Overview

Comprehensive Description

Longueur 95-105 cm, envergure 240-280 cm, poids 7,5-11 kg.

Il habite de préférence les régions accidentées chaudes. Les zones plus froides ou pluvieuses ne sont tolérées que s’il y trouve des conditions avantageuses de reproduction ou d’alimentation. Il a besoin de courants d’air ascendants pour se déplacer et monte ainsi jusqu’à 3 000 m et plus. Son rayon d’action est supérieur aux autres vautours européens.

Le Vautour fauve se nourrit de charognes de taille moyenne à grande (bétail, notamment), visant particulièrement les muscles et les viscères. La recherche est méthodique, les oiseaux d’une colonie exploitant le même secteur à portée de vue les uns des autres. Ils repèrent les carcasses à la vue, souvent par les mouvements d’autres oiseaux en vol ou au sol. Le long cou permet à la tête de pénétrer profondément dans les carcasses, tandis que les bords coupants du bec entaillent rapidement les parties molles. La langue possède en outre des séries d’épines pour maintenir et avaler les viscères.

Le Vautour fauve est grégaire. Il patrouille en solitaire mais se regroupe sur les carcasses et sur les falaises où il niche. C’est la seule espèce vraiment coloniale de vautour dans l’Ouest paléarctique. Les aires sont généralement bien espacées, à moins que la topographie du site n’impose un rapprochement des couples. Les activités de parade aérienne consistent en des vols élevés et des jeux de copie des mouvements du partenaire, les deux oiseaux volant très proches l’un de l’autre. Sur les carcasses, la dominance se fait plus selon le degré de faim que selon un rang social stable. Les oiseaux se nourrissent ensemble lorsqu’ils ont tous autant faim et que la carcasse est grande. Dans le cas contraire, des disputes parfois violentes éclatent et une hiérarchie s’établit alors. Les combats sont normalement courts et ritualisés, ne causant pas de blessures sérieuses.

Les colonies comprennent généralement 15 à 20 couples. L’aire est sur une corniche ou dans une grotte peu profonde, très rarement dans un vieux nid sur un arbre. Elle atteint 1 mètre de diamètre ; c’est une coupe nette dans un tas de branchettes, de plumes et d’herbe. L’œuf unique est déposé à partir de fin février. L’incubation dure une cinquantaine de jours et les jeunes sont volants peu avant à l’âge de 4 mois.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"Gyps fulvus, commonly called the Eurasian Griffon, is a large Old World vulture that breeds in mountains of southern Europe, North Africa and Asia."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Endemic Distribution

Not endemic
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution size (in km2): 10200000.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"A huge cinnamon-brown vulture, adults have pale yellowish-brown iris, yellowish bill, whitish head with yellowish white hair-like feathers, whitish scrawny almost naked neck with distinctive whitish ruff at base, prominent narrow pale shaft stripes on rufous-brown underparts, thighs and underwing coverts, and dark grey legs and feet. Juveniles show darker iris, blackish bill, more whistish down on grey head and neck, rufous-brown feathered neck ruff and darker rufous-brown on upperwing coverts and upperparts than adults."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 93–122 cm. Wingspan: 2.3–2.8 m. Tail length: 24 - 29 cm Weight: 6.2 to 10.5 kg in males and 6.5 to 11.3 kg in females.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"(a) Gyps fulvus fulvus (Hablizl, 1783) - North West Africa and Iberian Peninsula east through Balkans, Turkey, Middle East, Arabia and Iran to Pamirs and Altai. (b) Gyps fulvus fulvescens Hume, 1869 - Afghanistan, Pakistan and North India east to Assam."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Some birds are migratory, overwintering in Africa, although many others are resident or nomadic (del Hoyo et al. 1994). It relies heavily on soaring flight, and has been shown to fly at altitudes of 10,000 m and higher. Birds hunt alone but congregate at food sources and roosts; they also tend to migrate singly, but concentrations (usually up to 15 individuals) form at sea crossings and strong thermals (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Habitat It is a species of expansive open areas in a wide array of environments, from mountains to semi-desert, and is recorded regularly from sea level up to c.3,000 m (del Hoyo et al. 1994). Diet It feeds almost exclusively on carrion, mainly that of large mammals (del Hoyo et al. 1994). Breeding site The nest is usually built on a rocky outcrop, with sheltered ledges or small caves preferred (del Hoyo et al. 1994). Management information Effective protection in areas with a plentiful supply of food (which often includes the carrion of domestic animals), has been shown to catalyse impressive population recoveries, and reintroduction has been successful in parts of its range (del Hoyo et al. 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"A. Global: Habitat systems: Terrestrial. Forest Dependency: Does not normally occur in forest. Altitude: 0 - 3000 m. General Habitats: Shrubland - Mediterranean-type Shrubby Vegetation; Grassland - Temperate; Rocky areas (eg. inland cliffs, mountain peaks). Breeding Habitats: Grassland - Temperate grassland; Rocky areas; Shrubland - Mediterranean-type shrubland. B. Indian subcontinent: Semi-desert country, dry open plains and bare hills. Tends to avoid forests, wetlands, lakes and marine waters."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

"Full migrant. In the Indian subcontinent, resident breeding populations of this species found in Pakistani and Himalayan ranges. Winter visitor to Pakistani plains, North, North West, parts of eastern and southern India, and Nepal."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Carnivore. Before their replacement by domesticated animals, wild mountain goats, deer and gazelles were their main prey. Now known to approach injured or weak sheep and cattle but mainly scavenges on the soft tissue of small to medium sized mammal carcasses."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

"100,000 mature individuals (2009)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"These colonial breeders are known to co-operate in searching for food. They circle for food individually but in sight of each other till food is sighted at which point they swoop down in large numbers to feed on the carcass. Impressive threat displays seen at a carcass as each bird jostles to maintain its position at the feeding site. A fairly vocal bird, a range of sounds are produced by the Eurasian Griffon in its interactions with other birds of the same species. Dominant birds produce a drawn-out hissing sound when they feed at a carcass and a wooden-sounding chattering when another bird ventures too close."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum longevity: 41.4 years (captivity).
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 41.4 years (captivity) Observations: One captive specimen reportedly lived to 41.4 years of age (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"Breeding season: January to April. Breeding behaviour: Forms colonies of 15-20 pairs, sometimes even 150 pairs. Pairs show courtship flights. Mating system: Monogamous with birds forming life-long pairs. Nest: A large platform of sticks. Nest location: Cliff face in protected ledges or caves. Clutch size: 1. Eggs: White, sometimes red-flecked. Incubation period: 52 days. Parental investment: Both sexes share responsibility of caring for young."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gyps fulvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGAGCTGGTACAGGATGAACCGTCTACCCCCCACTGGCCGGCAACATAGCCCATGCTGGGGCCTCAGTTGACTTAGCCATCTTCTCCCTACACCTAGCAGGGATCTCATCCATTCTAGGGGCAATCAACTTCATCACCACAGCCATTAACATAAAACCACCTGCCCTCTCCCAATACCAAACACCCCTATTCGTATGGTCTGTCCTCATTACCGCAGTCCTACTACTACTCTCACTCCCAGTCTTAGCCGCCNGGATCACTATACTACTTACAGACCGAAACCTCAACACAACGTTCTTCGATCCCGCCGGAGGAGGTGACCCAGTTCTATACCAACACCTCTTCTGATTCTTCGGACACCCTGAAGTCTATATCCTAATTCTACCGGGCTTTGGAATCATCTCTCACGTAGTAACATACTACGCAGGTAAAAAAGAACCATTCGGCTACATAGGAATAGTCTGAGCTATACTATCCATTGGATTCCTAGGCTTCATCGTATGGGCCCACCACATA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gyps fulvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over 10 years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in 10 years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Red List Category & Criteria: Least Concern (ver 3.1) Year Published: 2009 Assessor/s: BirdLife International Reviewer/s: Bird, J., Butchart, S."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Former breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unset
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It declined markedly throughout the 19th-20th centuries in much of Europe, North Africa and the Middle East, mainly due to direct persecution and "bycatch" from the poisoned carcasses set for livestock predators (del Hoyo et al. 1994, Snow and Perrins 1998, Ferguson-Lees and Christie 2001). In some areas a reduction in available food supplies, arising from changes in livestock management practices, also had an impact (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). It is very highly vulnerable to the effects of potential wind energy development (Strix 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) India Listed Species:Yes. Appendix:II, III. CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) Global Listed Species:Yes. Appendix:II, III. AEWA (Agreement on the Conservation of African-Eurasian Migratory Waterbirds) Listed Species:Yes. Appendix:II. IWPA (Indian Wildlife Protection Act, 1972) Listed Species:Yes. IWPA (Indian Wildlife Protection Act, 1972) Schedule:IV."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!