Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetura brachyura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACATTGGCACCCTGTACTTAATCTTTGGAGCATGAGCTGGCATAGTAGGTACCGCCCTCAGCCTACTCATCCGAGCAGAACTTGGACAACCAGGGACCCTCCTGGGAGACGATCAAATTTACAACGTAATCGTCACTGCTCACGCCTTCGTAATAATCTTCTTCATAGTTATACCAATTATGATTGGAGGATTTGGAAACTGACTAGTCCCACTTATAATTGGAGCACCTGACATAGCCTTCCCACGAATAAATAATATAAGCTTCTGACTCCTTCCCCCATCATTCCTTCTCCTACTAGCCTCCTCAACAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTATACCCCCCACTAGCCGGCAATCTAGCCCATGCAGGAGCATCAGTAGACCTCGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCCATCCTAGGTGCAATCAACTTCATCACAACTGCCATCAATATAAAACCACCCGCCCTTTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATTACCGCCGTCCTACTACTCCTCTCCCTCCCTGTCCTCGCCGCAGGCATCACCATACTCTTAACCGACCGCAACCTAAACACCACATTCTTCGACCCAGCCGGAGGAGGTGACCCCATCCTCTACCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetura brachyura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Short-tailed swift

The short-tailed swift (Chaetura brachyura) is a bird in the Apodidae, or swift family.

Taxonomy[edit]

The subspecies C. b. ocypetes is sometimes considered a full species, the Tumbes swift Chaetura ocypetes Zimmer, 1953.

Distribution and habitat[edit]

The swift is a common resident of Trinidad, Tobago, Grenada and Saint Vincent, and in tropical South America from Panama, Colombia and the Guianas south to Ecuador, Peru and Brazil; in Brazil, the entire Amazon Basin, excluding much of the southeastern Basin. It rarely occurs over 800 m ASL even in the hottest parts of its range and in mountainous or hilly terrain it inhabits,[2] but has been recorded as high as 1,300 m ASL.[3] It is found in a range of habitats including savanna, open woodland, and cultivation.

Description[edit]

The short-tailed swift is about 10.5 cm long, and weighs 20 g. It has long narrow wings, a robust body and a short tail. The sexes are similar. It is mainly black with a pale rump and tail. It can be distinguished from related species in its range, such as the band-rumped swift (C. spinicauda) or the gray-rumped swift (C. cinereiventris) by the lack of contrast between the rump and the tail, the latter being much darker in the other species.

Behaviour[edit]

It is very gregarious and forms communal roosts when not breeding. Predation by bats at the nest sites has been suspected. The flight call is a rapid chittering sti-sti-stew-stew-stew.

Breeding[edit]

The nest is a 5 cm wide shallow half-saucer of twigs and saliva attached to a vertical surface. This is often a man-made structure like a chimney or manhole, as with its relative, the chimney swift (C. pelagica), but natural caves and tree cavities are also used. Up to seven white eggs (average 3 or 4) are incubated by both parents for 17–18 days. The young leave the nest in a further two weeks, but remain near it, clinging to the cavity wall without flying, for another two weeks.

Feeding[edit]

The swift feeds in flight on flying insects, including winged ants and termites.

Footnotes[edit]

  1. ^ BirdLife International (2012). "Chaetura brachyura". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Laverde-R. et al. (2005)
  3. ^ Cuervo et al. (2007)

References[edit]

  • Chantler, Phil & Driessens, Gerald (2000): Swifts: a guide to the swifts and treeswifts of the world. Pica Press, Mountfield, East Sussex. ISBN 1-873403-83-6
  • Cuervo, Andrés M.; Hernández-Jaramillo, Alejandro; Cortés-Herrera, José Oswaldo & Laverde, Oscar (2007): Nuevos registros de aves en la parte alta de la Serranía de las Quinchas, Magdalena medio, Colombia [New bird records from the highlands of Serranía de las Quinchas, middle Magdalena valley, Colombia]. Ornitología Colombiana 5: 94-98 [Spanish with English abstract]. PDF fulltext
  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y.. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Laverde-R., Oscar; Stiles, F. Gary & Múnera-R., Claudia (2005): Nuevos registros e inventario de la avifauna de la Serranía de las Quinchas, un área importante para la conservación de las aves (AICA) en Colombia [New records and updated inventory of the avifauna of the Serranía de las Quinchas, an important bird area (IBA) in Colombia]. Caldasia 27(2): 247-265 [Spanish with English abstract]. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!