Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

The mute swan feeds chiefly on submerged aquatic vegetation, which is obtained by upending (tipping head first into the water, so that the tail remains visible above the surface) (4). It also feeds in fields on young cereal crops (8), spilt grain (4), and on artificial food sources, such as bread given by the public (3). Territorial disputes may result in aggressive fights between males, in which they rush at one another and slide along the surface of the water (2). Pairs typically nest solitarily, although semi-domesticated birds may nest in large colonies (6) (notably at Abbotsbury in Dorset) (8). The cone-shaped nest is built at the edge of the water, and may be used in subsequent years by the same pair (4). After mid-April, between 5 and 7 (up to 12) whitish or pale blue eggs are laid. They are incubated, mainly by the female, for 35-42 days; the young, known as 'cygnets', leave the nest soon after hatching (4). Both parents take care of the cygnets for an extended period, often until the next breeding season (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The mute swan is Britain's largest bird (3), and one of the heaviest flying birds in the world (4); adults can weigh over 15 kg (3). The combination of their large size, very long neck, white plumage and orange-red bill with a black knob towards the top of the bill makes them easily to recognise (2). Males (cobs) and females (pens) are similar in appearance, although males are slightly larger and have a more prominent knob on the bill (4). Juveniles are greyish-brown with a grey bill, which lacks the knob seen in adults (2). Contrary to the name, the mute swan produces a range of vocalisations, including a rumbling 'heeorr', and an aggressive hissing noise when threatened (2). The wings make a loud 'clanking' in flight (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to Eurasia. Introduced and established in North America, with breeding recorded locally from southern Saskatchewan, Great Lakes region (Michigan), southern New York and Connecticut south to central Missouri and along the Atlantic coast to Virginia; other populations have been recorded in the vicinity of Vancouver Island and in Oregon and Indiana; also in other areas of world. In the U.S., the highest winter densities occur in Michigan and along the eastern seaboard from Delaware to Massachusetts (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

North America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mute swans breed in the British Isles, north central Europe and north central Asia. They winter as far south as North Africa, the Near East, and to northwest India and Korea. They have been successfully introduced in North America, where they are a widespread species. They are a common breeding species and permanent resident in various locations throughout Michigan and the eastern United States.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Palearctic region; winters to India and se China.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mute swans breed in the British Isles, north central Europe and north central Asia. They winter as far south as North Africa, the Near East, and to northwest India and Korea. They have been successfully introduced in North America, where they are a widespread species and permanent residents in many areas.  (Reilly, 1968; Granlund, McPeek, and Adams, 1994)

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America - from southern New England along the eastern seaboard to the mid-Atlantic. Great Lakes, and some inland populations. Europe and Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found throughout Britain, but absent from high ground and areas without fresh water (3). After 1960, the population began to decline as a result of poisoning from lead fishing weights (3). Since the mid-1980s and the banning of lead weights however, the population has increased (5). Outside of Britain, the mute swan is known throughout Europe and central Asia (6); it has also been introduced to New Zealand, Australia, South Africa, and North America (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mute swans are large birds, measuring 144 to 158 cm. The wingspan is 2 to 2.5 meters. The two sexes are alike in appearance, except that males are generally larger than females. The plumage is white. They are best distinguished from North American swans by the knob at the base of the upper bill, and the color of the bill itself, which is orange, with the tip and base colored black. The head and neck may sometimes be stained brown from water and mud containing iron.

Range mass: 7600 to 14300 g.

Range length: 144 to 158 cm.

Range wingspan: 2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Mute swans are large birds, measuring 144 to 158 cm. The wingspan is 2 to 2.5 meters. The two sexes are alike in appearance, except that males are generally larger than females. The plumage is white. They are best distinguished from North American swans by the knob at the base of the upper bill, and the color of the bill itself, which is orange, with the tip and base colored black. The head and neck may sometimes be stained brown from water and mud containing iron. (Reilly, 1968; Terres, 1980)

Range mass: 7600 to 14300 g.

Range length: 144 to 158 cm.

Range wingspan: 2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 152 cm

Weight: 11800 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 142.5-155 cm, Wingspan: 187.5 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

marine waters (well-sheltered bays), open marshes, and ponds
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour Truly wild populations of this species are migratory (particularly where displaced by cold weather) (del Hoyo et al. 1992, Snow and Perrins 1998) although European and feral populations are essentially sedentary (Johnsgard 1978, del Hoyo et al. 1992, Scott and Rose 1996, Snow and Perrins 1998) or only locally migratory or nomadic (Scott and Rose 1996, Snow and Perrins 1998). The species breeds during the local spring (del Hoyo et al. 1992, Kear 2005a)as isolated pairs in well-defended territories (del Hoyo et al. 1992). After breeding the adults may gather in large concentrations of thousands or more (Johnsgard 1978, Madge and Burn 1988) on selected waters (Madge and Burn 1988) (non-breeders in northern Europe migrating to such gatherings (Snow and Perrins 1998)) between July and August (Scott and Rose 1996) to undergo a flightless moulting period lasting for 6-8 weeks (Kear 2005a). Although not noticeably sociable in many areas during the winter (Johnsgard 1978) the species may flock in groups of several thousands on favoured waters (Johnsgard 1978, Madge and Burn 1988, Scott and Rose 1996). Habitat The species inhabits a variety of lowland freshwater wetlands (del Hoyo et al. 1992) such as shallow lakes (Kear 2005a), ponds (Madge and Burn 1988), lagoons, marshes (del Hoyo et al. 1992), reedbeds (del Hoyo et al. 1992, Snow and Perrins 1998) and slow-flowing rivers (Kear 2005a) (showing a preference for clean, weed-filled streams over larger, polluted rivers) (Johnsgard 1978). It is also common on artificial waterbodies such as reservoirs, gravel-pits, ornamental lakes (del Hoyo et al. 1992), ditches (Snow and Perrins 1998) and canals (Scott and Rose 1996), and will graze on grassland and agricultural land (e.g. arable cereal fields) (Kear 2005a). Moulting congregations of adults and non-breeders (Snow and Perrins 1998) may also utilise brackish or saline habitats (Johnsgard 1978) including brackish marshes (Kear 2005a), estuaries and sheltered coastal sites (del Hoyo et al. 1992) (e.g. brackish lagoons (Kear 2005a) and bays (Madge and Burn 1988)). Diet Its diet consists predominantly of leaves and the vegetative parts of aquatic plants (Johnsgard 1978, del Hoyo et al. 1992) and grasses (del Hoyo et al. 1992) as well as algae (Johnsgard 1978) and grain (del Hoyo et al. 1992), occasionally also taking small amphibians (Johnsgard 1978, del Hoyo et al. 1992) (frogs, toads and tadpoles) (Snow and Perrins 1998) and aquatic invertebrates (e.g. molluscs, insects and worms) (Johnsgard 1978, del Hoyo et al. 1992). Breeding site The nest is a large mound of aquatic vegetation (del Hoyo et al. 1992, Kear 2005a) placed close to or floating on shallow water (del Hoyo et al. 1992, Kear 2005a) or amongst reeds (del Hoyo et al. 1992). Breeding pairs often re-use nesting sites from previous years if the it was successful (Johnsgard 1978). Management information The cyclical removal of adult fish from an artificial waterbody (gravel pit) in the UK resulted in an increase in the growth of submerged aquatic macrophytes and in turn led to an increase in the winter use of the habitat by the species (Giles 1994). The removed fish (dead or alive) were sold to generate funds (Giles 1994). A control of the breeding output of the species (brood reduction) carried out in the Wylye Valley, UK to try to alleviate the species's negative impacts on fisheries (e.g. by overgrazing submergent riverine vegetation) was found to be ineffective as it had an insignificant impact on local population sizes (possibly due to immigration from surrounding areas) (Watola et al. 2003).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mute swans are the most common swans in the wild, in parks or on country estates in their native range. In winter, they are more common on marine waters. They live in well-sheltered bays, open marshes, lakes, and ponds.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mute swans are the most common swans in the wild, in parks or on country estates in their native range. In winter, they are more common on marine waters. They live in well-sheltered bays, open marshes, lakes, and ponds. (Reilly, 1968; Terres, 1980)

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.408 - 11.597
  Nitrate (umol/L): 1.335 - 6.602
  Salinity (PPS): 6.428 - 34.849
  Oxygen (ml/l): 6.474 - 7.967
  Phosphate (umol/l): 0.273 - 0.484
  Silicate (umol/l): 3.994 - 9.916

Graphical representation

Temperature range (°C): 9.408 - 11.597

Nitrate (umol/L): 1.335 - 6.602

Salinity (PPS): 6.428 - 34.849

Oxygen (ml/l): 6.474 - 7.967

Phosphate (umol/l): 0.273 - 0.484

Silicate (umol/l): 3.994 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open and quiet waters of lakes, ponds, marshes, and sluggish rivers, also in brackish and protected marine situations in winter (AOU 1983). Nests usually at water's edge on land or small islands, or in reed beds in shallow water, primarily in freshwater areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fresh and saltwater ponds, coastal lagoons, saltwater bays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in a wide range of water bodies, including rivers, lakes, ponds, reservoirs, flood waters, tidal estuaries, and sheltered coasts (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In North America, makes short local migrations or does not migrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Little in North America. In Eurasia, long distance migrations take place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mute swans eat mainly aquatic vegetation, but include small proportions of Insecta, Actinopterygii, and Lissamphibia. Mute swans plunge their head and long neck below the water's surface to graze.. Swans feed in deeper waters than ducks and other waterfowl that share their habitat and thus do not compete with them directly for food. Rather, food is made more readily available to other birds by swans because parts of the plants they consume float to the surface while the swans are feeding. However, mute swans compete with other swans for food because they feed in similar ways.

Animal Foods: insects; mollusks; aquatic or marine worms

Plant Foods: leaves; roots and tubers; algae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The diet of mute swans consists of aquatic vegetation, and small proportions of aquatic insects, fish, and frogs. Mute swans do not dive, instead they plunge their head and long neck below the water's surface. Swans feed in deeper waters than ducks and other waterfowl that share their habitat and thus do not compete with them directly for food. Rather, food is made more readily available to other birds by swans because parts of the plants they consume float to the surface while the swans are feeding. However, mute swans compete with other swans for food because they feed in similar ways.  (Reilly, 1968; Terres, 1980;   http://aztec.inre.asu.edu/phxzoo/swanmute.html)

Animal Foods: insects; mollusks; aquatic or marine worms

Plant Foods: leaves; roots and tubers; algae

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly aquatic plants pulled up from bottom in shallow water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant material mostly, aquatic and sometimes terrestrial grasses. Also consumes insects, snails, tadpoles, worms, and small fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Mute swans impact aquatic vegetation communities through their grazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mute swans are large and aggressive birds. As adults they are not often preyed on unless they are old or ill. Eggs and hatchlings are vulnerable to nest predation by Procyon lotor, Mustela vison, and a wide variety of other medium to large-sized predators. But swan parents are typically present to protect their young.

Known Predators:

  • raccoons (Procyon_lotor)
  • American minks (Mustela_vison)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
fluke of Cotylurus cornutus endoparasitises small intestine of Cygnus olor

Animal / parasite / endoparasite
fluke of Filicollis anatis endoparasitises small intestine of Cygnus olor

Animal / parasite / endoparasite
tapeworm of Nematoparataenia southwelli endoparasitises small intestine of Cygnus olor

Animal / parasite / endoparasite
fluke of Polymorphus minutus endoparasitises small intestine of Cygnus olor

Animal / parasite / ectoparasite / blood sucker
Theromyzon tessulatum sucks the blood of nasal passage of Cygnus olor

Animal / parasite / endoparasite
fluke of Typhlocoelum sisowi endoparasitises trachea of Cygnus olor

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Mute swans impact aquatic vegetation communities through their grazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mute swans are large and aggressive birds. As adults they are not often preyed on unless they are old or ill. Eggs and hatchlings are vulnerable to nest predation by raccoons, mink, and a wide variety of other medium to large-sized predators. But swan parents are typically present to protect their young.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Cygnus olor is prey of:
Amidostomum
Catatropis terrucosa

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Cygnus olor preys on:
Enteromorpha
aquatic or marine worms
algae
Mollusca
Insecta

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Introduced swans in southern New England occupy and defend territories against conspecific individuals year-round, except when mid-winter ice prevents occupancy. Some swans defend their territories also against waterfowl of other species, though interference with the nesting of other species has not been documented. As of the early 1990s, no impact of swans on aquatic vegetation was evident (Conover and Kania 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

aquatic vegetation, aquatic insects, fish and frogs
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Mute swans have keen vision and hearing. Mute swans are usually silent, as the name suggests. Adults sometimes snort and make hissing noises or puppy-like barking notes or whistles, though the sounds are not far-reaching due to their straight trachea. Also, the sound of the wings during flight, which has been described as a musical throbbing or humming, is very audible. They also use visual displays as a form of communication, such as postures. For example, in an aggressive posture, males often arch their secondary wing feathers over the back.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Mute swans have keen vision and hearing. Mute swans are usually silent, as the name suggests. Adults sometimes snort and make hissing noises or puppy-like barking notes or whistles, though the sounds are not far-reaching due to their straight trachea. Also, the sound of the wings during flight, which has been described as a musical throbbing or humming, is very audible. They also use visual displays as a form of communication, such as postures. For example, in an aggressive posture, males often arch their secondary wing feathers over the back.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The greatest age recorded for a banded mute swan was 19 years. In captivity, they have lived 30 to 40 years.

Range lifespan

Status: wild:
19 (high) years.

Range lifespan

Status: captivity:
30-40 (high) years.

Average lifespan

Status: wild:
321 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The greatest age recorded for a banded mute swan was 19 years. In captivity, they have lived 30 to 40 years.

Range lifespan

Status: wild:
19 (high) years.

Range lifespan

Status: captivity:
30-40 (high) years.

Average lifespan

Status: wild:
321 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 70 years (captivity) Observations: In the wild, these animals can live up to 26.8 years (http://bna.birds.cornell.edu/). There are anecdotal reports, which might be true, of animals living up to 70 years in captivity (John Terres 1980). IMR in the wild is probably less than 0.1. Breeding performance tends to decline after about age 12 (McCleery et al. 2008).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mute swans do not mate for life, contrary to the stereotype of the 'pining swan' who has lost its mate. In fact, some have been observed to have as many as four mates, or even 'divorce' one mate in favor of another. However, established pairs are more successful breeders than non-established pairs and mute swans do mate with only one other swan during each breeding season.

Mating System: monogamous

Mute swans rarely nest in colonies. Nest sites are selected and breeding begins in March or early April. These swans either build a new nest or use a previously constructed mound, such as a muskrat house. The nest is large, made of aquatic vegetation, and lined with feathers and down. It is built well above the normal water level in swampy places near a pond or lake. It is possible for clutches of 5 to 12 to occur, but 5 to 7 is most common. The eggs are pale gray to pale blue-green. Incubation lasts 36 to 38 days. The chicks are brownish gray (gradually turning white within the next 12 months) and only remain in the nest for one day. The male may often take the first-hatched cygnet (hatchling swan) to the water while the female continues to incubate the remaining eggs. They are able to fly in about 60 days. Chicks can ride on the backs of their parents or under their wings. By the following breeding season the parents drive the young away. The cygnets then join flocks of other non-breeding swans, and during this time molt their feathers, becoming flightless for a short period of time. In the next two years, the cygnets begin to bond with a mate and begin to look for suitable breeding territory. Swans do not begin to breed until about their third year.

Breeding interval: Mute swans breed once yearly.

Breeding season: Breeding begins in March and April.

Range eggs per season: 5 to 12.

Average eggs per season: 5-7.

Range time to hatching: 36 to 38 days.

Average fledging age: 60 days.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

The sexes share incubation, though the female spends the majority of time sitting, and the male usually stands guard.

Even in semi-domestication, the nest is strongly defended; swans have been known to attack other waterfowl and even people. Blows from their powerful wings can be especially painful. They can be dangerous to children, and are capable of killing or maiming some of the larger predators.

Parental Investment: precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults are not paired for life, contrary to the stereotype of the 'pining swan' who has lost its mate. In fact, some have been observed to have as many as four mates, or even 'divorce' one mate in favor of another. However, established pairs are more successful breeders than non-established pairs and mute swans do form monogamous pairs for at least a season.

Mating System: monogamous

Mute swans rarely nest in colonies. Nest sites are selected and breeding begins in March or early April. These swans either build a new nest or use a previously constructed mound, such as a muskrat house. The nest is large, made of aquatic vegetation, and lined with feathers and down. It is built well above the normal water level in swampy places near a pond or lake. It is possible for clutches of 5 to 12 to occur, but 5 to 7 is most common. The eggs are pale gray to pale blue-green. Incubation lasts 36 to 38 days. The chicks are brownish gray (gradually turning white within the next 12 months) and only remain in the nest for one day. The male may often take the first-hatched cygnet to the water while the female continues to incubate the remaining eggs. They are able to fly in about 60 days. Chicks can ride on the backs of their parents or under their wings. By the following breeding season the parents drive the young away. The cygnets then join flocks of other non-breeding swans, and during this time molt their feathers, becoming flightless for a short period of time. In the next two years, the cygnets begin to bond with a mate and begin to look for suitable breeding territory. Swans do not begin to breed until about their third year. (Granlund, McPeek and Adams, 1994; Reilly, 1968; Terres, 1980;   http://www.airtime.co.uk/users/cygnus/muteswan.htm;   http://www.aztec.inre.asu.edu/phxzoo/swanmute.html)

Breeding interval: Mute swans breed once yearly.

Breeding season: Breeding begins in March and April.

Range eggs per season: 5 to 12.

Average eggs per season: 5-7.

Range time to hatching: 36 to 38 days.

Average fledging age: 60 days.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

The sexes share incubation, though the female spends the majority of time sitting, and the male usually stands guard.

Even in semi-domestication, the nest is strongly defended; swans have been known to attack other waterfowl and even people. Blows from their powerful wings can be especially painful. They can be dangerous to children, and are capable of killing or maiming some of the larger predators.

Parental Investment: precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size averages 4-6. Incubation lasts 34-38 days, mainly or entirely by female. Young are tended by both parents, independent at about 4 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Form pairs at 2 years old. First breed at 3-4 years old. Nest built by female, near water's edge or on small mound in shallow water. 5-7 eggs laid, incubated for 36 days mostly by the female. Both parents look after hatched young through their first winter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cygnus olor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cygnus olor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGACATTGGCACCCTATACCTTATCTTCGGGGCATGGGCAGGAATAGTCGGCACCGCACTCAGTCTGTTAATCCGCGCAGAACTAGGACAGCCAGGAACCCTCCTCGGCGACGACCAAATTTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATTTTCTTCATAGTCATACCCATTATGATCGGAGGGTTCGGCAACTGACTAGTCCCCCTCATAATCGGCGCCCCCGACATAGCATTCCCACGAATGAATAACATAAGCTTCTGACTCCTTCCACCATCATTTCTCCTGCTGCTAGCCTCATCTACCGTAGAAGCCGGAGCCGGCACAGGCTGAACTGTCTACCCACCCCTAGCAGGTAACCTGGCCCACGCCGGAGCCTCAGTAGACCTAGCCATTTTCTCACTTCACTTAGCTGGTGTTTCCTCCATCCTCGGAGCTATTAACTTTATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTGTTCGTCTGATCCGTCCTAATTACTGCCATCCTACTACTCCTGTCACTCCCTGTACTCGCCGCAGGTATCACAATGCTGCTAACCGACCGAAACCTAAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATTCTATACCAACACCTATTCTGATTTTTTGGGCACCCAGAAGTCTATATCCTAATCTTGCCAGGATTTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The successful introduction and expansion of mute swans into North America may pose significant concerns to native wildlife. Gavia immer (threatened in Michigan) and recently re-introduced Cygnus buccinator are two species of primary concern. The North American population of mute swans has been increasing steadily since its introduction. These birds are aggressive, and have been known to drive off such stubborn and similarly sized species as Branta canadensis and Cygnus buccinator. Wildlife managers seek to control non-native mute swans in areas where native wildlife is being threatened.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The successful introduction and consequent expansion of mute swans into North America has begun to pose significant concerns to native wildlife. Common loons (threatened in Michigan) and recently re-introduced trumpeter swans are two species of primary concern. The North American population of mute swans has been increasing steadily since its introduction. These birds are aggressive, and have been known to drive off such stubborn and similarly sized species as Canada geese and trumpeter swans. Wildlife managers seek to control non-native mute swans in areas where native wildlife is being threatened. (Granlund, McPeek, and Adams, 1994)

There was a high incidence of lead poisoning in the mute swans of Great Britain, caused by the swans' ingestion of discarded lead shot that became entangled in aquatic vegetation. Since this problem was discovered, it is no longer a major threat to mute swan populations in Britain. (  http://www.airtime.co.uk/users/cygnus/muteswan.htm)

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No official conservation status. Populations in North America are increasing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Widespread and common species, not listed under any conservation designations (3). Included in the Birds of Conservation Concern Amber List (medium conservation concern) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.600,000-610,000 individuals (Wetlands International 2006), while national population estimates include:
Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species suffers heavy losses from lead poisoning due to ingested lead fishing weights (del Hoyo et al. 1992, Kelly and Kelly 2004), lead shot (Spray and Milne 1988) and lead contaminated sediments from mining and smelting activities (Day et al. 2003). Heavy losses have also been recorded from local incidences of copper poisoning (Kobayashi et al. 1992). The ingestion of or entanglement in fishing lines and/or hooks can also cause severe injury or mortality (Kelly and Kelly 2004) as can collisions with overhead lines (del Hoyo et al. 1992). The species may be threatened by future oil spills (which can cause death by oil saturation) (Berglund et al. 1963). The species is also susceptible to avian influenza (Melville and Shortridge 2006)(e.g. strain H5N1) (Nagy et al. 2007) so may be threatened by future outbreaks of the virus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Harsh winters and poisoning from lead fishing weights were responsible for the decline of the mute swan population in Britain. A series of mild winters combined with the banning of lead weights has resulted in the recovery of the numbers of this beautiful bird (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: "Egg shaking" has been used to reduce reproductive success in the northeastern U.S. where the species is regarded as a pest and threat to native waterfowl; however, negative public response has limited or eliminated the use of this technique in some areas. Rhode Island population has continued to grow despite an intensive egg-shaking program.

See Allin et al. (1987) for information on management needs in the Atlantic Flyway.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Strong lobbying to ban lead fishing weights has enabled mute swans to recover from the crash in numbers caused by lead poisoning. They will also have benefited from action carried out for other species of wildfowl, such as the creation and management of wetland nature reserves (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Swans may attack people who approach their nests too closely. There are records of them knocking boaters off of jet skis. An adult swan can seriously injure children.

In addition, mute swans are thought to pose a threat to native wildlife as a result of competition for food, territories, and nesting areas.

Negative Impacts: injures humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mute swans were domesticated for food in Britain. Markings on their feet indicated ownership. Eventual domestication saved the bird from becoming hunted to extinction there. Feathers were also used as quills for writing, the leathery web used for purses, and the wing bones for making whistles.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Swans may attack people who approach their nests too closely. There are records of them knocking boaters off of jet skis. An adult swan can seriously injure children.

In addition, mute swans are thought to pose a threat to native wildlife as a result of competition for food, territories, and nesting areas.

Negative Impacts: injures humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mute swans were domesticated for food in Britain. Markings on their feet indicated ownership. Eventual domestication saved the bird from becoming hunted to extinction there. Feathers were also used as quills for writing, the leathery web used for purses, and the wing bones for making whistles. (  http://www.airtime.co.uk.users/cygnus/muteswan/htm)

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Populations on the U.S. east coast are growing; regarded as Regarded as a pest and threat to native waterfowl in the northeastern U.S. (Allin et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mute Swan

The Mute Swan (Cygnus olor) is a species of swan, and thus a member of the waterfowl family Anatidae. It is native to much of Europe and Asia, and (as a rare winter visitor) the far north of Africa. It is also an introduced species in North America, Australasia and southern Africa. The name 'mute' derives from it being less vocal than other swan species.[2][3][4] Measuring 125 to 170 cm (49 to 67 in) in length, this large swan is wholly white in plumage with an orange bill bordered with black. It is recognisable by its pronounced knob atop the bill.

Taxonomy[edit]

The Mute Swan was first formally described by the German naturalist Johann Friedrich Gmelin as Anas olor in 1789, and was transferred by Johann Matthäus Bechstein to the new genus Cygnus in 1803. It is the type species of the genus Cygnus.[5] Both cygnus and olor mean "swan" in Latin; cygnus is related to the Greek kyknos.[6][7]

Despite its Eurasian origin, its closest relatives are the Black Swan of Australia and the Black-necked Swan of South America, not the other Northern Hemisphere swans.[2] The species is monotypic with no living subspecies.[2][4]

Evolution[edit]

Mute Swan subfossils, 6,000 years old, have been found in post-glacial peat beds of East Anglia, Great Britain.[8] They have also been recorded from Ireland east to Portugal and Italy,[9] and from France, 13,000 BP (Desbrosse and Mourer-Chauvire 1972–1973).[full citation needed] The paleosubspecies Cygnus olor bergmanni, which differed only in size from the living bird, is known from fossils found in Azerbaijan.[citation needed]

Fossils of swan ancestors more distantly allied to the Mute Swan have been found in four U.S. states: California, Arizona, Idaho and Oregon.[10] The timeline runs from the Miocene to the late Pleistocene, or 10,000 BP. The latest find was in Anza Borrego Desert, a national park in California.[10] Fossils from the Pleistocene include Cygnus paloregonus from Fossil Lake, Oregon, Froman's Ferry, Idaho, and Arizona, referred to by Howard in The Waterfowl of the World as "probably the mute type swan".[11]

Description[edit]

"Polish Swan" on the right
Finding food underwater

Adults of this large swan typically range from 140 to 160 cm (55 to 63 in) long, although can range in extreme cases from 125 to 170 cm (49 to 67 in), with a 200 to 240 cm (79 to 94 in) wingspan.[4][12] Males are larger than females and have a larger knob on their bill. On average, this is the second largest waterfowl species after the Trumpeter Swan, although male Mute Swans can easily match or even exceed a male Trumpeter in mass.[4][13] Among standard measurements of the Mute Swan, the wing chord measures 53–62.3 cm (20.9–24.5 in), the tarsus is 10–11.8 cm (3.9–4.6 in) and the bill is 6.9–9 cm (2.7–3.5 in).[4]

The Mute Swan is one of the heaviest flying birds, with males (known as cobs) averaging about 11–12 kg (24–26 lb) and the slightly smaller females (known as pens) weighing about 8.5–9 kg (19–20 lb).[4][14] While the top normal weight for a big cob is 15 kg (33 lb), one unusually big Polish cob weighed almost 23 kg (51 lb) and this counts as the largest verified weight for a flying bird, although it has been questioned whether this heavyweight could still take flight.[15]

Young birds, called cygnets, are not the bright white of mature adults, and their bill is dull greyish-black, not orange, for the first year. The down may range from pure white to grey to buff, with grey/buff the most common. The white cygnets have a leucistic gene. All Mute Swans are white at maturity, though the feathers (particularly on the head and neck) are often stained orange-brown by iron and tannins in the water.[16]

The morph immutabilis ("Polish Swan") has pinkish (not dark grey) legs and dull white cygnets; as with white domestic geese, it is only found in populations with a history of domestication.[17]

Behaviour[edit]

Mute swans courting

Mute Swans nest on large mounds that they build with waterside vegetation in shallow water on islands in the middle or at the very edge of a lake. They are monogamous and often reuse the same nest each year, restoring or rebuilding it as needed. Male and female swans share the care of the nest, and once the cygnets are fledged it is not uncommon to see whole families looking for food.They feed on a wide range of vegetation, both submerged aquatic plants which they reach with their long necks, and by grazing on land. The food commonly includes agricultural crop plants such as oilseed rape and wheat, and feeding flocks in the winter may cause significant crop damage, often as much through trampling with their large webbed feet, as through direct consumption.[18]

Unlike Black Swans, Mute Swans are usually strongly territorial with just a single pair on smaller lakes, though in a few locations where a large area of suitable feeding habitat is found they can be colonial. The largest colonies have over 100 pairs, such as at the colony at Abbotsbury Swannery in southern England, and at the southern tip of Öland Island, Ottenby Preserve, in the coastal waters of the Baltic Sea, and can have nests spaced as little as 2 m (7 ft) apart.[17][19] Non-mated juveniles up to 3–4 years old also commonly form larger flocks, which can total several hundred birds, often at regular traditional sites.[20] A notable flock of non-breeding birds is found on the River Tweed estuary at Berwick-upon-Tweed in northeastern England, with a maximum count of 787 birds.[21] Once the adults are mated they seek out their own territories and often live close to ducks and gulls, which may take advantage of the swan's ability to reach deep water weeds, which tend to spread out on the water surface.[citation needed]

The Mute Swan is less vocal than the noisy Whooper and Bewick's Swans; the most familiar sound associated with Mute Swan is the vibrant throbbing of the wings in flight. This sound is unique to the species, and can be heard from a range of 1 to 2 km (0.6 to 1 mi), indicating its value as a contact sound between birds in flight.[17] They do however make a variety of grunting, hoarse whistling, and snorting noises, especially in communicating with their cygnets, and usually hiss at predators trying to enter their territory.[citation needed]

Nesting in early spring, Aabach (Greifensee) in Wetzikon, Switzerland

Mute Swans can be very aggressive in defence of their nests. Most defensive attacks from a Mute Swan begin with a loud hiss and, if this is not sufficient to drive off the predator, are followed by a physical attack. Swans attack by smashing at their enemy with bony spurs in the wings, accompanied by biting with their large bill. The wings of the swan are very powerful, anecdotally reported to exert enough force to break an adult man's leg.[22] Large waterfowl, such as Canada Geese, (more likely out of competition than in response to potential predation) may also be aggressively driven off, and Mute Swans regularly attack people who enter their territory.[23] The cob is also responsible for defending the cygnets while on the water, and will sometimes attack small watercraft, such as canoes, that it feels are a threat to its young. The cob will additionally try and chase the predator out of his family territory, and will keep animals such as foxes and raptors at bay. In New York (outside its native range), the most common predators of cygnets are common snapping turtles.[23] Healthy adults are rarely predated, though canids such as coyotes, felids such as lynxes, and bears can pose a threat to infirm ones (healthy adults can usually swim away from danger unless defending nests) and there are a few cases of healthy adults falling prey to Golden Eagles.[24][25]

The familiar pose with neck curved back and wings half raised, known as busking, is a threat display. Both feet are paddled in unison during this display, resulting in more jerky movement.[26]

Distribution and habitat[edit]

Landing on a canal in Ireland

The Mute Swan is found naturally mainly in temperate areas of Europe across western Asia, as far east as the Russian Maritimes, near Sidemi.[27]

It is partially migratory throughout northern latitudes in Europe and Asia, as far south as north Africa and the Mediterranean. It is known and recorded to have nested in Iceland and is a vagrant to that area, as well as to Bermuda, according to the U.N. Environmental Programme chart of international status chart of bird species, which places it in 70 countries, breeding in 49 countries, and vagrant in 16 countries.[citation needed] While most of the current population in Japan is introduced, Mute Swans are depicted on scrolls more than a thousand years old, and wild birds from the mainland Asian population still occur rarely in winter. Natural migrants to Japan usually occur along with Whooper and sometimes Bewick's Swans.[citation needed]

The Mute Swan is protected in most of its range, but this has not prevented illegal hunting and poaching. It is often kept in captivity outside its natural range, as a decoration for parks and ponds, and escapes have happened. The descendants of such birds have become naturalised in the eastern United States and Great Lakes, much as the Canada Goose has done in Europe.[citation needed]

World population[edit]

Native populations[edit]

The total native population of Mute Swans is about 500,000 birds at the end of the breeding season (adults plus young), of which 350,000 are in the former Soviet Union.[2] The largest single breeding concentration is 11,000 pairs in the Volga Delta.[3]

The population in the United Kingdom is about 22,000 birds, as of the 2006–2007 winter,[28] a slight decline from the peak of about 26,000-27,000 birds in 1990.[3] This includes about 5,300 breeding pairs, the remainder being immatures.[29] Other significant populations in Europe include 6,800-8,300 breeding pairs in Germany, 4,500 pairs in Denmark, 4,000-4,200 pairs in Poland, 3,000-4,000 pairs in the Netherlands, about 2,500 pairs in Ireland, and 1,200-1,700 pairs in Ukraine.[3]

For many centuries, Mute Swans in Britain were domesticated for food, with individuals being marked by nicks on their webs (feet) or beaks to indicate ownership. These marks were registered with the Crown and a Royal Swanherd was appointed. Any birds not so marked became Crown property, hence the swan becoming known as the "Royal Bird". It is quite possible that this domestication saved the swan from being hunted to extinction in Britain.[30][31][31]

Populations in western Europe were largely exterminated by hunting pressure in the 13th–19th centuries, with the exception of semi-domesticated birds maintained as poultry by large landowners. Better protection in the late 19th and early 20th centuries allowed birds to return to most or all of their former range.[32][33] More recently in the period from about 1960 up to the early 1980s, numbers declined significantly again in many areas, primarily due to lead poisoning from birds swallowing discarded fishing sinkers made from lead. After lead weights were replaced by other less toxic alternatives, Mute Swan numbers increased again rapidly.[3]

Introduced populations[edit]

Since being introduced into North America, the Mute Swan has increased greatly in number, to the extent that it is considered as an invasive species. Populations introduced into other areas remain are small, with around 200 in Japan, less than 200 in New Zealand and Australia, and about 120 in South Africa.[2]

North America[edit]

The Mute Swan was introduced to North America in the late 19th century. Recently, it has been widely viewed as an invasive species because of its rapidly increasing numbers and adverse effects on other waterfowl and native ecosystems. For example, a study of population sizes in the lower Great Lakes from 1971 to 2000 found that Mute Swan numbers were increasing at an average rate of at least 10% per year, doubling the population every seven to eight years.[34] Several studies have concluded that Mute Swans severely reduce densities of submerged vegetation where they occur.[35]

In 2003, the U.S. Fish and Wildlife Service proposed to "minimize environmental damages attributed to Mute Swans" by reducing their numbers in the Atlantic Flyway to pre-1986 levels, a 67% reduction at the time. According to a report published in the Federal Register of 2003[36] the proposal was supported by all thirteen state wildlife agencies which submitted comments, as well as by 43 bird conservation, wildlife conservation and wildlife management organisations. Ten animal rights organisations and the vast majority of comments from individuals were opposed. At this time Mute Swans were protected under the Migratory Bird Treaty Act due to a court order, but in 2005 the United States Department of the Interior officially declared them a non-native, unprotected species.[37] Mute Swans are protected in some areas of the U.S. by local laws, as for example in Connecticut.[38]

The status of the Mute Swan as an introduced species in North America is disputed by the interest group "Save The Mute Swans".[39] They assert that Mute Swans are native in the region and therefore deserving of protection. They claim that Mute Swans had origins from Russia and cite historical sightings and fossil records. These claims have been rejected as specious by the U.S. Department of the Interior.[37]

Oceania[edit]

The Mute Swan had absolute protection in New Zealand under the Wildlife Act 1953 but this was changed in June 2010 to a lower level of protection. It still has protection, but is now allowed to be killed or held in captivity at the discretion of the Minister of Conservation.[40]

A small feral population exists in the vicinity of Perth, Australia, however is believed to number less than 100 individuals.

Cultural references[edit]

References[edit]

  1. ^ BirdLife International (2012). "Cygnus olor". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e del Hoyo, J., et al., ed. (1992). Handbook of the Birds of the World 1. Barcelona: Lynx Edicions. pp. 577–78. ISBN 84-87334-10-5. 
  3. ^ a b c d e Snow, D. W.; Perrins, C. M. (1998). The Birds of the Western Palearctic (Concise ed.). Oxford: Oxford University Press. ISBN 0-19-854099-X. 
  4. ^ a b c d e f Madge, S.; Burn, H. (1987). Wildfowl: An Identification Guide to the Ducks, Geese and Swans of the World. A & C Black. ISBN 0-7470-2201-1. 
  5. ^ Cheng, Tso-hsin (1987). A Synopsis of the Avifauna of China. Beijing: Science Press. pp. 48–49. ISBN 3-490-12518-5. 
  6. ^ Liddell, Henry George; Scott, Robert (1980). A Greek-English Lexicon (Abridged ed.). United Kingdom: Oxford University Press. ISBN 0-19-910207-4. 
  7. ^ Simpson, D.P. (1979). Cassell's Latin Dictionary (5th ed.). London: Cassell. ISBN 0-304-52257-0. 
  8. ^ Northcote, E.M. (1981). "Size difference between limb bones of recent and subfossil Mute Swans (Cygnus olor)". J. Archeol. Sci. 8 (1): 89–98. doi:10.1016/0305-4403(81)90014-5. 
  9. ^ Palmer, R.S. (1976). Handbook of North American Birds 2. New Haven: Yale University Press. 
  10. ^ a b Jefferson, G.T. (2005). Fossil Treasures of the Anza-Borrego Desert. p. 153. 
  11. ^ The Waterfowl of the World. pp. 262–265. 
  12. ^ Mullarney, K., Svensson, L, Zetterstrom, D., & Grant, P.J. (1999) Collins Bird Guide. HarperCollins Publishers Ltd, London p. 14
  13. ^ del Hoyo, et al, Handbook of the Birds of the World. Volume 1: Ostrich to Ducks (Handbooks of the Birds of the World). Lynx Edicions (1992), ISBN 978-84-87334-10-8
  14. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  15. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  16. ^ "The Mute Swan | Birds of Eden". Birds of Eden. Retrieved 26 March 2014. 
  17. ^ a b c Cramp, S., chief editor (1977). The Birds of the Western Palearctic. Oxford: Oxford University Press. ISBN 0-19-857358-8. 
  18. ^ Parrott, D.; McKay, H. V. (2001). "Mute swan grazing on winter crops: Estimation of yield loss in oilseed rape and wheat. Mute swans occasionally eat insects, amphibians and smaller birds". J. Crop Protection 20: 913–919. 
  19. ^ Hogan, C. M. (2006). Environmental Database for Oland, Sweden. Lumina Press. 
  20. ^ Scott, P.; Wildfowl Trust (1972). Behavioral patterns of juvenile Mute Swans. 
  21. ^ "The Berwick Swan and Wildlife Trust". 
  22. ^ [1]
  23. ^ a b "Mute Swan". New York Department of Environmental Conservation. Retrieved 2012-05-03. 
  24. ^ "ADW: Cygnus olor: INFORMATION". Animaldiversity.ummz.umich.edu. Retrieved 2012-05-03. 
  25. ^ Watson, Jeff (2011). The Golden Eagle: Second Edition. ISBN 978-0=30017-019-1 Check |isbn= value (help). 
  26. ^ "Topic: Busking". Bird On! Bird Care. Retrieved 26 March 2014. 
  27. ^ Dement'ev, G.P.; Gladkov, N.A. (1967). Birds of the Soviet Union IV. U.S. Fish & Wildlife Translation. 
  28. ^ Austin, G.; Collier, M.; Calbrade, N.; Hall, C.; & Musgrove, A. (2008). Waterbirds in the UK 2006/07. Thetford: Wetland Bird Survey. ISBN 978-1-906204-33-4. 
  29. ^ Baker, H. et al. (2006). "Population estimates of birds in Great Britain". British Birds 99: 25–44. 
  30. ^ http://www.northwestswanstudy.org.uk/old/muteswan.htm
  31. ^ a b http://www.thamesweb.co.uk/swans/upping2.html
  32. ^ Ticehurst, N. E. (1957). The Mute Swan in England. London: Cleaver-Hume Press. 
  33. ^ Holloway, S. (1996). The Historical Atlas of Breeding Birds in Britain and Ireland 1875–1900. London: Poyser. ISBN 0-85661-094-1. 
  34. ^ Petrie, Scott A.; Francis, Charles M. (2010). "Rapid increase in the lower Great Lakes population of feral mute swans: a review and a recommendation". Wildlife Society Bulletin 31 (2): 407. 
  35. ^ Allin, Charles C.; and Husband, Thomas P. (September 2003). "Mute Swan (Cygnus olor) impact on submerged aquatic vegetation and macroinvertebrates in a Rhode Island coastal pond". Northeastern Naturalist 10 (3): 305–318. doi:10.1656/1092-6194(2003)010[0305:MSCOIO]2.0.CO;2. ISSN 1092-6194. 
  36. ^ Williams, Steve. "Finding of No Significant Impact and Final Environmental Assessment for the Management of Mute Swans in the Atlantic Flyway" (PDF). Federal Register 68 (152): 47085. 
  37. ^ a b "Final List of Bird Species to Which the Migratory Bird Treaty Act Does Not Apply" (PDF). 
  38. ^ "Bird lovers, Conn. are at odds on swans". Boston Globe. 24 December 2007. Retrieved 7 April 2009. 
  39. ^ "Mute Swan Advocacy". Mute Swan Advocacy. Retrieved 2012-05-03. 
  40. ^ "Protection status changes to Wildlife Act". New Zealand Government. 10 June 2010. 
  41. ^ British Monarchy website regarding swan upping and the Crown's ownership of Mute Swans.
  42. ^ "Swan Watch: The Bishop's Swans". Retrieved 2013-09-04. 
  43. ^ Slack, Donovan (12 August 2005). "Thou art no Romeo". The Boston Globe. Retrieved 26 December 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Meng et al. (1990) for information on variability of DNA fingerprints in C. cygnus, C. olor, and C. columbianus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!