Overview
Distribution
Baai van Heist, Belgian Exclusive Economic Zone, Belt Sea, German Bight, Swedish Exclusive Economic Zone
-
Gollash, S.; Nehring, S. (2006). National checklist for aquatic alien species in Germany. Aquatic invasions 1(4): 245-269
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10051
-
VLIZ Alien Species Consortium
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=132969
-
Kerckhof, F.; Verbeke, D.; Bauwens, F. (2012). Nieuws uit de Baai van Heist: de roodwieren Caulacanthus ustulatus (Mertens ex Turner) Kützing, 1843 en Gracilaria vermiculophylla (Ohmi) Papenfuss 1967 nieuw voor de Belgische kust en een merkwaardig habitat van intertidale mossels De Strandvlo 32(1): 19-23
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=162899
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gracilaria vermiculophylla
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 73 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 73 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACTTTATATTTAATTTTTGGGGCGTTTTCAGGTATTTTAGGAGGTTGTATGTCAATGTTAATACGTATGGAATTAGCTCAACCAGGTAATCAATTACTATTAGGTAACCACCAAGTTTATAATGTTTTAATTACAGCACATGCGTTTTTAATGATTTTTTTCATGGTTATGCCTGTAATGATAGGAGGATTTGGTAATTGATTAGTTCCTATTATGATAGGAAGTCCTGATATGGCTTTTCCACGCTTAAATAATATTTCCTTTTGATTATTACCCCCTTCACTTTGTTTACTTTTAGCGTCAGCAGTTGTAGAAGTCGGTGTAGGAACAGGATGAACAGTTTATCCTCCATTAAGTTCGATTCAAAGTCACTCAGGCGGAGCTGTAGATTTAGCTATATTTAGTTTGCACATATCAGGAGCCTCTTCAATTTTAGGTGCAATTAATTTTATTTCAACAATTTTAAACATGCGTAATCCCGGACAAAGTTTGTATCGTATGCCATTATTTGTATGATCAATTTTTATCACGGCATTTTTATTATTATTGGCAGTTCCAGTTTTAGCTGGCGCTATTACAATGCTTTTAACTGACCGAAATTTTAATACTGCGTTCTTTGATCCAGCAGGTGGTGGTGATCCTGTATTATATCAACATCTTTTCTGATTTTTTGGACATCCCGAAGT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Gracilaria vermiculophylla
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 73
Specimens with Barcodes: 82
Species With Barcodes: 1
Public Records: 73
Specimens with Barcodes: 82
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
