Articles on this page are available in 3 other languages: Chinese (Simplified) (7), Spanish (11), Dutch (1) (learn more)

Overview

Brief Summary

Cygnus columbianus

Somewhat smaller (53 inches) and slimmer than the Mute Swan (Cygnus olor), the Tundra Swan is most easily identified by its size, black bill, and long straight neck. Other field marks include an all-white body, black legs, and short tail. Male and female Tundra Swans are alike at all seasons. Tundra Swans inhabit a large portion of the Northern Hemisphere. The North American subspecies breeds in coastal Alaska and northwestern Canada southeast to the Hudson Bay. Swans breeding in the western part of this range spend the winter along the Pacific coast of the United States and in the mountain west; swans breeding further east winter along the Atlantic coast from New Jersey to South Carolina. In the Old World, this species breeds in northern Siberia, wintering south to Western Europe and northern China. In summer, Tundra Swans breed in coastal lakes and ponds on the arctic tundra. During the winter, this species may be found in a variety of wetland habitats, including estuaries, lakes, and rivers. Tundra Swans primarily eat plant material, including aquatic grasses, seeds, and tubers. Due to the relative inaccessibility of this species’ breeding grounds, most birdwatchers never observe Tundra Swans during the summer months. In winter, they may be most easily observed while foraging for food, when they may be seen walking on the shore or on grass further inland. They also feed on the water, where they may be seen submerging their upper bodies to seek out aquatic vegetation. This species is primarily active during the day.

  • Cygnus columbianus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012.
  • Limpert, R. J. and S. L. Earnst. 1994. Tundra Swan (Cygnus columbianus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/089
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Tundra Swan (Cygnus columbianus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012.
  • eBird Range Map - Tundra Swan. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012.
translation missing: en.license_cc_by_nc_sa_4_0

© Smithsonian Institution

Supplier: Robert Costello

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bewick's swans are called 'small swans' in Dutch. Even though they are big birds, they are smaller than mute and whooper swans. Bewick's swans have more than 25,000 feathers on their body, providing excellent insulation when they are in northern Russia where they nest. They move south in the winter, where the grass is more tender than the withered tundra grass hidden under the snow. This swan is named after the illustrator Thomas Bewick.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are six species of swan. Swans are some of the largest birds on Earth and can both fly and swim. Tundra Swans get their name from the fact that they spend spring and summer in cold arctic areas. In winter they fly as far south as northern Mexico.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sebastian Velvez

Supplier: Life on Earth

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: Alaska and Canadian low Arctic; northern Russia east along Arctic coast to northern Siberia. WINTERS: mainly on Pacific and Atlantic coasts of North America from southern British Columbia to California and from New Jersey to South Carolina; Eurasia south to British Isles, northern Europe, southeastern Asia. Accidental in Hawaii, Puerto Rico, and elsewhere (AOU 1998). In the U.S., primary wintering areas include the Atlantic coast from northern South Carolina to southern New Jersey, the vicinity of the Great Salt Lake, and central and northern California (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

More info for the term: tundra

The tundra swan (C. columbianus ssp. columbianus) breeds from northern
Alaska (Point Barrow and Cape Prince of Wales), south to St. Lawrence
Island and the Alaska Peninsula, and east near the Arctic Coast to
Baffin Island, Hudson Bay, and Churchill and the Belcher islands.
Bewick's swan breeds from Russia east along the Arctic Coast to northern
Siberia. It occasionally occurs in Alaska and the Pacific Northwest
coast [1,6].

Cygnus columbianus ssp. columbianus winters in two regions. Populations
in Alaska and Yukon Territory chiefly winter in the Central Valley of
California, but some birds winter along Pacific coastal regions from
southern Alaska to California and east to Utah, southern Arizona, and
southern New Mexico. Tundra swans of the rest of the range migrate
southwards to winter in the interior Great Lakes region or on coastal
marshes from Maryland south to North Carolina, Florida, and Texas. The
tundra swan occasionally winters as far north as Maine [1,8]. Bewick's
swan winters in Eurasia in the British Isles, northern Europe, the
Caspian Sea, Japan, Korea, and the coast of China [1].

During migration, the tundra swan (C. columbianus ssp. columbianus)
occurs widely throughout interior North America on large bodies of
water. It is primarily found in the Great Basin, upper Mississippi
Valley, and the Great Lakes region, but also occurs in the Appalachian
Mountains in southern Pennsylvania and northern West Virginia [1].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America


AK AZ AR CA CO DE ID
IA MD MI MN MO MT NJ
NM NY NC ND OH OR PA
SC SD TX UT VA WA WI WY


AB BC MB NT ON PE PQ SK YK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Size

Length: 132 cm

Weight: 7100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory and travels on a narrow front via specific routes using well-known stop-over sites (Madge and Burn 1988) between its Arctic breeding and temperate wintering grounds (del Hoyo et al. 1992). It arrives on the breeding grounds from early-May to late-June (Madge and Burn 1988) (depending on local conditions [Kear 2005a]) where it breeds well-dispersed (Snow and Perrins 1998) in single pairs (del Hoyo et al. 1992), occasionally nesting semi-colonially in optimum habitats (Madge and Burn 1988, Kear 2005a). After breeding the species undergoes a flightless moulting period lasting for c.30 days between late-June and early-September, gathering in flocks on open waters (Madge and Burn 1988, Scott and Rose 1996). Family groups leave the breeding grounds from early-September to late-October (Madge and Burn 1988) and arrive on the wintering grounds from mid-October onwards (Madge and Burn 1988). During this autumn migration some groups may remain at stop-over sites until moved on by cold weather (Madge and Burn 1988). The return northward migration occurs from early-March, with the species travelling in small parties that disperse on arrival in the Arctic (Madge and Burn 1988). The species is gregarious outside of the breeding season, often gathering into large flocks of hundreds or thousands of individuals on the wintering grounds (Madge and Burn 1988, Kear 2005a). The species forages by day (where undisturbed [del Hoyo et al. 1992]) and roosts at night on open water (Kear 2005a). Habitat Breeding The species breeds near shallow pools, lakes (del Hoyo et al. 1992) and broad slow-flowing rivers (del Hoyo et al. 1992, Kear 2005a) with emergent littoral vegetation and pondweeds (e.g. Potamogeton spp.) connected to coastal delta areas (Kear 2005a) in open, moist, low-lying sedge-grass or moss-lichen (Kear 2005a) Arctic tundra (del Hoyo et al. 1992). It rarely nests in shrub tundra, and generally avoids forested areas (Kear 2005a). Non-breeding On migration the species frequents shallow ponds (Kear 2005a), lowland and upland lakes (Madge and Burn 1988, Kear 2005a), reservoirs (Madge and Burn 1988), riverine marshes, shallow saline lagoons (Kear 2005a) and sheltered coastal bays and estuaries (Madge and Burn 1988). During the winter it inhabits brackish and freshwater marshes (Madge and Burn 1988), rivers, lakes, ponds (Kear 2005a) and shallow tidal estuarine areas (del Hoyo et al. 1992, Kear 2005a) with adjacent grasslands (del Hoyo et al. 1992), flooded pastures (Kear 2005a) or agricultural arable fields (del Hoyo et al. 1992, Kear 2005a) below 100 m (Snow and Perrins 1998). Diet The species is predominantly herbivorous (del Hoyo et al. 1992), its diet consisting of the seeds, fruits, leaves, roots, rhizomes and stems of aquatic plants (e.g. Potamogeton, Zostera and Glyceria spp.), grasses (del Hoyo et al. 1992), sedges, reeds (Phragmites and Typha spp. [Kear 2005a]) and herbaceous tundra vegetation (Kear 2005a). During the winter the species complements its diet with agricultural grain and vegetables (del Hoyo et al. 1992) (e.g. potatoes [del Hoyo et al. 1992] and sugar beet [Kear 2005a]), and may also take estuarine invertebrates such as molluscs, amphipods (e.g. Corophium spp.) and polycheate worms on tidal mudflats prior to migration (Kear 2005a). Breeding site The nest is a large mound of plant matter positioned on elevated ground (del Hoyo et al. 1992) such as a ridge or hummock, often at some distance from feeding poolsto reduce to the risk of flooding (Kear 2005a). The species may re-use a nest from the previous year or build a new one, and although it is not colonial, many pairs may nest close together in optimum habitats (e.g. 5-16 pairs per 10 km2 [Kear 2005a]). Management information An experiment carried out in the Sacramento National Wildlife Refuge, California found that in wetland habitats where clay hardpans underlie wetland sediments tilling (plowing) the soil may be an effective means of reducing lead shot availability to waterfowl (Thomas et al. 2001). Plowing was found to reduce the amount of shot available to depths of 20-30 cm (below the foraging zone of the species [Thomas et al. 2001]).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

lakes, ponds, and streams and often frequent salt water bays and estuaries
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Lakes, sloughs, rivers, sometimes fields, in migration. Open tundra marshy lakes and ponds and sluggish streams in summer. Shallow lakes, ponds, and estuaries in winter. Breeds on tundra near open water. Usually nests on islets or along shoreline of ponds, but may nest as far as 1/2 mile from water. The nest is a mound (1-2 ft x 2-3 ft) of mosses, grasses, and sedges (Terres 1980). Same site may be used in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, tundra

Tall emergent vegetation provides shelter and cover for tundra swans.
Adult swans remove vegetation around the nest until the nest is
surrounded by open water [2,10].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: fresh, heath, marsh, tundra

Breeding habitat - Tundra swans usually breed on or near tundra ponds,
lakes, and sluggish rivers, and less often near sheltered tidal waters.
They tend to avoid areas near exposed marine coasts [1,8,10].

Nest sites - Tundra swans often select islets in tundra ponds and lakes
as nest sites [10]. Nests are also commonly located on the main shores
of lakes or ponds, heath tundras, hummocks in marshes or tidal meadows,
or more rarely, level stretches in marsh or meadow areas [2,15]. The
nest is an elaborate platform, 12 to 18 inches (30-45 cm) high, composed
of mosses, grasses, and sedges. It resembles a muskrat house surrounded
by a moat. In making the nest, the vegetation is plucked from around
the nest site, creating a circle of open water up to 15 feet (4.6 m) in
diameter [2]. In optimum habitat, several pairs of swans may have nests
very widely spaced but still in view of one onother [10].

Winter habitat - In winter, tundra swans use extensive shallow fresh and
brackish water. They are less frequently found on salt water. Migrants
occur at ponds, lakes, flooded lowlands, slow-moving streches of rivers,
and estuaries [8,10].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: tundra

Tundra swans are generally found in wetland areas among aquatic and
emergent vegetation. They are commonly found feeding in extensive beds
of pondweeds (Potamogeton spp.) [10]. Other plant species found in
wetland areas occupied by tundra swans include willows (Salix spp.),
wild celery (Valisineria americana), smartweed (Polygonum persicaria),
muskgrasses (Characeae spp.), bulrushes (Scirpus spp.), horsetail
(Equisetum spp.), and sedges (Carex spp.) [10].

REFERENCES :
NO-ENTRY

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K001 Spruce - cedar - hemlock forest
K008 Lodgepole pine - subalpine forest
K015 Western spruce - fir forest
K020 Spruce - fir - Douglas-fir forest
K021 Southwestern spruce - fir forest
K025 Alder - ash forest
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES26 Lodgepole pine
FRES28 Western hardwoods
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

16 Aspen
204 Black spruce
217 Aspen
218 Lodgepole pine
222 Black cottonwood - willow
223 Sitka spruce
225 Western hemlock - Sitka spruce
235 Cottonwood - willow

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Nearly all swans nesting along Beaufort Sea coast winter on Atlantic coast and migrate through Mackenzie Valley and along Yukon coast in spring (Johnson and Herter 1989). Northward migration over interior U.S. usually occurs in March-April. May arrive in some nesting areas as early as March; begins to arrive in Beaufort Sea area mid- to late May (Johnson and Herter 1989). Fall migration in Beaufort Sea region September-October; nesters from northeastern Alaska and Yukon North Slope migrate south through Mackenzie Valley to Peace-Athabasca delta, Alberta, where they apparently mix with western Alaska birds that nested in Yukon River delta; both populations congregate in large numbers at lakes Claire and Richardson in Peace-Athabasca delta before continuing overland to wintering areas (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on aquatic plants. Sago pondweed is a favorite food during brood-rearing period and molt (Johnson and Herter 1989). Also eats grasses, sedges and thin-shelled mollusks. Forages while swimming on the surface of the water, with head and neck below surface; roots and digs at plants, stimulating their growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Tundra swans eat the stems, seeds, and bulbous roots of aquatic plants,
and the seeds and young shoots of cultivated grains. They also eat a
small amount of animal matter consisting mainly of the larvae of aquatic
beetles and dragon flies, worms, and mollusks [2,10].

Tundra swans feed on the following plants: foxtail (Alopecurus spp.) and
other grasses, wild celery, pondweeds, smartweeds, square-stem spike
rush (Eleocharis quadrangulata), arrowhead (Sagittaria spp.), coontail
(Ceratophyllum demersum), mermaid weed (Prosperinaca spp.), muskgrasses,
bulrushes, horsetail, wigeon grass (Ruppia maritima), and bur reed
(Sparganium spp.). Rice and barley are eaten in stubble fields [2,10].
Tundra swans also feed on waste corn in both dry and flooded fields and
upon harvested potatoes. These swans commonly fly as far as 10 to 15
miles (16-24 km) inland to glean waste corn and soybeans and to
browse upon shoots of winter wheat [2].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

More info for the term: tundra

Little information is available in the literature regarding predation on
tundra swans. Bellrose [2] reported that nests have been destroyed by
gulls (Larus spp.) and foxes. The following species also occur in
tundra swan habitat and could potentially prey on tundra swans: coyotes
(Canis lutrans), river otters (Lutra canadensis), minks (Mustela vison),
black bears (Ursus americanus), grizzly bears (U. arctos), bald eagles
(Haliaetus leucocephalus), mountain lions (Felis concolor), skunks
(Mephitis spp. and Spilogale spp.), and raccoons (Procyon lotor). In a
few states, experimental hunting of tundra swans is allowed. Generally,
a one swan per hunter limit is imposed [10]. Taking of tundra swan eggs
and the hunting of flightless molting birds by Native Americans are
significant mortality factors in some areas [10].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: See Johnson and Herter (1989) for population numbers in Beaufort Sea region. North American population numbers roughly 150,000-170,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May gather in large flocks to feed. Family groups of 6-7 individuals may form flocks and move together.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: marsh, tundra

Fire occurring in wetland habitats often removes excessive accumulations
of fast-growing hydrophytes, permitting better waterfowl access, more
feeding and loafing areas, and growth of more desirable tundra swan
foods such as pondweeds [11,12]. In the Nebraska sandhills many
desirable plants for waterfowl, such as duckweeds (Lemna spp.), pondweeds,
and wild rice (Zizania spp.) become more abundant following fire because
more open water is created [11].

There may be some negative effects of burning waterfowl habitat.
Large-scale autumn burning may have a detrimental effect upon marshes by
reducing the retention of drifting snow. The ability of marsh
vegetation to catch and hold snow is vital to marsh survival [13].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: tundra

Age at first breeding - Tundra swans first breed when they are 2 or
3 years old. They form lifelong monogamous pairs [10].

Nesting - Tundra swans start nesting in late May to late June depending
on location and weather [2,10].

Clutch size and incubation - Tundra swans generally lay a clutch of four
or five eggs [6,10]. The incubation period is 30 to 32 days [10].

Cygnet development and fledging - Tundra swan cygnets are generally able
to fly within 9 to 10 weeks. The family remains together during the
fall migration, through winter, and during spring migration [10].

Molt - On the Yukon Delta, adult tundra swans molt between July and
August and regain flight within 35 to 40 days. Nonbreeders, which
remain in flocks of 3 to 15 during the breeding season, regain flight in
late August and begin to congregate in sizable flocks [2].

Fall migration - Tundra swans migrate in family units, with several
families and probably some nonbreeding birds combining in a single flock
[2]. In the West, tundra swans leave major breeding grounds in Alaska
in late September and early October. Marshes adjoining the eastern
shore of Great Salt Lake begin to receive tundra swans in mid-October.
Tundra swans begin arriving at the Malheur National Wildlife Refuge in
Oregon from mid- to late November and remain abundant well into
December. In the Klamath basins of Oregon and California, wintering
tundra swans do not arrive in substantial numbers until late November
and early December. On winter grounds adjacent to San Francisco Bay,
the swans are not present in great numbers until early December [2].

The eastern contingent of tundra swans passes across Minnesota,
Wisconsin, and Michigan, largely during November 5 to 15. Tundra swans
on Chesapeake Bay slowly increase in numbers through December and reach
a peak in January [2].

Spring migration - Tundra swans begin leaving their winter habitat after
the first spring thaw [2]. Tundra swans from Chesapeake Bay cross
Pennsylvania to Lake Erie from the first week in March into early April.
Tundra swans leave their central California winter grounds in
mid-February, and within 3 weeks almost all have departed. By early
April most have migrated north to Alaska and Canada. The first swans
generally reach their breeding grounds on the Yukon Delta in late April
and almost all arrive by mid-May. The western population of tundra
swans migrate earlier and more swiftly than its eastern counterpart [2].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

seeds and roots of aquatic vegetation and shellfish
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 24.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding begins late May to June. Female incubates 5, sometimes 3-7 eggs for 30-32 days. Peak hatching usually is in late June-early July in Beaufort Sea region. Single-brooded. Young can fly at about 9-10 weeks, remain with the adults until the following spring (Harrison 1978). Probably first breeds at 3 years (may establish territory at 2 years). Substantial portion of birds in breeding areas may be nonbreeders. Highest nest density in Alaska: 1.5 nests per sq km in Yukon-Kuskokwim River delta (see Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cygnus columbianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTTTCCACTAACCATAAAGATATCGGCACCCTATACCTTATCTTCGGGGCATGAGCAGGAATAGTTGGCACCGCACTCAGCCTGTTAATCCGCGCAGAACTGGGACAACCGGGAACTCTCCTTGGTGACGACCAGATCTATAATGTAGTCGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATAGTCATGCCCATTATGATCGGGGGATTTGGTAACTGACTGGTCCCCCTTATAATCGGCGCCCCCGACATAGCATTCCCACGAATGAATAACATAAGCTTTTGACTCCTCCCACCATCATTTCTCCTGCTACTAGCCTCATCCACCGTAGAAGCTGGCGCCGGTACAGGCTGAACCGTCTACCCACCCCTAGCAGGCAACCTAGCCCACGCTGGAGCTTCAGTAGACCTGGCCATTTTCTCACTTCACTTAGCTGGCATCTCCTCCATCCTTGGAGCCATCAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACTCCACTATTCGTCTGATCCGTCCTAATTACCGCCATCCTACTACTTCTATCACTCCCTGTGCTTGCCGCAGGTATCACAATGCTATTAACCGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTATCAACACTTGTTCTGATTTTTCGGACACCCAGAAGTCTACATCCTAATCCTACCCGGATTCGGAATCATTTCACATGTAGTCACATACTACTCAGGCAAAAAAGAACCCTTCGGCTACATAGGAATAGTCTGAGCCATACTATCCATCGGCTTCCTAGGGTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGATACTCGAGCCTACTTTACATCAGCTACTATAATCATTGCCATTCCCACTGGAATCAAAGTATTTAGCTGACTAGCCACCCTACACGGAGGAACGATCAAGTGAGACCCCCCAATGCTATGAGCCCTAGGGTTCATCTTCCTGTTTACCATTGGAGGATTAACAGGAATCGTCCTTGCAAACTCATCTCTAGACATCGCCCTGCACGACACATACTACGTAGTTGCTCACTTCCATTACGTTCTATCTATAGGCGCCGTCTTCGCCATTCTAGCAGGATTTACCCACTGATTCCCACTCCTAACCGGATTTACCCTACACCAAACATGAGCAAAAGCCCACTTCGGAGTTATGTTCACAGGAGTAAACCTCACATTCTTCCCCCAACACTTCCTAGGCCTAGCAGGAATGCCCCGACGATACTCGGACTACCCCGACGCCTACACACTATGAAACACCGTATCCTCCATTGGCTCCTTAATCTCAATGGTAGCTGTAATCATACTAATATTCATCATTTGAGAAGCCTTCTCAGCTAAACGAAAAGTCCTACAACCAGAACTAACCGCCACAAACATTGAATGAATCCACGGCTGCCCTCCCCCATATCACACTTTCGAGGAACCGGCTTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cygnus columbianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5