (Terres 1980). Same site may be used in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Nearly all swans nesting along Beaufort Sea coast winter on Atlantic coast and migrate through Mackenzie Valley and along Yukon coast in spring (Johnson and Herter 1989). Northward migration over interior U.S. usually occurs in March-April. May arrive in some nesting areas as early as March; begins to arrive in Beaufort Sea area mid- to late May (Johnson and Herter 1989). Fall migration in Beaufort Sea region September-October; nesters from northeastern Alaska and Yukon North Slope migrate south through Mackenzie Valley to Peace-Athabasca delta, Alberta, where they apparently mix with western Alaska birds that nested in Yukon River delta; both populations congregate in large numbers at lakes Claire and Richardson in Peace-Athabasca delta before continuing overland to wintering areas (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tundra swans eat the stems, seeds, and bulbous roots of aquatic plants,
and the seeds and young shoots of cultivated grains. They also eat a
small amount of animal matter consisting mainly of the larvae of aquatic
beetles and dragon flies, worms, and mollusks [2,10].

Tundra swans feed on the following plants: foxtail (Alopecurus spp.) and
other grasses, wild celery, pondweeds, smartweeds, square-stem spike
rush (Eleocharis quadrangulata), arrowhead (Sagittaria spp.), coontail
(Ceratophyllum demersum), mermaid weed (Prosperinaca spp.), muskgrasses,
bulrushes, horsetail, wigeon grass (Ruppia maritima), and bur reed
(Sparganium spp.). Rice and barley are eaten in stubble fields [2,10].
Tundra swans also feed on waste corn in both dry and flooded fields and
upon harvested potatoes. These swans commonly fly as far as 10 to 15
miles (16-24 km) inland to glean waste corn and soybeans and to
browse upon shoots of winter wheat [2].
  • 2. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Palmer, Ralph S., editor. 1976. Handbook of North American birds. vol. 2. New Haven, CT: Yale University Press. 521 p. [21242]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on aquatic plants. Sago pondweed is a favorite food during brood-rearing period and molt (Johnson and Herter 1989). Also eats grasses, sedges and thin-shelled mollusks. Forages while swimming on the surface of the water, with head and neck below surface; roots and digs at plants, stimulating their growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

More info for the term: tundra

Little information is available in the literature regarding predation on
tundra swans. Bellrose [2] reported that nests have been destroyed by
gulls (Larus spp.) and foxes. The following species also occur in
tundra swan habitat and could potentially prey on tundra swans: coyotes
(Canis lutrans), river otters (Lutra canadensis), minks (Mustela vison),
black bears (Ursus americanus), grizzly bears (U. arctos), bald eagles
(Haliaetus leucocephalus), mountain lions (Felis concolor), skunks
(Mephitis spp. and Spilogale spp.), and raccoons (Procyon lotor). In a
few states, experimental hunting of tundra swans is allowed. Generally,
a one swan per hunter limit is imposed [10]. Taking of tundra swan eggs
and the hunting of flightless molting birds by Native Americans are
significant mortality factors in some areas [10].
  • 2. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Palmer, Ralph S., editor. 1976. Handbook of North American birds. vol. 2. New Haven, CT: Yale University Press. 521 p. [21242]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: See Johnson and Herter (1989) for population numbers in Beaufort Sea region. North American population numbers roughly 150,000-170,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: marsh, tundra

Fire occurring in wetland habitats often removes excessive accumulations
of fast-growing hydrophytes, permitting better waterfowl access, more
feeding and loafing areas, and growth of more desirable tundra swan
foods such as pondweeds [11,12]. In the Nebraska sandhills many
desirable plants for waterfowl, such as duckweeds (Lemna spp.), pondweeds,
and wild rice (Zizania spp.) become more abundant following fire because
more open water is created [11].

There may be some negative effects of burning waterfowl habitat.
Large-scale autumn burning may have a detrimental effect upon marshes by
reducing the retention of drifting snow. The ability of marsh
vegetation to catch and hold snow is vital to marsh survival [13].
  • 11. Schlichtemeier, Gary. 1967. Marsh burning for waterfowl. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 40-46. [16450]
  • 12. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers Fire Ecology Conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]
  • 13. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: tundra

Age at first breeding - Tundra swans first breed when they are 2 or
3 years old. They form lifelong monogamous pairs [10].

Nesting - Tundra swans start nesting in late May to late June depending
on location and weather [2,10].

Clutch size and incubation - Tundra swans generally lay a clutch of four
or five eggs [6,10]. The incubation period is 30 to 32 days [10].

Cygnet development and fledging - Tundra swan cygnets are generally able
to fly within 9 to 10 weeks. The family remains together during the
fall migration, through winter, and during spring migration [10].

Molt - On the Yukon Delta, adult tundra swans molt between July and
August and regain flight within 35 to 40 days. Nonbreeders, which
remain in flocks of 3 to 15 during the breeding season, regain flight in
late August and begin to congregate in sizable flocks [2].

Fall migration - Tundra swans migrate in family units, with several
families and probably some nonbreeding birds combining in a single flock
[2]. In the West, tundra swans leave major breeding grounds in Alaska
in late September and early October. Marshes adjoining the eastern
shore of Great Salt Lake begin to receive tundra swans in mid-October.
Tundra swans begin arriving at the Malheur National Wildlife Refuge in
Oregon from mid- to late November and remain abundant well into
December. In the Klamath basins of Oregon and California, wintering
tundra swans do not arrive in substantial numbers until late November
and early December. On winter grounds adjacent to San Francisco Bay,
the swans are not present in great numbers until early December [2].

The eastern contingent of tundra swans passes across Minnesota,
Wisconsin, and Michigan, largely during November 5 to 15. Tundra swans
on Chesapeake Bay slowly increase in numbers through December and reach
a peak in January [2].

Spring migration - Tundra swans begin leaving their winter habitat after
the first spring thaw [2]. Tundra swans from Chesapeake Bay cross
Pennsylvania to Lake Erie from the first week in March into early April.
Tundra swans leave their central California winter grounds in
mid-February, and within 3 weeks almost all have departed. By early
April most have migrated north to Alaska and Canada. The first swans
generally reach their breeding grounds on the Yukon Delta in late April
and almost all arrive by mid-May. The western population of tundra
swans migrate earlier and more swiftly than its eastern counterpart [2].
  • 2. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 6. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 10. Palmer, Ralph S., editor. 1976. Handbook of North American birds. vol. 2. New Haven, CT: Yale University Press. 521 p. [21242]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

May gather in large flocks to feed. Family groups of 6-7 individuals may form flocks and move together.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

seeds and roots of aquatic vegetation and shellfish
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 24.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding begins late May to June. Female incubates 5, sometimes 3-7 eggs for 30-32 days. Peak hatching usually is in late June-early July in Beaufort Sea region. Single-brooded. Young can fly at about 9-10 weeks, remain with the adults until the following spring (Harrison 1978). Probably first breeds at 3 years (may establish territory at 2 years). Substantial portion of birds in breeding areas may be nonbreeders. Highest nest density in Alaska: 1.5 nests per sq km in Yukon-Kuskokwim River delta (see Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cygnus columbianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cygnus columbianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTTTCCACTAACCATAAAGATATCGGCACCCTATACCTTATCTTCGGGGCATGAGCAGGAATAGTTGGCACCGCACTCAGCCTGTTAATCCGCGCAGAACTGGGACAACCGGGAACTCTCCTTGGTGACGACCAGATCTATAATGTAGTCGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATAGTCATGCCCATTATGATCGGGGGATTTGGTAACTGACTGGTCCCCCTTATAATCGGCGCCCCCGACATAGCATTCCCACGAATGAATAACATAAGCTTTTGACTCCTCCCACCATCATTTCTCCTGCTACTAGCCTCATCCACCGTAGAAGCTGGCGCCGGTACAGGCTGAACCGTCTACCCACCCCTAGCAGGCAACCTAGCCCACGCTGGAGCTTCAGTAGACCTGGCCATTTTCTCACTTCACTTAGCTGGCATCTCCTCCATCCTTGGAGCCATCAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACTCCACTATTCGTCTGATCCGTCCTAATTACCGCCATCCTACTACTTCTATCACTCCCTGTGCTTGCCGCAGGTATCACAATGCTATTAACCGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTATCAACACTTGTTCTGATTTTTCGGACACCCAGAAGTCTACATCCTAATCCTACCCGGATTCGGAATCATTTCACATGTAGTCACATACTACTCAGGCAAAAAAGAACCCTTCGGCTACATAGGAATAGTCTGAGCCATACTATCCATCGGCTTCCTAGGGTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGATACTCGAGCCTACTTTACATCAGCTACTATAATCATTGCCATTCCCACTGGAATCAAAGTATTTAGCTGACTAGCCACCCTACACGGAGGAACGATCAAGTGAGACCCCCCAATGCTATGAGCCCTAGGGTTCATCTTCCTGTTTACCATTGGAGGATTAACAGGAATCGTCCTTGCAAACTCATCTCTAGACATCGCCCTGCACGACACATACTACGTAGTTGCTCACTTCCATTACGTTCTATCTATAGGCGCCGTCTTCGCCATTCTAGCAGGATTTACCCACTGATTCCCACTCCTAACCGGATTTACCCTACACCAAACATGAGCAAAAGCCCACTTCGGAGTTATGTTCACAGGAGTAAACCTCACATTCTTCCCCCAACACTTCCTAGGCCTAGCAGGAATGCCCCGACGATACTCGGACTACCCCGACGCCTACACACTATGAAACACCGTATCCTCCATTGGCTCCTTAATCTCAATGGTAGCTGTAATCATACTAATATTCATCATTTGAGAAGCCTTCTCAGCTAAACGAAAAGTCCTACAACCAGAACTAACCGCCACAAACATTGAATGAATCCACGGCTGCCCTCCCCCATATCACACTTTCGAGGAACCGGCTTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N3N : N5B: Secure - Breeding, N3N: Vulnerable - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.300,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.50-10,000 wintering individuals in China and c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Mid-winter population index was increasing in the 1980s for the eastern population, well above USFWS management objective for both eastern and western populations (USFWS 1988). North American population now believed to be stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by the degradation and loss of wetland habitats due to drainage (Kear 2005a) (e.g. for agriculture [Grishanov 2006]), petroleum pollution, peat-extraction, changing wetland management practices (e.g. decreased grazing and mowing in meadows leading to scrub over-growth), the burning and mowing of reeds (Grishanov 2006) and eutrophication (Kear 2005a). Its Arctic breeding habitat is also threatened by oil and gas exploration (Kear 2005a). The species is threatened by mortality from oil pollution (oil spills) in moulting and pre-migrational staging areas, from collisions with powerlines, and from lead poisoning as a result of lead shot (del Hoyo et al. 1992, Kear 2005a) and fishing weight ingestion during migration and on wintering grounds (Kear 2005a). The species suffers from poaching in north-west Europe, is hunted for sport in North America (del Hoyo et al. 1992, Kear 2005a) and is hunted considerably for subsistence throughout its range (del Hoyo et al. 1992). The species is also susceptible to avian influenza, so may be threatened by future outbreaks of the disease (Melville and Shortridge 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the term: marsh

Prescribed burning is an effective method of manipulating waterfowl
habitat [11,14]. Fire can be used to convert forested uplands adjacent
to aquatic habitats to grasses and sedges, which are more suitable for
tundra swan nesting. Additionally, removal of dense vegetation and
prevention of woody encroachment is vital to prairie marsh maintenance
[12]. Less dense vegetation allows space for waterfowl movement and
activities [11]. According to Ward [13], spring burning in marshlands
is primarily done to remove vegetation and create more nesting edge for
waterfowl. Summer fires are used to create more permanent changes in
the plant community [13]. Prescribed burning during the nesting season
should be avoided so as not to disturb nesting females and/or destroy
nests and cygnets.
  • 11. Schlichtemeier, Gary. 1967. Marsh burning for waterfowl. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 40-46. [16450]
  • 12. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers Fire Ecology Conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]
  • 13. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]
  • 14. Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States and southern Canada. New York: John Wiley & Sons. 501 p. [2620]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the term: tundra

The tundra swan is the most common and widespread swan in North America
[15]. Winter surveys of tundra swans during the 1950's in the United
States revealed an average population of 78,000. This figure increased
to 98,000 during the 1960's and to 133,000 during 1970-74. The lowest
population recorded from 1949 to 1974 was in 1950 at 49,000, and the
highest was 157,000 in January 1971. Although the number of tundra
swans found on the winter surveys has varied considerably from year to
year, there has been a slow increase in the continental population over
the last 25 years [2].

REFERENCES :
NO-ENTRY
  • 2. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 15. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: See Castelli and Applegate (1989) for information on economic loss caused by swans feeding in cranberry bogs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tundra Swan

Whistling swan with yellow patch at base of bill.

The Tundra Swan (Cygnus columbianus) is a small Holarctic swan. The two taxa within it are usually regarded as conspecific, but are also sometimes[2][3] split into two species, Cygnus bewickii (Bewick's Swan) of the Palaearctic and the Whistling Swan, C. columbianus proper, of the Nearctic. Birds from eastern Russia (roughly east of the Taimyr Peninsula) are sometimes separated as the subspecies C. c. jankowskii, but this is not widely accepted as distinct, most authors including them in C. c. bewickii. Tundra Swans are sometimes separated in the genus Olor together with the other Arctic swan species.[2][4]

Bewick's Swan was named in 1830 by William Yarrell after the engraver Thomas Bewick, who specialised in illustrations of birds and animals.[5]

Description[edit]

C. columbianus is the smallest of the Holarctic swans, at 115–150 cm (45–59 in) in length, 168–211 cm (66–83 in) in wingspan and a weight range of 3.4–9.6 kg (7.5–21.2 lb).[6][7] In adult birds, the plumage of both subspecies is entirely white, with black feet, and a bill that is mostly black, with a thin salmon-pink streak running along the mouthline and – depending on the subspecies – more or less yellow in the proximal part. The iris is dark brown. In birds living in waters that contains large amounts of iron ions (e.g. bog lakes), the head and neck plumage acquires a golden or rusty hue. Pens (females) are slightly smaller than cobs (males), but do not differ in appearance otherwise.[2][4]

Adult (front) and half-year-old immature Bewick's Swans (C. c. bewickii) wintering in Saitama (Japan)

Immatures of both subspecies are white mixed with some dull grey feathering, mainly on the head and upper neck, which are often entirely light grey; their first-summer plumage is quite white already, and in their second winter they moult into the adult plumage. Their bills are black with a large dirty-pink patch taking up most of the proximal half and often black nostrils, and their feet are dark grey with a pinkish hue. Downy young are silvery grey above and white below.[2][4]

Bewick's Swans are the smaller subspecies. There is a slight size cline, with the eastern birds being slightly larger; good measurement data only exists for the western populations however. These weigh 3.4–7.8 kg (7.5–17.2 lb), 6.4 kg (14 lb) on average in males and 5.7 kg (13 lb) in females. They measure 115–140 cm (45–55 in) in overall length; each wing is 46.9–54.8 cm (18.5–21.6 in) long, on average 51.9 cm (20.4 in) in males and 50.4 cm (19.8 in) in females. The tarsus measures 9.2–11.6 cm (3.6–4.6 in) in length, the bill 8.2–10.2 cm (3.2–4.0 in), averaging 9.1 cm (3.6 in). Bewick's Swan is similar in appearance to the parapatric Whooper Swan (C. cygnus), but is smaller, shorter-necked and has a more rounded head shape, with variable bill pattern, but always showing more black than yellow and having a blunt forward edge of the yellow base patch. Whooper Swans have a bill that has more yellow than black and the forward edge of the yellow patch is usually pointed. The bill pattern for every individual Bewick's Swan is unique, and scientists often make detailed drawings of each bill and assign names to the swans to assist with studying these birds. The eastern birds, apart from being larger, tend towards less yellow on the bill, perhaps indicating that gene flow across Beringia, while marginal, never entirely ceased. An apparent case of hybridization between a Bewick's and a vagrant Whistling Swan has been reported from eastern Siberia.[2][4]

Adult Whistling Swans (C. c. columbianus). Click to magnify for seeing variation in the yellow bill spots.
Adult Whistling Swan in flight. Seen from below, all "Arctic" swans look almost identical.

Whistling Swans weigh 9.5–21 lb (4.3–9.5 kg) – 16 lb (7.3 kg) on average in males and 14 lb (6.4 kg) in females –, and measure 47–59 in (120–150 cm) in length. Each wing is 19.7–22.4 in (50–57 cm) long; the tarsus measures 3.7–4.5 in (9.4–11.4 cm) in length, and the bill is 3.6–4.2 in (9.1–10.7 cm) long. C. c. columbianus is distinguished from C. c. bewickii by its larger size and the mostly black bill, with just a small and usually hard to see yellow spot of variable size at the base. It is distinguished from the largely allopatric Trumpeter Swan (C. buccinator) of North America by that species' much larger size and particularly long bill, which is black all over except for the pink mouthline, which is stronger than in the Whistling Swan.[2][4]

Note that color variations with more or less yellow, or pink instead of yellow or black, are not exceptional, especially in Bewick's Swans, which very rarely may even have yellowish feet. The small size and particularly the rather short neck, which make it look like a large white goose, are still distinguishing marks.[2][4]

Tundra Swans have high-pitched honking calls and sound similar to a black goose (Branta). They are particularly vocal when foraging in flocks on their wintering grounds; any conspecific arriving or leaving will elicit a bout of loud excited calling from its fellows. Contrary to its common name, the ground calls of the Whistling Swan are not a whistle and neither notably different from that of Bewick's Swan. The flight call of the latter is a low and soft ringing bark, bow-wow...; the Whistling Swan gives a markedly high-pitched trisyllabic bark like wow-wow-wow in flight. By contrast, the Whooper and Trumpeter Swans' names accurately describe their calls – a deep hooting and a higher-pitched French horn-like honk, respectively. Flying birds of these species are shorter-necked and have a quicker wingbeat than their relatives, but they are often impossible to tell apart except by their calls.[2]

Distribution[edit]

Flock of adult and young Whistling Swans

As their common name implies, the Tundra Swan breeds in the Arctic and subarctic tundra, where they inhabit shallow pools, lakes and rivers. These birds, unlike Mute Swans (C. olor) but like the other Arctic swans, are migratory birds. The winter habitat of both subspecies is grassland and marshland, often near the coast; they like to visit fields after harvest to feed on discarded grains and while on migration may stop over on mountain lakes.[citation needed] According to National Geographic, when migrating these birds can fly at altitudes of 8 km (nearly 27,000 ft);[citation needed] Tundra Swan flocks usually fly in V formation.[2][4]

The breeding range of C. c. bewickii extends across the coastal lowlands of Siberia, from the Kola Peninsula east to the Pacific. They start to arrive on the breeding grounds around mid-May, and leave for winter quarters around the end of September. The populations west of the Taimyr Peninsula migrate via the White Sea, Baltic Sea and the Elbe estuary to winter in Denmark, the Netherlands and the British Isles. They are common in winter in the wildfowl nature reserves of the Royal Society for the Protection of Birds and of the Wildfowl and Wetlands Trust. Some birds also winter elsewhere on the southern shores of the North Sea. Bewick's Swans breeding in eastern Russia migrate via Mongolia and northern China to winter in the coastal regions of Korea, Japan, and southern China, south to Guangdong and occasionally as far as Taiwan. A few birds from the central Siberian range also winter in Iran at the south of the Caspian Sea; in former times these flocks also migrated to the Aral Sea before the late 20th century ecological catastrophe turned most of the habitat there into inhospitable wasteland. Arrival in winter quarters starts about mid-October, though most spend weeks or even months at favorite resting locations and will only arrive in winter quarters by November or even as late as January. The birds leave winter quarters to breed starting in mid-February. Vagrants may occur south of the main wintering range in cold years and have been recorded from most European countries where the birds do not regularly winter, as well as Algeria, Iraq, Palestine, Libya, Nepal, NE Pakistan, and on the Marianas and Volcano Islands in the western Pacific. Vagrants on the spring migration have been sighted on Bear Island, Iceland and Svalbard, and in Alaska, Oregon and Saskatchewan in North America.[2][4][8]

C. c. columbianus breeds in the coastal plains of Alaska and Canada, leaving for winter quarters about October. They arrive in winter quarters by November/December. Birds breeding in western Alaska winter along the Pacific coast from southern Alaska to California; they often move inland – particularly to the rich feeding grounds in the Californian Central Valley – and some cross the Rocky Mountains again and winter as far east as Utah and south to Texas and northern Mexico. The birds breeding along the Arctic Ocean coast migrate via Canada and the Great Lakes region to winter at the Atlantic coast of the USA, mainly from Maryland to South Carolina, but some move as far south as Florida. Whistling Swans start leaving for the breeding grounds again by mid-March, and arrive by late May. Vagrants have been recorded on the Bermudas, Cuba the Hawaiian Islands, Puerto Rico, and in England, Ireland, Japan, northeastern Siberia and Sweden.[2][4]

Ecology[edit]

A Bewick's Swan feeding by upending

In summer, their diet consists mainly of aquatic vegetation – e.g. mannagrass (Glyceria), Potamogeton pondweeds and marine eelgrass (Zostera), acquired by sticking the head underwater or upending while swimming; they also eat some grass growing on dry land. At other times of year, leftover grains and other crops such as potatoes, picked up in open fields after harvest, make up much of their diet. Tundra Swans forage mainly by day. In the breeding season, they tend to be territorial and are aggressive to many animals who pass by; outside the breeding season they are rather gregarious birds.[2][4]

Healthy adult birds have few natural predators. Arctic Foxes (Vulpes lagopus) may threaten breeding females and particular the eggs and hatchlings; they can be quite hard to scare away[citation needed]. Raccoons (Procyon lotor), very common in Canada, East Asia and Europe, eat eggs and young on occasion[citation needed]. About 15% of the adults die each year from various causes, and thus the average lifespan in the wild is about 10 years. The oldest recorded Tundra Swan was over 24 years old.[4][9][10]

Reproduction[edit]

The Tundra Swans mate in the late spring, usually after they have returned to the nesting grounds; as usual for swans, they pair monogamously until one partner dies. Should one partner die long before the other, the surviving bird often will not mate again for some years, or even for its entire life. The nesting season starts at the end of May. The pair build the large mound-shaped nest from plant material at an elevated site near open water, and defend a large territory around it. The pen (female) lays and incubates a clutch of 2–7 (usually 3–5) eggs, watching for danger while sitting on the nest. The cob (male) keeps a steady lookout for potential predators heading towards his mate and offspring[citation needed]. When either of them spots a threat, they give a warning sound to let their partner know that danger is approaching[citation needed]. Sometimes the cob will use his wings to run faster and appear larger in order to scare away a predator[citation needed].[2][4]

The time from laying to hatching is 29–30 days for Bewick's Swan and 30–32 days for the Whistling Swan. Since they nest in cold regions, Tundra Swan cygnets grow faster than those of swans breeding in warmer climates; those of the Whistling Swan take about 60–75 days to fledge – twice as fast as those of the Mute Swan for example – while those of Bewick's Swan, about which little breeding data is known, may fledge a record 40–45 days after hatching already. The fledglings stay with their parents for the first winter migration. The family is sometimes even joined by their offspring from previous breeding seasons while on the wintering grounds; Tundra Swans do not reach sexual maturity until 3 or 4 years of age.[4]

Conservation status[edit]

Woodcut by Robert Elliot Bewick of the swan named in memory of his father by William Yarrell. 1847 edition of Thomas Bewick's A History of British Birds.

The Whistling Swan is the most common swan species of North America, estimated to number almost 170,000 individuals around 1990. Its numbers seem to be slowly declining in the west of its range since the late 19th century, coincident with the expansion of human settlement and habitat conversion in the birds' wintering areas; the eastern Whistling Swan populations on the other hand seem to be increasing somewhat, and altogether its numbers seem to have slightly risen in the late 20th century (the population was estimated at about 146,000 in 1972). Bewick's Swan remains far less known; the European winter population was estimated at 16,000–17,000 about 1990, with about 20,000 birds wintering in East Asia. The Iranian wintering population is small – 1,000 birds or so at most – but they usually disperse to several sites, some of which are still unknown to scientists.[2][4]

Although Tundra Swan numbers are stable over most of its range, they are increasingly dependent on agricultural crops to supplement their winter diet, as aquatic vegetation in their winter habitat dwindles due to habitat destruction and water pollution. But the main cause of adult mortality is hunting; 4,000 Whistling Swans are bagged officially each year, while a further 6,000–10,000 are killed by poachers and native subsistence hunter-gatherers. Bewick's Swan cannot be hunted legally, but almost half the birds studied contained lead shot in their body, indicating they were shot at by poachers. Lead poisoning by ingestion of lead shot is a very significant cause of mortality also, particularly in the Whistling Swan. The Tundra Swan is not considered threatened by the IUCN due to its large range and population.[1] The proposed subspecies jankowskii was for some time placed on CITES Appendix II; it was eventually removed since it is not generally accepted as valid.[2][4][11]

Bewick's Swan is one of the birds to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Toxic mining wastes in the Silver Valley, Idaho in the United States has been known to be responsible for the death of migrating tundra swans.[12]

References[edit]

  1. ^ a b BirdLife International (2012). "Cygnus columbianus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m n o Madge, Steve & Burn, Hilary (1987): Wildfowl: an identification guide to the ducks, geese and swans of the world. Christopher Helm, London. ISBN 0-7470-2201-1
  3. ^ Rasmussen, Pamela C. & Anderton, John C. (2005): Birds of South Asia – The Ripley Guide. Lynx Edicions, Barcelona. ISBN 84-87334-67-9
  4. ^ a b c d e f g h i j k l m n o Carboneras, Carles (1992): 16. Tundra Swan. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Volume 1: Ostrich to Ducks): 579, plate 40. Lynx Edicions, Barcelona. ISBN 84-87334-10-5
  5. ^ Uglow, Jenny (2006). Nature's Engraver: A Life of Thomas Bewick. Faber and Faber, p. 396, ISBN 0226823911.
  6. ^ Bewick’s swan (Cygnus columbianus bewickii). Arkive.org.
  7. ^ Tundra Swan. All About Birds
  8. ^ Wiles, Gary J.; Johnson, Nathan C.; de Cruz, Justine B.; Dutson, Guy; Camacho, Vicente A.; Kepler, Angela Kay; Vice, Daniel S.; Garrett, Kimball L.; Kessler, Curt C. & Pratt, H. Douglas (2004). "New and Noteworthy Bird Records for Micronesia, 1986–2003". Micronesica 37 (1): 69–96. 
  9. ^ Wasser, D. E.; Sherman, P. W. (2010). "Avian longevities and their interpretation under evolutionary theories of senescence". Journal of Zoology 280 (2): 103. doi:10.1111/j.1469-7998.2009.00671.x.  edit
  10. ^ AnAge [2009]: Cygnus columbianus life history data. Retrieved 2009-JAN-05.
  11. ^ Littlejohn, Chase (1916). "Some unusual records for San Mateo County, California. Abstract in the Minutes of Cooper Club Meetings". Condor 18 (1): 38–40. doi:10.2307/1362896. 
  12. ^ Toxic marshes killing northern Idaho swans. Deseret News, April 19, 2009.

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

More info for the term: tundra

The currently accepted scientific name for the tundra swan is Cygnus
columbianus. There are two North American subspecies: Cygnus
columbianus ssp. columbianus (Ord) and C. columbianus ssp. bewickii
Yarrell (Bewick's swan) [1,16]. Hybrids have occurred among captive
stock between C. columbianus and the following species: Australian
black swan (C. atratus), mute swan (C. olor), whooper swan (C. cygnus),
trumpeter swan (C. buccinator), and Canada goose (Branta canadensis) [6].
  • 1. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 6. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 16. Kuchler, A. W. 1964. Manual to accompany the map of potential vegetation of the conterminous United States. Special Publication No. 36. New York: American Geographical Society. 77 p. [1384]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common Names

tundra swan
whistling swan
Bewick's swan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: C. columbianus and C. bewickii are sometimes considered distinct species (AOU 1983, 1998). See Meng et al. (1990) for information on variability of DNA fingerprints in C. cygnus, C. olor, and C. columbianus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!