Overview

Comprehensive Description

Longueur 95-105 cm, envergure 240-280 cm, poids 7,5-11 kg.

Il habite de préférence les régions accidentées chaudes. Les zones plus froides ou pluvieuses ne sont tolérées que s’il y trouve des conditions avantageuses de reproduction ou d’alimentation. Il a besoin de courants d’air ascendants pour se déplacer et monte ainsi jusqu’à 3 000 m et plus. Son rayon d’action est supérieur aux autres vautours européens.

Le Vautour fauve se nourrit de charognes de taille moyenne à grande (bétail, notamment), visant particulièrement les muscles et les viscères. La recherche est méthodique, les oiseaux d’une colonie exploitant le même secteur à portée de vue les uns des autres. Ils repèrent les carcasses à la vue, souvent par les mouvements d’autres oiseaux en vol ou au sol. Le long cou permet à la tête de pénétrer profondément dans les carcasses, tandis que les bords coupants du bec entaillent rapidement les parties molles. La langue possède en outre des séries d’épines pour maintenir et avaler les viscères.

Le Vautour fauve est grégaire. Il patrouille en solitaire mais se regroupe sur les carcasses et sur les falaises où il niche. C’est la seule espèce vraiment coloniale de vautour dans l’Ouest paléarctique. Les aires sont généralement bien espacées, à moins que la topographie du site n’impose un rapprochement des couples. Les activités de parade aérienne consistent en des vols élevés et des jeux de copie des mouvements du partenaire, les deux oiseaux volant très proches l’un de l’autre. Sur les carcasses, la dominance se fait plus selon le degré de faim que selon un rang social stable. Les oiseaux se nourrissent ensemble lorsqu’ils ont tous autant faim et que la carcasse est grande. Dans le cas contraire, des disputes parfois violentes éclatent et une hiérarchie s’établit alors. Les combats sont normalement courts et ritualisés, ne causant pas de blessures sérieuses.

Les colonies comprennent généralement 15 à 20 couples. L’aire est sur une corniche ou dans une grotte peu profonde, très rarement dans un vieux nid sur un arbre. Elle atteint 1 mètre de diamètre ; c’est une coupe nette dans un tas de branchettes, de plumes et d’herbe. L’œuf unique est déposé à partir de fin février. L’incubation dure une cinquantaine de jours et les jeunes sont volants peu avant à l’âge de 4 mois.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"Gyps fulvus, commonly called the Eurasian Griffon, is a large Old World vulture that breeds in mountains of southern Europe, North Africa and Asia."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Endemic Distribution

Not endemic
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution size (in km2): 10200000.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"A huge cinnamon-brown vulture, adults have pale yellowish-brown iris, yellowish bill, whitish head with yellowish white hair-like feathers, whitish scrawny almost naked neck with distinctive whitish ruff at base, prominent narrow pale shaft stripes on rufous-brown underparts, thighs and underwing coverts, and dark grey legs and feet. Juveniles show darker iris, blackish bill, more whistish down on grey head and neck, rufous-brown feathered neck ruff and darker rufous-brown on upperwing coverts and upperparts than adults."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 93–122 cm. Wingspan: 2.3–2.8 m. Tail length: 24 - 29 cm Weight: 6.2 to 10.5 kg in males and 6.5 to 11.3 kg in females.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"(a) Gyps fulvus fulvus (Hablizl, 1783) - North West Africa and Iberian Peninsula east through Balkans, Turkey, Middle East, Arabia and Iran to Pamirs and Altai. (b) Gyps fulvus fulvescens Hume, 1869 - Afghanistan, Pakistan and North India east to Assam."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Some birds are migratory, overwintering in Africa, although many others are resident or nomadic (del Hoyo et al. 1994). It relies heavily on soaring flight, and has been shown to fly at altitudes of 10,000 m and higher. Birds hunt alone but congregate at food sources and roosts; they also tend to migrate singly, but concentrations (usually up to 15 individuals) form at sea crossings and strong thermals (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Habitat It is a species of expansive open areas in a wide array of environments, from mountains to semi-desert, and is recorded regularly from sea level up to c.3,000 m (del Hoyo et al. 1994). Diet It feeds almost exclusively on carrion, mainly that of large mammals (del Hoyo et al. 1994). Breeding site The nest is usually built on a rocky outcrop, with sheltered ledges or small caves preferred (del Hoyo et al. 1994). Management information Effective protection in areas with a plentiful supply of food (which often includes the carrion of domestic animals), has been shown to catalyse impressive population recoveries, and reintroduction has been successful in parts of its range (del Hoyo et al. 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"A. Global: Habitat systems: Terrestrial. Forest Dependency: Does not normally occur in forest. Altitude: 0 - 3000 m. General Habitats: Shrubland - Mediterranean-type Shrubby Vegetation; Grassland - Temperate; Rocky areas (eg. inland cliffs, mountain peaks). Breeding Habitats: Grassland - Temperate grassland; Rocky areas; Shrubland - Mediterranean-type shrubland. B. Indian subcontinent: Semi-desert country, dry open plains and bare hills. Tends to avoid forests, wetlands, lakes and marine waters."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

"Full migrant. In the Indian subcontinent, resident breeding populations of this species found in Pakistani and Himalayan ranges. Winter visitor to Pakistani plains, North, North West, parts of eastern and southern India, and Nepal."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Carnivore. Before their replacement by domesticated animals, wild mountain goats, deer and gazelles were their main prey. Now known to approach injured or weak sheep and cattle but mainly scavenges on the soft tissue of small to medium sized mammal carcasses."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

"100,000 mature individuals (2009)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"These colonial breeders are known to co-operate in searching for food. They circle for food individually but in sight of each other till food is sighted at which point they swoop down in large numbers to feed on the carcass. Impressive threat displays seen at a carcass as each bird jostles to maintain its position at the feeding site. A fairly vocal bird, a range of sounds are produced by the Eurasian Griffon in its interactions with other birds of the same species. Dominant birds produce a drawn-out hissing sound when they feed at a carcass and a wooden-sounding chattering when another bird ventures too close."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum longevity: 41.4 years (captivity).
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 41.4 years (captivity) Observations: One captive specimen reportedly lived to 41.4 years of age (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"Breeding season: January to April. Breeding behaviour: Forms colonies of 15-20 pairs, sometimes even 150 pairs. Pairs show courtship flights. Mating system: Monogamous with birds forming life-long pairs. Nest: A large platform of sticks. Nest location: Cliff face in protected ledges or caves. Clutch size: 1. Eggs: White, sometimes red-flecked. Incubation period: 52 days. Parental investment: Both sexes share responsibility of caring for young."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gyps fulvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGCTGGTACAGGATGAACCGTCTACCCCCCACTGGCCGGCAACATAGCCCATGCTGGGGCCTCAGTTGACTTAGCCATCTTCTCCCTACACCTAGCAGGGATCTCATCCATTCTAGGGGCAATCAACTTCATCACCACAGCCATTAACATAAAACCACCTGCCCTCTCCCAATACCAAACACCCCTATTCGTATGGTCTGTCCTCATTACCGCAGTCCTACTACTACTCTCACTCCCAGTCTTAGCCGCCNGGATCACTATACTACTTACAGACCGAAACCTCAACACAACGTTCTTCGATCCCGCCGGAGGAGGTGACCCAGTTCTATACCAACACCTCTTCTGATTCTTCGGACACCCTGAAGTCTATATCCTAATTCTACCGGGCTTTGGAATCATCTCTCACGTAGTAACATACTACGCAGGTAAAAAAGAACCATTCGGCTACATAGGAATAGTCTGAGCTATACTATCCATTGGATTCCTAGGCTTCATCGTATGGGCCCACCACATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gyps fulvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over 10 years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in 10 years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Red List Category & Criteria: Least Concern (ver 3.1) Year Published: 2009 Assessor/s: BirdLife International Reviewer/s: Bird, J., Butchart, S."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Former breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unset
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It declined markedly throughout the 19th-20th centuries in much of Europe, North Africa and the Middle East, mainly due to direct persecution and "bycatch" from the poisoned carcasses set for livestock predators (del Hoyo et al. 1994, Snow and Perrins 1998, Ferguson-Lees and Christie 2001). In some areas a reduction in available food supplies, arising from changes in livestock management practices, also had an impact (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). It is very highly vulnerable to the effects of potential wind energy development (Strix 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) India Listed Species:Yes. Appendix:II, III. CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) Global Listed Species:Yes. Appendix:II, III. AEWA (Agreement on the Conservation of African-Eurasian Migratory Waterbirds) Listed Species:Yes. Appendix:II. IWPA (Indian Wildlife Protection Act, 1972) Listed Species:Yes. IWPA (Indian Wildlife Protection Act, 1972) Schedule:IV."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Griffon vulture

The griffon vulture (Gyps fulvus) is a large Old World vulture in the bird of prey family Accipitridae.

Description[edit]

The griffon vulture is 93–122 cm (37–48 in) long with a 2.3–2.8 m (7.5–9.2 ft) wingspan. In the nominate race the males weigh 6.2 to 10.5 kg (14 to 23 lb) and females typically weigh 6.5 to 11.3 kg (14 to 25 lb), while in the Indian subspecies (G. f. fulvescens) the vultures average 7.1 kg (16 lb). Extreme adult weights have been reported from 4.5 to 15 kg (9.9 to 33.1 lb), the latter likely a weight attained in captivity.[2][3] Hatched naked, it is a typical Old World vulture in appearance, with a very white head, very broad wings and short tail feathers. It has a white neck ruff and yellow bill. The buff body and wing coverts contrast with the dark flight feathers.

Behavior[edit]

Gyps fulvus eating the carcass of a red deer in Spain.
Gyps fulvus soaring against a fiery summer sunset, in Monfrague NP, in Spain.

Like other vultures, it is a scavenger, feeding mostly from carcasses of dead animals which it finds by soaring over open areas, often moving in flocks. It establishes nesting colonies in cliffs that are undisturbed by humans while coverage of open areas and availability of dead animals within dozens of kilometers of these cliffs is high.[4][5] It grunts and hisses at roosts or when feeding on carrion.

The maximum recorded lifespan of the griffon vulture is 41.4 years for an individual in captivity.[6]

It breeds on crags in mountains in southern Europe, north Africa, and Asia, laying one egg. Griffon vultures may form loose colonies. The population is mostly resident. Juveniles and immature individuals may migrate far or embark on long-distance movements.[7][8]

Status in Europe and Asia[edit]

  • In Italy, the species survived only in Sardinia, but was re-introduced in a few other areas of the peninsula. As a result, several specimens been spotted again in August 2006 on the Gran Sasso massif (central Italy).
  • In Croatia, a colony of griffon vultures can be found near the town of Beli on the island of Cres.[9] There they breed at lower elevations, with some nests just 10 m above sea level. Therefore, contact with people is common. The population makes frequent incursions in the Slovenian territory, especially in the mountain Stol above Kobarid.
  • In Cyprus, there is a colony at Episkopi, in the south of the island.
  • Colonies of griffon vultures can be found in northern Israel and in the Golan Heights, where a large colony breeds in the Carmel Mountains, the Negev desert and especially at Gamla, where reintroduction projects are being carried out at breeding centers in the Carmel and Negev.
  • In Greece, there are nearly 1000 birds. On Crete they can be found in most mountainous areas, sometimes in groups of up to 20.
  • Griffon vultures have been re-introduced successfully into the Massif Central in France; about 500 are now found there.
  • In Belgium and the Netherlands, around 100 birds were present in the summer of 2007. These were vagrants from the Pyrenees population (see below).[10]
  • In Germany, the species died out in the mid 18th century. Some 200 vagrant birds, probably from the Pyrenees, were sighted in 2006,[11] and several dozen of the vagrants sighted in Belgium the following year crossed into Germany in search for food.[12] There are plans to reintroduce the species in the Alps. In September 2008, pieces of a griffon vulture bone, about 35,000 years old, were excavated from Hohle Fels cave in southern Germany, which are believed to form a flute.[13][14]
  • In Serbia, there are around 60–65 pairs of griffon vultures in western parts of the country, around Zlatar mountain,also 35 birds in canyon of river Trešnjica[15] and they are under legal protection from hunting.[16]
  • In Switzerland, there is a population of several dozen birds.
  • In Austria, there is a remnant population around Salzburg Zoo, and vagrants from the Balkans are often seen.
  • In Spain, there are tens of thousands of birds, from a low of a few thousand around 1980.
  • The Pyrenees population has apparently been affected by an EC ruling that due to danger of BSE transmission, no carcasses must be left on the fields for the time being. This has critically lowered food availability, and consequently, carrying capacity. Although the griffon vulture does not normally attack larger living prey, there are reports of Spanish griffon vultures killing weak, young or unhealthy living animals as they do not find enough carrion to eat.[17] In May 2013, a 52-year-old woman who was hiking in the Pyrenees and had fallen off a cliff to her death was eaten by griffon vultures before rescue workers were able to recover her body, leaving only her clothes and a few of her bones. Due to her being the first human to be documented being eaten by griffon vultures, the story brought worldwide attention to the griffon vulture problems in Southern Europe.[18]

Gallery[edit]

Notes[edit]

  1. ^ BirdLife International (2013). "Gyps fulvus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  3. ^ Ali, Sálim (1996). The Book of Indian Birds (12th ed.). Bombay: Bombay Natural History Society. ISBN 0-19-563731-3. 
  4. ^ Gavashelishvili, A.; McGrady, M. J. (2006). "Breeding site selection by bearded vulture (Gypaetus barbatus) and Eurasian griffon (Gyps fulvus) in the Caucasus". Animal Conservation 9 (2): 159–170. doi:10.1111/j.1469-1795.2005.00017.x. 
  5. ^ Gavashelishvili, A.; McGrady, M. J. (2006). "Geographic information system-based modelling of vulture response to carcass appearance in the Caucasus". Journal of Zoology 269 (3): 365–372. doi:10.1111/j.1469-7998.2006.00062.x. 
  6. ^ Carey, James R.; Debra S. Judge. "Longevity Records: Life Spans of Mammals, Birds, Amphibians, Reptiles, and Fish". Monographs on Population Aging, 8. Odense University Press. Retrieved 13 September 2011. 
  7. ^ Gavashelishvili, A. (2005). "Vulture movements in the Caucasus". Vulture News 53: 28–29. 
  8. ^ McGrady, M. J.; Gavashelishvili, A. (2006). "Tracking vultures from the Caucasus into Iran". Podoces 1 (1/2): 21–26. 
  9. ^ Griffon Vulture on Cres
  10. ^ n-tv.de, 2007-JUN-18: Gänsegeier in Flandern. Retrieved 2007-JUN-20.
  11. ^ Handelsblatt, 2006-JUN-30: Großer Geier-Einflug über Deutschland. Retrieved 2007-JUN-20
  12. ^ n-tv.de, 2006-JUN-22: Gänsegeier in Deutschland. Retrieved 2007-JUN-25
  13. ^ Associated Press, Prehistoric flute in Germany is oldest known. Retrieved 2009-JUN-24.
  14. ^ Science Centric, Earliest musical tradition documented in SW Germany. Retrieved 2009-JUN-24.
  15. ^ Canyon of river Trešnjica
  16. ^ Zlatar tourist organization, Serbia
  17. ^ New Scientist, 2007-JUN-01: Starving vultures switch to live Retrieved 2007-JUN-20.
  18. ^ http://www.inquisitr.com/650400/woman-eaten-by-vultures-after-fall-from-cliff/

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!