Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

The mute swan feeds chiefly on submerged aquatic vegetation, which is obtained by upending (tipping head first into the water, so that the tail remains visible above the surface) (4). It also feeds in fields on young cereal crops (8), spilt grain (4), and on artificial food sources, such as bread given by the public (3). Territorial disputes may result in aggressive fights between males, in which they rush at one another and slide along the surface of the water (2). Pairs typically nest solitarily, although semi-domesticated birds may nest in large colonies (6) (notably at Abbotsbury in Dorset) (8). The cone-shaped nest is built at the edge of the water, and may be used in subsequent years by the same pair (4). After mid-April, between 5 and 7 (up to 12) whitish or pale blue eggs are laid. They are incubated, mainly by the female, for 35-42 days; the young, known as 'cygnets', leave the nest soon after hatching (4). Both parents take care of the cygnets for an extended period, often until the next breeding season (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The mute swan is Britain's largest bird (3), and one of the heaviest flying birds in the world (4); adults can weigh over 15 kg (3). The combination of their large size, very long neck, white plumage and orange-red bill with a black knob towards the top of the bill makes them easily to recognise (2). Males (cobs) and females (pens) are similar in appearance, although males are slightly larger and have a more prominent knob on the bill (4). Juveniles are greyish-brown with a grey bill, which lacks the knob seen in adults (2). Contrary to the name, the mute swan produces a range of vocalisations, including a rumbling 'heeorr', and an aggressive hissing noise when threatened (2). The wings make a loud 'clanking' in flight (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 145-160 cm, envergure 208-238 cm, poids 7-16 kg.

Les oiseaux d’Europe de l’Ouest, introduits et domestiqués à l’origine, sont largement conditionnés à la présence humaine et dépendent fréquemment d’habitats artificiels et de nourrissage. Ils préfèrent les rivières au cours régulé, les canaux, les plans d’eau ornementaux ou de carrières, les réservoirs… Plus à l’est, l’espèce évite l’homme et s’installe préférentiellement sur les lacs pourvus de hauts fonds garnis de végétation aquatique.

Le Cygne se nourrit surtout de végétaux aquatiques qu’il obtient en plongeant la tête jusqu’à 1 m de profondeur. Il mange aussi des graines et des plantes émergentes à la surface, ou des graminées qu’il broute à terre. Les quelques animaux consommés régulièrement incluent des amphibiens et leurs larves, des mollusques, vers et insectes.

Les couples sont territoriaux durant la saison de reproduction, voire au-delà, tandis que les non-nicheurs sont grégaires toute l’année et peuvent constituer des groupes de plusieurs dizaines d’individus. Si la nidification n’a pas été menée à son terme, les couples de Cygnes quittent souvent leur territoire avant la mue des ailes, qui les empêchera de voler, pour rejoindre les sites traditionnels de mue. La monogamie et la fidélité sont la norme, mâle et femelle restant en couple après la saison de nidification. La formation du couple est longue. Elle débute parmi les juvéniles dans les groupes hivernaux, puis les parades augmentent jusqu’au 2e été, âge où une première reproduction est possible. La plupart s’associent à leur partenaire mais ne pondent que la saison suivante, à l’âge de 3 ou 4 ans (les femelles étant un peu plus précoces). Le territoire est tenu de février à octobre, sur une superficie qui dépend de la configuration du site. Une minorité nichent en petite colonie et ne défendent que le site de nid. Les adultes et particulièrement les mâles sont très agressifs.

Le nid est un monceau de joncs, roseaux, etc., de 1 à 2 m de diamètre à la base, voire jusqu’à 4 m quand il est fait dans l’eau. La ponte de 5-8 œufs est déposée à partir de la mi-mars. L’incubation dure 35-41 jours et les jeunes sont volants à l’âge de 120-150 jours. Ceux-ci sont souvent transportés par la femelle, rarement par le mâle, durant leurs 10 premiers jours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to Eurasia. Introduced and established in North America, with breeding recorded locally from southern Saskatchewan, Great Lakes region (Michigan), southern New York and Connecticut south to central Missouri and along the Atlantic coast to Virginia; other populations have been recorded in the vicinity of Vancouver Island and in Oregon and Indiana; also in other areas of world. In the U.S., the highest winter densities occur in Michigan and along the eastern seaboard from Delaware to Massachusetts (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

North America
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mute swans breed in the British Isles, north central Europe and north central Asia. They winter as far south as North Africa, the Near East, and to northwest India and Korea. They have been successfully introduced in North America, where they are a widespread species and permanent residents in many areas.  (Reilly, 1968; Granlund, McPeek, and Adams, 1994)

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mute swans breed in the British Isles, north central Europe and north central Asia. They winter as far south as North Africa, the Near East, and to northwest India and Korea. They have been successfully introduced in North America, where they are a widespread species. They are a common breeding species and permanent resident in various locations throughout Michigan and the eastern United States.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic region; winters to India and se China.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America - from southern New England along the eastern seaboard to the mid-Atlantic. Great Lakes, and some inland populations. Europe and Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found throughout Britain, but absent from high ground and areas without fresh water (3). After 1960, the population began to decline as a result of poisoning from lead fishing weights (3). Since the mid-1980s and the banning of lead weights however, the population has increased (5). Outside of Britain, the mute swan is known throughout Europe and central Asia (6); it has also been introduced to New Zealand, Australia, South Africa, and North America (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Mute swans are large birds, measuring 144 to 158 cm. The wingspan is 2 to 2.5 meters. The two sexes are alike in appearance, except that males are generally larger than females. The plumage is white. They are best distinguished from North American swans by the knob at the base of the upper bill, and the color of the bill itself, which is orange, with the tip and base colored black. The head and neck may sometimes be stained brown from water and mud containing iron. (Reilly, 1968; Terres, 1980)

Range mass: 7600 to 14300 g.

Range length: 144 to 158 cm.

Range wingspan: 2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Mute swans are large birds, measuring 144 to 158 cm. The wingspan is 2 to 2.5 meters. The two sexes are alike in appearance, except that males are generally larger than females. The plumage is white. They are best distinguished from North American swans by the knob at the base of the upper bill, and the color of the bill itself, which is orange, with the tip and base colored black. The head and neck may sometimes be stained brown from water and mud containing iron.

Range mass: 7600 to 14300 g.

Range length: 144 to 158 cm.

Range wingspan: 2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 152 cm

Weight: 11800 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 142.5-155 cm, Wingspan: 187.5 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Truly wild populations of this species are migratory (particularly where displaced by cold weather) (del Hoyo et al. 1992, Snow and Perrins 1998) although European and feral populations are essentially sedentary (Johnsgard 1978, del Hoyo et al. 1992, Scott and Rose 1996, Snow and Perrins 1998) or only locally migratory or nomadic (Scott and Rose 1996, Snow and Perrins 1998). The species breeds during the local spring (del Hoyo et al. 1992, Kear 2005a)as isolated pairs in well-defended territories (del Hoyo et al. 1992). After breeding the adults may gather in large concentrations of thousands or more (Johnsgard 1978, Madge and Burn 1988) on selected waters (Madge and Burn 1988) (non-breeders in northern Europe migrating to such gatherings (Snow and Perrins 1998)) between July and August (Scott and Rose 1996) to undergo a flightless moulting period lasting for 6-8 weeks (Kear 2005a). Although not noticeably sociable in many areas during the winter (Johnsgard 1978) the species may flock in groups of several thousands on favoured waters (Johnsgard 1978, Madge and Burn 1988, Scott and Rose 1996). Habitat The species inhabits a variety of lowland freshwater wetlands (del Hoyo et al. 1992) such as shallow lakes (Kear 2005a), ponds (Madge and Burn 1988), lagoons, marshes (del Hoyo et al. 1992), reedbeds (del Hoyo et al. 1992, Snow and Perrins 1998) and slow-flowing rivers (Kear 2005a) (showing a preference for clean, weed-filled streams over larger, polluted rivers) (Johnsgard 1978). It is also common on artificial waterbodies such as reservoirs, gravel-pits, ornamental lakes (del Hoyo et al. 1992), ditches (Snow and Perrins 1998) and canals (Scott and Rose 1996), and will graze on grassland and agricultural land (e.g. arable cereal fields) (Kear 2005a). Moulting congregations of adults and non-breeders (Snow and Perrins 1998) may also utilise brackish or saline habitats (Johnsgard 1978) including brackish marshes (Kear 2005a), estuaries and sheltered coastal sites (del Hoyo et al. 1992) (e.g. brackish lagoons (Kear 2005a) and bays (Madge and Burn 1988)). Diet Its diet consists predominantly of leaves and the vegetative parts of aquatic plants (Johnsgard 1978, del Hoyo et al. 1992) and grasses (del Hoyo et al. 1992) as well as algae (Johnsgard 1978) and grain (del Hoyo et al. 1992), occasionally also taking small amphibians (Johnsgard 1978, del Hoyo et al. 1992) (frogs, toads and tadpoles) (Snow and Perrins 1998) and aquatic invertebrates (e.g. molluscs, insects and worms) (Johnsgard 1978, del Hoyo et al. 1992). Breeding site The nest is a large mound of aquatic vegetation (del Hoyo et al. 1992, Kear 2005a) placed close to or floating on shallow water (del Hoyo et al. 1992, Kear 2005a) or amongst reeds (del Hoyo et al. 1992). Breeding pairs often re-use nesting sites from previous years if the it was successful (Johnsgard 1978). Management information The cyclical removal of adult fish from an artificial waterbody (gravel pit) in the UK resulted in an increase in the growth of submerged aquatic macrophytes and in turn led to an increase in the winter use of the habitat by the species (Giles 1994). The removed fish (dead or alive) were sold to generate funds (Giles 1994). A control of the breeding output of the species (brood reduction) carried out in the Wylye Valley, UK to try to alleviate the species's negative impacts on fisheries (e.g. by overgrazing submergent riverine vegetation) was found to be ineffective as it had an insignificant impact on local population sizes (possibly due to immigration from surrounding areas) (Watola et al. 2003).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.408 - 11.597
  Nitrate (umol/L): 1.335 - 6.602
  Salinity (PPS): 6.428 - 34.849
  Oxygen (ml/l): 6.474 - 7.967
  Phosphate (umol/l): 0.273 - 0.484
  Silicate (umol/l): 3.994 - 9.916

Graphical representation

Temperature range (°C): 9.408 - 11.597

Nitrate (umol/L): 1.335 - 6.602

Salinity (PPS): 6.428 - 34.849

Oxygen (ml/l): 6.474 - 7.967

Phosphate (umol/l): 0.273 - 0.484

Silicate (umol/l): 3.994 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

marine waters (well-sheltered bays), open marshes, and ponds
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mute swans are the most common swans in the wild, in parks or on country estates in their native range. In winter, they are more common on marine waters. They live in well-sheltered bays, open marshes, lakes, and ponds. (Reilly, 1968; Terres, 1980)

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open and quiet waters of lakes, ponds, marshes, and sluggish rivers, also in brackish and protected marine situations in winter (AOU 1983). Nests usually at water's edge on land or small islands, or in reed beds in shallow water, primarily in freshwater areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mute swans are the most common swans in the wild, in parks or on country estates in their native range. In winter, they are more common on marine waters. They live in well-sheltered bays, open marshes, lakes, and ponds.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.408 - 11.597
  Nitrate (umol/L): 1.335 - 6.602
  Salinity (PPS): 6.428 - 34.849
  Oxygen (ml/l): 6.474 - 7.967
  Phosphate (umol/l): 0.273 - 0.484
  Silicate (umol/l): 3.994 - 9.916

Graphical representation

Temperature range (°C): 9.408 - 11.597

Nitrate (umol/L): 1.335 - 6.602

Salinity (PPS): 6.428 - 34.849

Oxygen (ml/l): 6.474 - 7.967

Phosphate (umol/l): 0.273 - 0.484

Silicate (umol/l): 3.994 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fresh and saltwater ponds, coastal lagoons, saltwater bays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in a wide range of water bodies, including rivers, lakes, ponds, reservoirs, flood waters, tidal estuaries, and sheltered coasts (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In North America, makes short local migrations or does not migrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little in North America. In Eurasia, long distance migrations take place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of mute swans consists of aquatic vegetation, and small proportions of aquatic insects, fish, and frogs. Mute swans do not dive, instead they plunge their head and long neck below the water's surface. Swans feed in deeper waters than ducks and other waterfowl that share their habitat and thus do not compete with them directly for food. Rather, food is made more readily available to other birds by swans because parts of the plants they consume float to the surface while the swans are feeding. However, mute swans compete with other swans for food because they feed in similar ways.  (Reilly, 1968; Terres, 1980;   http://aztec.inre.asu.edu/phxzoo/swanmute.html)

Animal Foods: insects; mollusks; aquatic or marine worms

Plant Foods: leaves; roots and tubers; algae

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly aquatic plants pulled up from bottom in shallow water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mute swans eat mainly aquatic vegetation, but include small proportions of Insecta, Actinopterygii, and Lissamphibia. Mute swans plunge their head and long neck below the water's surface to graze.. Swans feed in deeper waters than ducks and other waterfowl that share their habitat and thus do not compete with them directly for food. Rather, food is made more readily available to other birds by swans because parts of the plants they consume float to the surface while the swans are feeding. However, mute swans compete with other swans for food because they feed in similar ways.

Animal Foods: insects; mollusks; aquatic or marine worms

Plant Foods: leaves; roots and tubers; algae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Plant material mostly, aquatic and sometimes terrestrial grasses. Also consumes insects, snails, tadpoles, worms, and small fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Mute swans impact aquatic vegetation communities through their grazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mute swans are large and aggressive birds. As adults they are not often preyed on unless they are old or ill. Eggs and hatchlings are vulnerable to nest predation by raccoons, mink, and a wide variety of other medium to large-sized predators. But swan parents are typically present to protect their young.

Known Predators:

  • raccoons (Procyon lotor)
  • American minks (Neovison vison)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Mute swans impact aquatic vegetation communities through their grazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mute swans are large and aggressive birds. As adults they are not often preyed on unless they are old or ill. Eggs and hatchlings are vulnerable to nest predation by Procyon lotor, Mustela vison, and a wide variety of other medium to large-sized predators. But swan parents are typically present to protect their young.

Known Predators:

  • raccoons (Procyon_lotor)
  • American minks (Mustela_vison)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
fluke of Cotylurus cornutus endoparasitises small intestine of Cygnus olor

Animal / parasite / endoparasite
fluke of Filicollis anatis endoparasitises small intestine of Cygnus olor

Animal / parasite / endoparasite
tapeworm of Nematoparataenia southwelli endoparasitises small intestine of Cygnus olor

Animal / parasite / endoparasite
fluke of Polymorphus minutus endoparasitises small intestine of Cygnus olor

Animal / parasite / ectoparasite / blood sucker
Theromyzon tessulatum sucks the blood of nasal passage of Cygnus olor

Animal / parasite / endoparasite
fluke of Typhlocoelum sisowi endoparasitises trachea of Cygnus olor

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Cygnus olor is prey of:
Amidostomum
Catatropis terrucosa

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Cygnus olor preys on:
Enteromorpha
aquatic or marine worms
algae
Mollusca
Insecta

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Introduced swans in southern New England occupy and defend territories against conspecific individuals year-round, except when mid-winter ice prevents occupancy. Some swans defend their territories also against waterfowl of other species, though interference with the nesting of other species has not been documented. As of the early 1990s, no impact of swans on aquatic vegetation was evident (Conover and Kania 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

aquatic vegetation, aquatic insects, fish and frogs
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mute swans have keen vision and hearing. Mute swans are usually silent, as the name suggests. Adults sometimes snort and make hissing noises or puppy-like barking notes or whistles, though the sounds are not far-reaching due to their straight trachea. Also, the sound of the wings during flight, which has been described as a musical throbbing or humming, is very audible. They also use visual displays as a form of communication, such as postures. For example, in an aggressive posture, males often arch their secondary wing feathers over the back.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Mute swans have keen vision and hearing. Mute swans are usually silent, as the name suggests. Adults sometimes snort and make hissing noises or puppy-like barking notes or whistles, though the sounds are not far-reaching due to their straight trachea. Also, the sound of the wings during flight, which has been described as a musical throbbing or humming, is very audible. They also use visual displays as a form of communication, such as postures. For example, in an aggressive posture, males often arch their secondary wing feathers over the back.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The greatest age recorded for a banded mute swan was 19 years. In captivity, they have lived 30 to 40 years.

Range lifespan

Status: wild:
19 (high) years.

Range lifespan

Status: captivity:
30-40 (high) years.

Average lifespan

Status: wild:
321 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The greatest age recorded for a banded mute swan was 19 years. In captivity, they have lived 30 to 40 years.

Range lifespan

Status: wild:
19 (high) years.

Range lifespan

Status: captivity:
30-40 (high) years.

Average lifespan

Status: wild:
321 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 70 years (captivity) Observations: In the wild, these animals can live up to 26.8 years (http://bna.birds.cornell.edu/). There are anecdotal reports, which might be true, of animals living up to 70 years in captivity (John Terres 1980). IMR in the wild is probably less than 0.1. Breeding performance tends to decline after about age 12 (McCleery et al. 2008).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Adults are not paired for life, contrary to the stereotype of the 'pining swan' who has lost its mate. In fact, some have been observed to have as many as four mates, or even 'divorce' one mate in favor of another. However, established pairs are more successful breeders than non-established pairs and mute swans do form monogamous pairs for at least a season.

Mating System: monogamous

Mute swans rarely nest in colonies. Nest sites are selected and breeding begins in March or early April. These swans either build a new nest or use a previously constructed mound, such as a muskrat house. The nest is large, made of aquatic vegetation, and lined with feathers and down. It is built well above the normal water level in swampy places near a pond or lake. It is possible for clutches of 5 to 12 to occur, but 5 to 7 is most common. The eggs are pale gray to pale blue-green. Incubation lasts 36 to 38 days. The chicks are brownish gray (gradually turning white within the next 12 months) and only remain in the nest for one day. The male may often take the first-hatched cygnet to the water while the female continues to incubate the remaining eggs. They are able to fly in about 60 days. Chicks can ride on the backs of their parents or under their wings. By the following breeding season the parents drive the young away. The cygnets then join flocks of other non-breeding swans, and during this time molt their feathers, becoming flightless for a short period of time. In the next two years, the cygnets begin to bond with a mate and begin to look for suitable breeding territory. Swans do not begin to breed until about their third year. (Granlund, McPeek and Adams, 1994; Reilly, 1968; Terres, 1980;   http://www.airtime.co.uk/users/cygnus/muteswan.htm;   http://www.aztec.inre.asu.edu/phxzoo/swanmute.html)

Breeding interval: Mute swans breed once yearly.

Breeding season: Breeding begins in March and April.

Range eggs per season: 5 to 12.

Average eggs per season: 5-7.

Range time to hatching: 36 to 38 days.

Average fledging age: 60 days.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 5.

The sexes share incubation, though the female spends the majority of time sitting, and the male usually stands guard.

Even in semi-domestication, the nest is strongly defended; swans have been known to attack other waterfowl and even people. Blows from their powerful wings can be especially painful. They can be dangerous to children, and are capable of killing or maiming some of the larger predators.

Parental Investment: precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size averages 4-6. Incubation lasts 34-38 days, mainly or entirely by female. Young are tended by both parents, independent at about 4 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mute swans do not mate for life, contrary to the stereotype of the 'pining swan' who has lost its mate. In fact, some have been observed to have as many as four mates, or even 'divorce' one mate in favor of another. However, established pairs are more successful breeders than non-established pairs and mute swans do mate with only one other swan during each breeding season.

Mating System: monogamous

Mute swans rarely nest in colonies. Nest sites are selected and breeding begins in March or early April. These swans either build a new nest or use a previously constructed mound, such as a muskrat house. The nest is large, made of aquatic vegetation, and lined with feathers and down. It is built well above the normal water level in swampy places near a pond or lake. It is possible for clutches of 5 to 12 to occur, but 5 to 7 is most common. The eggs are pale gray to pale blue-green. Incubation lasts 36 to 38 days. The chicks are brownish gray (gradually turning white within the next 12 months) and only remain in the nest for one day. The male may often take the first-hatched cygnet (hatchling swan) to the water while the female continues to incubate the remaining eggs. They are able to fly in about 60 days. Chicks can ride on the backs of their parents or under their wings. By the following breeding season the parents drive the young away. The cygnets then join flocks of other non-breeding swans, and during this time molt their feathers, becoming flightless for a short period of time. In the next two years, the cygnets begin to bond with a mate and begin to look for suitable breeding territory. Swans do not begin to breed until about their third year.

Breeding interval: Mute swans breed once yearly.

Breeding season: Breeding begins in March and April.

Range eggs per season: 5 to 12.

Average eggs per season: 5-7.

Range time to hatching: 36 to 38 days.

Average fledging age: 60 days.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

The sexes share incubation, though the female spends the majority of time sitting, and the male usually stands guard.

Even in semi-domestication, the nest is strongly defended; swans have been known to attack other waterfowl and even people. Blows from their powerful wings can be especially painful. They can be dangerous to children, and are capable of killing or maiming some of the larger predators.

Parental Investment: precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Form pairs at 2 years old. First breed at 3-4 years old. Nest built by female, near water's edge or on small mound in shallow water. 5-7 eggs laid, incubated for 36 days mostly by the female. Both parents look after hatched young through their first winter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cygnus olor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGACATTGGCACCCTATACCTTATCTTCGGGGCATGGGCAGGAATAGTCGGCACCGCACTCAGTCTGTTAATCCGCGCAGAACTAGGACAGCCAGGAACCCTCCTCGGCGACGACCAAATTTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATTTTCTTCATAGTCATACCCATTATGATCGGAGGGTTCGGCAACTGACTAGTCCCCCTCATAATCGGCGCCCCCGACATAGCATTCCCACGAATGAATAACATAAGCTTCTGACTCCTTCCACCATCATTTCTCCTGCTGCTAGCCTCATCTACCGTAGAAGCCGGAGCCGGCACAGGCTGAACTGTCTACCCACCCCTAGCAGGTAACCTGGCCCACGCCGGAGCCTCAGTAGACCTAGCCATTTTCTCACTTCACTTAGCTGGTGTTTCCTCCATCCTCGGAGCTATTAACTTTATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTGTTCGTCTGATCCGTCCTAATTACTGCCATCCTACTACTCCTGTCACTCCCTGTACTCGCCGCAGGTATCACAATGCTGCTAACCGACCGAAACCTAAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATTCTATACCAACACCTATTCTGATTTTTTGGGCACCCAGAAGTCTATATCCTAATCTTGCCAGGATTTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cygnus olor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5