Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Geographic Range

Surnia ulula (also known as the Northern Hawk Owl) is found primarily in North America. It ranges from northern Alaska, through lower and middle Canada, and along the northern region of the United States. This species has also spread through northern Russia and Scandinavia (de la Torre, 1990).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDS: from limit of trees in western and central Alaska to southern Keewatin and Labrador, south to southern British Columbia, central Saskatchewan, northern Minnesota, northern Michigan, and New Brunswick. WINTERS: mainly in breeding range, makes irregular invasions of northern coterminous U.S. Also occurs in Old World.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Northern Hawk Owls' plumage is compact, in contrast to the down feathers of boreal owls (Voous, 1988). They are dark chocolate in color with white spots. The breast and belly regions are creamy white crossed by horizontal, cinnamon brown bars. Their poorly developed facial disks are framed by black lines. Often referred to as the "earless" owl, they lack true ear tufts; the external ear openings are elliptical (de la Torre, 1990). Both legs are fully feathered (Duncan and Duncan, 1998).

Range mass: 343.9 to 348.9 g.

Range length: 35.56 to 43.18 cm.

Average length: 39.37 cm.

Range wingspan: 78.74 to 88.9 cm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 41 cm

Weight: 345 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Surnia ulula lives primarily in dense coniferous or coniferous-deciduous forests, which adjoin open areas. It prefers mountainous ranges where open areas and perches are readily available. The abundance of prey dictates location of habitats (Duncan and Duncan, 1998). This species will not inhabit dark impenetrable spruce-fir forests

(Voous,1988).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open coniferous or mixed forest, forest edge and clearings, old deciduous forest burns, dense shrubby areas (especially tamarack), swamps, scrubby second-growth woodland and muskeg (AOU 1983).

Nests in hollow tops of dead spruces, birches, natural tree hollows, abandoned woodpecker holes, deserted nests of crows and birds of prey (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Basically nonmigratory but retreats slightly in winter from northernmost part of range (National Geographic Society 1983). Southward irruptive movements generally in year following peak in rodent population. Usually on nesting territory by mid-March in northern Alberta.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern Hawk Owls prey on small mammals (voles, lemmings, mice, shrews, snowshoe hares, cottontails, moles, squirrels and rats). During the summer, they consume primarily rodents, and in the winter they shift to birds (ptarmigan and grouse). The extent to which they prey on birds is unknown. They share similar hunting habits with boreal owls. They hunt both during the day and the night (Duncan and Duncan, 1998).

Animal Foods: birds; mammals

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet often is dominated by voles, but birds (up to grouse size) may comprise the major part of the diet in winter and snowshoe hare juveniles may be important during certain nesting stages (Rohner et al. 1995). Also eats other small mammals and insects. Watches for prey from perch, swoops down on it, returns to elevated perch.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

There has been minimal research performed on this species, and therefore, this information is not available.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The Great Horned Owl serves as the Northern Hawk Owl's primary predator. At night the Great Horned Owls kill roosting owls while they are resting or enter nests and take eggs or young. To avoid predation, the Northern Hawk Owl flattens its plumage and stands erect. Also, it attempts to intercept predators that attack its nest (Duncan and Duncan, 1998).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Surnia ulula is prey of:
Accipiter gentilis
Bubo virginianus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Surnia ulula preys on:
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Tends to occur in greatest numbers in areas with temporarily high prey populations; may move long distances in response to changes in prey abundance. Population density generally is low (e.g., 4 pairs in 200 sq km in Norway; 1 pair per 500 sq km in Sweden) (Johnsgard 1988); maximum of 3 nests per 100 sq km in southwestern Yukon, Canada (Rohner et al. 1995). Home ranges in Europe ranged from 140 to 848 hectares, average 372 hectares (Baekken et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active any time of day during breeding season; hunts mainly during daylight hours in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Expected lifespan in both captivity and wild is 10 years (Duncan and Duncan, 1998).

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: captivity:
8.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (captivity) Observations: In captivity, these animals have been reported to live up to 10 years (http://bna.birds.cornell.edu/). Oldest banded individual was 8.2 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Northern Hawk Owls are generally monogamous. However, in captivity a male may mate with two females. Males attract females by clapping their wings while in flight and making Advertising Calls while perched. Females respond with their own Advertising Calls. Males court by bringing food to the nest and the females. Before and after copulation, both males and females sing (Duncan and Duncan, 1998).

Mating System: monogamous

The female lays the first egg, which immediately starts the incubation period. Between eggs, there is an interval of approximately 1.6 days. When the female is off the nest, the male does not incubate the eggs. The male provides food and protection against predators.The female owl incubates the eggs for 25-29 days. Before they hatch, the young start to call. After the eggs have hatched, the young are tended to by the female. Eggshells are either eaten or removed from nest. The female broods the young for approximately 10 days. Three to five weeks after hatching, the young leave the nest (Duncan and Duncan, 1998; Nero, 1995).

Breeding season: March 30 - June 30

Range eggs per season: 3 to 13.

Average eggs per season: 7.

Range time to hatching: 25 to 30 days.

Range fledging age: 3 to 5 weeks.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); oviparous

Immediately after hatching has occurred, brooding begins. During this time, the male brings food to the female, which then gives it to the young. Brooding lasts approximately 10 to 14 days. While the male will offer small intact prey to the young, primary care and feeding is provided through the female (Duncan and Duncan, 1998).

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg dates: late April to mid-June in Alaska and arctic Canada; April-early June in Alberta. Clutch size is up to 13 (mean brood size was 6.3 in Fennoscandia, 3.7 in Yukon, 5.5 in Alaska). Incubation lasts about 25-30 days, by female. Both parents tend young, which fledge in 25-35 days, independent in about 3 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Surnia ulula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTCTACCTAATTTTTGGTGCATGGGCCGGCATAGTAGGAACAGCCCTCAGCCTACTCATCCGAGCTGAACTTGGACAACCAGGAACCCTACTGGGGGACGACCAAATCTACAATGTAGTCGTCACTGCCCATGCCTTCGTGATGATCTTCTTCATAGTTATACCAGTCATGATCGGGGGCTTTGGGAACTGGCTAGTCCCACTAATAATCGGAGCCCCAGACATGGCCTTCCCCCGCATAAACAACATAAGTTTCTGATTACTACCCCCCTCCTTCATACTCCTTCTAGCCTCCTCTACAGTAGAAGCCGGAGCAGGTACTGGATGAACTGTCTACCCCCCTCTAGCCAGCAACATTGCCCACGCAGGAGCCTCAGTTGATCTAGCTATCTTCTCCCTCCACCTAGCCGGAGTATCCTCCATCCTAGGGGCCATTAACTTCATCACAACCGCCATCAACATAAAACCACCATCCCTATCACAATACCAAACACCCCTCTTTGTATGATCTGTACTCATTACTGCCATCCTCTTACTATTATCCCTCCCTGTCCTAGCTGCAGGAATTACCATGCTCCTCACCGACCGCAACCTAAACACCACATTCTTTGACCCAGCTGGAGGCGGCGACCCTATCCTATACCAACACCTATTCTGGTTCTTCGGGCACCCAGAAGTTTACATCCTTATTCTGCCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Surnia ulula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Northern Hawk Owl has historically been shot down by some native groups for consumption. The number of owls affected by this is small.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These birds not pose a serious threat to humans. They allow humans to come relatively close to them. However, invading their territory may cause an owl to bite or attack (Duncan and Duncan, 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In particular during the summer months, the Northern Hawk Owl plays a significant role in controlling the rodent population; rodents may make up as much as 90% of their diet (Lockshaw, 2001).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Hawk-Owl

The Northern Hawk-Owl (Surnia ulula), or Northern Hawk Owl in North America, is a non-migratory owl that usually stays within its breeding range, though it sometimes irrupts southward. It is one of the few owls that is not nocturnal or crepuscular. This is the only living species in the genus Surnia of the family Strigidae, the "typical" owls (as opposed to barn owls, Tytonidae). The species is sometimes called simply the Hawk Owl; however, many species of owls in the Ninox genus are also called "hawk owls".

Contents

Description [edit]

Male Northern Hawk-Owls are generally 36.0–42.5 cm long and weigh 300 g. Females are slightly bigger with a length of 37.2–44.7 cm and a mass of about 340g. Both male and female have similar wingspans of about 45 cm. The Northern Hawk-Owl plumage is relatively dark brown with an off white spotting pattern on all dorsal parts of the body with the exception of the back of the neck which boasts a black v-shaped pattern. The underbelly is generally white or off-white which continues to the toes with brown bands on the breast and stomach. It also boasts a long tail with brown banding. The Northern Hawk-Owl has a smokey white face with a black border, a flat head, yellow eyes and a yellow curved beak.[2]

The Northern Hawk-Owl has been said to resemble a hawk in appearance and in behavior. In North America, its appearance in flight is often considered similar to a Cooper's Hawk (Accipiter cooperii). It has been suggested that this may be because the Hawk-Owl may partially fill an important diurnal niche similar to that of day hunters such as hawks.[3]

Vocalization [edit]

S. ulula has a variety of calls used by the different sexes in different situations. When attracting a mate the male usually lets out a rolled whistle of ulululululululul and a sound similar to tu-wita-wit, tiwita-tu-wita, wita, when perching at a potential nest site. The female’s call is usually less constant and more shrill.[2]

When alerting to danger, the Northern Hawk-Owl lets out a sound similar to rike, rike, rike, rike. It also releases a high pitched scream followed by a yip when an intruder is near to the nest. To warn of impending dangers to a fledgling, the Hawk-Owl will let out a noise similar to ki ki kikikikiki. Calls can vary in length from 15 s to 2 min.[2]

Distribution [edit]

Three subspecies exist across the northern holarctic.[4][5] The North American subspecies S.u.caparoch spans from eastern Alaska through to Newfoundland and in some areas extends south into northern United States.[2][5] The other two subspecies are found in Eurasia: S. u. tianschanica breeds in central Asia reaching Xinjiang (China) and S. u. ulula resides across Eurasia reaching Siberia at its most eastern range.[2]

Occasionally, S.u.caparoch can extend its territory as far south as northern Minnesota and many other states in the northern United States including more central states such as West Virginia, New York, and South Dakota. These southern forays into the northern United States are rare and generally occur during winter, or following an explosion in a population of prey.[2] S. u. caparoch has been known to reach Great Britain. As in North America, the Eurasian subspecies can occasionally be found in more southern areas such as the following: Great Britain; and southern Russia and Scandinavia, following explosions of prey.[2]

Habitat [edit]

Northern Hawk Owls are unevenly distributed and highly variable throughout the boreal forest.[2] They live mostly in open coniferous forests, or coniferous forests mixed with deciduous species such as larch, birch, poplar, and willow.[4] They are found in muskegs, clearings, swamp valleys, meadows,[4] or recently burnt areas,[6] and generally avoid dense spruce-fir forests.[4] Winter habitat is usually the same as breeding habitat.[2]

Breeding [edit]

The Northern Hawk-Owl generally starts its mating rituals at the beginning of March.[2] After calling and pairing is complete the Northern Hawk-Owl will build a nest and start to lay eggs. On average the Northern Hawk-Owl will lay 3–11 eggs per brood. The nest sites are usually the tops of hollow stumps of old dead spruce trees. These nesting sites are usually 2-10m above ground for the North American S. u. caparoch and approximately 4-5m above ground for the Eurasian S. u. ulala. The specific dates of egg appearance can be quite variable depending on locality. In central Canada eggs are usually laid from March 30 to the 5th of June. In Newfoundland the appearance of eggs occurs later, between May 9 and June 11. In Finland however, eggs can be found anywhere between the 30th of March to the 23rd of June.[7]

For the most part the female Northern Hawk-Owl does the incubating of the eggs whilst the male forages for food. Once the chicks have hatched their roles shift drastically. At about two weeks into the chicks lives the female starts to leave the nest for long spans of time (5 hours or more). This span of time is presumably when the female hunts. The male however, will guard the nest diligently until the chicks leave. When predators (usually other raptors) fly nearby, the male will sometimes chase them away from the nest if they feel it is necessary. Once the owlets have grown to a size which allows less parental supervision, they will leave the nest. This occurs on average after their 21st day, and can begin as early as mid-June. After this the female will provide most of the care. However the male will remain close and will still feed his young on occasion.[7] The Northern Hawk-Owl has also been known to nest on cliffsides. It has little fear of humans, and will attack if the young are approached too closely.

Feeding [edit]

The Northern Hawk-Owl feeds on a variety of prey, which can include small rodents to mammals more robust in size, and a variety of birds,[7] a typical diet for many boreal owls.[2] In Eurasia the Northern Hawk-Owl is known to feed primarily on voles from the Microtus family. These voles usually follow a 3–4 year cycle of abundance. Therefore, S. u. ulula numbers are affected negatively when the numbers of voles are lowest. In North America the subspecies S. u. caparoch also feeds upon microtine voles, but its population is primarily based on the ten year cycling of the Snowshoe Hare (Lepus americanus). In Eurasia the Northern Hawk-Owl’s biomass consists of about 94% microtine voles, whereas in North America the percentage of biomass contributed by voles can be as low as 20%. Juvenile hares are considerably more important at 40–50%.[8]

Other animals that are important prey items for the Northern Hawk-Owl include the red squirrel (Sciurus vulgaris) which has been documented to contributing as much as 20% to the Hawk-Owl’s biomass.[7] A long list of others include mice, rats, voles, lemmings, the short-tail weasel (Mustela erminea), partridge, Spruce Grouse (Falcipennis canadensis), doves, Pileated Woodpeckers (Dryocopus pileatus), sparrows, jays, robins, starlings, buntings, grackles, and finches.[2] In the winter, feeding strategies change; where in summer the main source of food is mammals, in the winter a bigger portion of the Hawk-Owl’s biomass consists of ground dwelling birds, such as the ptarmigan and the grouse.[2]

The Northern Hawk-Owl is a partially diurnal hunter, although it has been recorded hunting at varying times and does not appear to have a preferred hunting time.[2] Whether the bird resides in Eurasia or North America, the strategy is usually similar. The Northern Hawk-Owl will perch and scour the immediate area for prey.[7] As these owls are considered a search-oriented species they likely do not stay put for long if the site is not producing prey.[3] The Hawk-Owl prefers open, forest-type environments when perching. These environments include sphagnum bogs and partially deforested areas. The preferred perching tree of the Northern Hawk-Owl is the spruce tree. When the Hawk-Owl attacks, it goes from a horizontal posture into a gliding dive. If the prey is further away, the bird will flap its wings a few times during the dive to increase distance.[7] The Hawk Owl has exceptional hearing and can plunge into snow to capture rodents below the surface.

The type of prey the Hawk-Owl catches will determine its eating strategy. For mammalian prey the ritual is generally the same: the Northern Hawk-Owl will eviscerate its prey, eats the head first (especially for prey like the red squirrel, whose head is fairly large), and then—when tackling larger prey—it will eat the organs and cache the remains; with smaller prey, the owl will simply swallow the body whole.[7]

Phylogeny [edit]

Northern Hawk Owls are the only representative of the genus Surnia,[2][4][5][9] and no known fossil relatives exist.[4] When the nearest relatives of the Northern Hawk Owl were unknown, Voous and Cameron (1989) initially noted similarities with the Glaucidium owls based on ear morphology and facial characteristics.[4] In 1991, Schmutz and Moker first reported the karyotype of the Northern Hawk Owl and found it to resemble considerably that of the genus Athene.[10] Maximum parsimony and maximum likelihood phylogenetic trees created from nucleotide sequencing of the cytochrome b gene demonstrated that Surnia and Glaucidium form a paraphyletic group.[9][11]

Conservation and Status [edit]

The Northern Hawk Owl is one of the least studied and poorly understood birds in North America.[2][12] It is extremely difficult to study due to its low density occurrence, sporadic fluctuations, and remote breeding locations.[13] This lack of knowledge makes it almost impossible to properly estimate the population levels of this species.[13][14]

In Yukon, Northern Hawk Owl densities were estimated to be between zero to six pairs per 100 km2.[8] Despite these low densities, the North American population is thought to be fairly large given that they occur throughout the boreal forest.[13] Duncan and Harris (1997) estimated that this population contains between 10 000 and 50 000 pairs.[12]

Populations are known to fluctuate with cycles of small rodents [4][5][14] and irruptions are known to occur in sub-boreal regions throughout the world.[4][13][15] In Scandinavia, populations have been reported to vary from a few hundred birds in certain years to over 4000 birds in others and even up to 10 000 breeding pairs in optimal years.[4] Irruptions can be used as indicators of small mammal abundance [16] and in eastern North America, southern irruptions have been linked with low densities of red-backed voles in the high boreal forest.[15]

In North America, over 50 percent of the Northern Hawk Owls' breeding territory occurs in non-commercial boreal forests [2] and as long as nothing threatens their northern habitats, no known factors challenge their existence.[4] However, it is unknown what effects modern forestry would have on population levels because although it would decrease nesting localities, it would simultaneously create ideal habitat for Microtus prey.[2] Fire suppression by humans is believed to negatively affect Northern Hawk Owl populations by reducing open areas for hunting and dead wood to nest in [6]

The status and conservation of this species is uncertain.[5] A report by the Committee On the Status of Endangered Wildlife In Canada (COSEWIC) recommended that no designation be assigned for the Northern Hawk Owl.[13] Compared to the nineteenth century, southern irruptions in the New and Old World appear to have declined.[4] Also, North American populations seem to be declining, although no proper documentation exists to confirm this trend.[2][13] In Canada, it was ranked 85th overall to set conservation, research, or monitoring priorities.[17] Downes et al. (2000) considered the hawk owl to be of medium concern, but with a high priority to improve monitoring.[18]

References [edit]

  1. ^ BirdLife International (2012). "Surnia ulula". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f g h i j k l m n o p q r s Duncan, James R. and Patricia A. Duncan. (1998) Northern Hawk-Owl (Surnia ulula), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: doi:10.2173/bna.356.
  3. ^ a b Sonerud, Geir A. (1992). "Search tactics of a pause-travel predator: adaptive adjustments of perching times and move distances by hawk owls (Surnia ulula)". Behav Ecol Sociobiol 30 (3–4): 207–217. doi:10.1007/BF00166705. 
  4. ^ a b c d e f g h i j k l Voous KH, Cameron A. (1989) Owls of the northern hemisphere. Cambridge (MA): MIT Press ISBN 0262220350.
  5. ^ a b c d e König C, Weick F, Wink M. 2008. Owls of the world. London: Christopher Helm.
  6. ^ a b Hannah KC, Hoyt JS. (2004. Northern Hawk Owls and recent burns: Does burn age matter?). "Northern Hawk Owls and Recent Burns: Does Burn Age Matter?". Condor 106 (2): 420–423. doi:10.1650/7342. JSTOR 1370652. 
  7. ^ a b c d e f g Kertell, Kenneth. (1986). "Reproductive biology of Northern Hawk-Owls in Denali National Park, Alaska". Raptor Research 20 (3/4): 91–101. 
  8. ^ a b Rohner C, Smith JNM, Stroman J, Joyce M, Doyle FI, Boonstra R. (1995). "Northern Hawk Owls in the nearctic boreal forest: Prey selection and population consequences of multiple prey cycles". Condor 97 (1): 208–220. doi:10.2307/1368997. JSTOR 1368997. 
  9. ^ a b Wink M, El-Sayed AA, Sauer-Gurth H, Gonzalez J. (2009). "Molecular phylogeny of owls (Strigiformes) inferred from DNA sequences of the mitochondrial cytochrome b and the nuclear rag-1 gene". Ardea 97 (4): 581–591. doi:10.5253/078.097.0425. 
  10. ^ Schmutz SM, Moker JS. (1991). "A cytogenetic comparison of some North American owl species". Genome 34 (5): 714–717. doi:10.1139/g91-110. 
  11. ^ Nieuwenhuyse Dv, Génot J-C, Johnson DH. (2008) The little owl : Conservation, ecology, and behavior of Athene noctua. Cambridge, UK; New York: Cambridge University Press ISBN 0521714206.
  12. ^ a b Duncan PA, Harris WC. (1997). "Northern Hawk Owls Surnia ulula caparoch and forest management in North America: A review". Journal of Raptor Research 31 (2): 187–190. 
  13. ^ a b c d e f Duncan PA, Committee on the Status of Endangered Wildlife in Canada (1992). Status report on the Northern Hawk Owl, Surnia ulula. Ottawa: Committee on the Status of Endangered Wildlife in Canada.
  14. ^ a b Johnsgard PA. (2002) North American Owls: Biology and natural history. Washington, D.C.: Smithsonian Institution Press ISBN 0874745608.
  15. ^ a b Cheveau M, Drapeau P, Imbeau L, Bergeron Y. (2004). "Owl winter irruptions as an indicator of small mammal population cycles in the boreal forest of eastern North America". Oikos 107 (1): 190–198. doi:10.1111/j.0030-1299.2004.13285.x. 
  16. ^ Sundell J, Huitu O, Henttonen H, Kaikusalo A, Korpimaki E, Pietiainen H, Saurola P, Hanski I. (2004). "Large-scale spatial dynamics of vole populations in Finland revealed by the breeding success of vole-eating avian predators". Journal of Animal Ecology 73 (1): 167–178. doi:10.1111/j.1365-2656.2004.00795.x. 
  17. ^ Dunn EH. (1997) Setting priorities for conservation, research and monitoring of Canada's landbirds. Tech. Rep. Ser. No. 293. Can. Wildl. Serv. Ottawa, ON. Cited in: Duncan JR, Duncan PA, Poole A, editor. 1998. Northern Hawk Owl Surnia ulula, The Birds of North America Online [Internet]. Ithaca: Cornell Lab of Ornithology.
  18. ^ Downes CM, Dunn EH, Francis CM. (2000) Canadian landbird monitoring strategy: Monitoring needs and priorities into the new millennium. Partners In Flight-Canada, Ottawa.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!