Articles on this page are available in 1 other language: Spanish (17) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Polioptila plumbea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCATCAACCGATGATTATTCTCAACCAACCATAAAGACATCGGCACCCTATACCTTATCTTCGGCGCCTGAGCCGGAATAGTAGGAACTGCCCTAAGCCTCCTCATCCGAGCAGAGCTAGGTCAACCAGGAGCCCTCCTAGGAGATGACCAAGTCTACAATGTAATCGTCACAGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATGCCAATTATAATTGGTGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTTCTTCTACTACTAGCCTCATCTACCGTCGAAGCAGGAGTAGGAACCGGCTGAACAGTATACCCACCCCTAGCTGGTAACCTCGCCCACGCCGGGGCCTCAGTAGATCTGGCCATCTTCTCTCTACATTTAGCCGGTATCTCCTCAATCCTCGGAGCAATCAACTTCATCACAACAGCGATTAACATAAAACCCCCTGCCCTATCCCAATACCAAACCCCCCTATTCGTCTGATCAGTACTAATCACCGCAGTCCTACTTCTACTCTCCCTACCCGTACTCGCCGCAGGCATCACTATGCTACTAACAGACCGCAACCTAAACACTACCTTCTTCGACCCAGCAGGAGGGGGTGACCCAGTACTATACCAACATCTCTTCTGATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polioptila plumbea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tropical gnatcatcher

The tropical gnatcatcher (Polioptila plumbea) is a small active insectivorous songbird, which is a resident species throughout a large part of the Neotropics. There are large geographical variations in its voice and plumage, resulting in some populations sometimes being considered separate species, notably the bilineata group as the white-browed gnatcatcher, and the taxon maior as the Marañón gnatcatcher.[2]

Description[edit]

The adult tropical gnatcatcher is 10–12 cm (4–5 in) long, and weighs 6–8 g (0.2-0.3 oz).[2] Its "jizz" is similar to that of other gnatcatchers; a small bird with a relatively long thin bill, a long frequently cocked tail, grey upperparts and whitish underparts. The central rectrices are black, while the outer are white (consequently, the tail appears primarily black from above, white from below), and there is a white patch in the wing (caused by broad white edging to the tertials). Males of the nominate group have a contrasting black cap that reaches just below the eye, while this is lacking in females, which instead have a grey cap (same colour as back). Some females have an irregular black post-ocular patch. This is especially prominent in female of the subspecies atricapilla from north-eastern Brazil.[2]

Males of the white-browed gnatcatcher (bilineata group) resemble males of the nominate group, but the white of their underparts extends clearly above the eye, resulting in a more restricted black cap, which, however, often is connected with a fine black line from the nape to the rear of the eye. Females resemble males, but with the black of the cap replaced by grey, except for an irregulat black patch in the post-ocular region (lacking in some females). As the white in both sexes extends above the eye, they appear rather "white-browed" (unlike the nominate group), resulting in the common name proposed for this group if considered a separate species.[2]

The final group, which only includes the taxon maior (the so-called Marañón gnatcatcher), is distinctive. Males resemble males of the nominate group, but, except for their white forecrown, females resemble males of the bilineata group. Juveniles of all groups resemble females.[2]

The tropical gnatcatcher has a thin buzzy gezzz call and a trilled swee see see si si si su su song. However, exact structure and tone of the voice varies greatly over its range.[3]

Distribution and ecology[edit]

The nominate group if found from north-eastern Brazil (the Caatinga region), west through the Amazon Basin, and north to the Guianas, northern Venezuela and northern Colombia (including the valleys of Magdalena and Cauca). The bilineata group is found from north-western Peru, through the Chocó and Central America, to southern Mexico. The Marañón gnatcatcher is restricted to the Marañón valley in northern Peru.[2]

Both the nominate and the bilineata group are found in a wide range of wooded habitats, ranging from the arid woodland and scrub (such as the Caatinga in Brazil) to humid forest (such as the various types of humid forest in the Amazon). They are mainly found in lowlands below an altitude of 1,000 m (3,300 ft),[2] but the taxon maior, which is restricted to dry woodland and scrub, is found at altitudes of 200-2,700 m (650-8,850 ft).[4]

In dense humid forest, it is typically found at canopy height, but it is commonly seen a lower levels in more open habitats. The tropical gnatcatcher gleans spiders and their eggs, beetles, caterpillars and other insects from outer twigs and foliage. Moving about alone or in pairs, it often joins mixed-species feeding flocks with tanagers, New World warblers and honeycreepers.[3]

The nest is a small cup like that of a hummingbird, constructed from vegetable fibres 6.5 – 28 ft (2–8 m) high on a tree branch. The female lays two or three brown-spotted white eggs in May and June.

This is a curious bird and unafraid of humans; this behavior renders it vulnerable to predators however. Even omnivorous mammals as small as the Common marmoset (Callithrix jacchus) will eagerly plunder tropical gnatcatcher nests in the undergrowth – perhaps more often during the dry season when fruits are scarce – despite the birds' attempts to defend their offspring.[5]

Conservation status[edit]

In general, this species is common and widespread throughout most of its range. Consequently, it considered to be of least concern by BirdLife International and IUCN. In the Amazon, this species is primarily associated with relatively open habitats (e.g. Várzea Forest), resulting in it being rather local. It may benefit from the opening of the forest caused by deforestation, at least as long as some stands of trees remain. The Marañón gnatcatcher remains common, but is restricted to a small region with extensive habitat destruction. Three other taxa with highly restricted distributions may be threatened, these being anteocularis of the Magdalena Valley (Colombia), daguae of the Cauca Valley (Colombia), and cinericia of Coiba Island (Panama).[6]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Polioptila plumbea". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g Atwood & Lerman (2006)
  3. ^ a b Hilty (2003)
  4. ^ Schulenberg et al. (2007)
  5. ^ Hilty (2003), de Lyra-Neves et al. (2007)
  6. ^ Atwood & Lerman (2006), BLI (2008)

References[edit]

  • Atwood, J. L. & Lerman, S. B. (2006): Tropical Gnatcatcher (Polioptila plumbea). In: del Hoyo, J.; Elliott, A. & Christie, D. A. (eds.): Handbook of the Birds of the World (Vol. 11: Old World Flycatchers to Old World Warblers): 373–374. Lynx Edicions, Barcelona. ISBN 84-96553-06-X
  • de Lyra-Neves, Rachel M.; Oliveira, Maria A. B.; Telino-Júnior,Wallace R. & dos Santos, Ednilza M. (2007): Comportamentos interespecíficos entre Callithrix jacchus (Linnaeus) (Primates, Callitrichidae) e algumas aves de Mata Atlântica, Pernambuco, Brasil [Interspecific behaviour between Callithrix jacchus (Linnaeus) (Callitrichidae, Primates) and some birds of the Atlantic forest, Pernanbuco State, Brazil]. Revista Brasileira de Zoologia 24(3): 709–716 [Portuguese with English abstract]. doi:10.1590/S0101-81752007000300022 PDF fulltext.
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Salaman, Paul G. W.; Stiles, F. Gary; Bohórquez, Clara Isabel; Álvarez-R., Mauricio; Umaña, Ana María; Donegan, Thomas M. & Cuervo, Andrés M. (2002): New and noteworthy bird records from the east slope of the Andes of Colombia. Caldasia 24(1): 157–189 [English with Spanish abstract]. PDF fulltext
  • Schulenberg, T. S.; Stotz, D. F.; Lane, D. F.; O'Neill, J. P.; & Parker III, T. A. (2007): Field Guide to the Birds of Peru. Christopher Helm, London. ISBN 978-0-7136-8673-9
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!