Overview
Comprehensive Description
Cells are medium sized, usually longer than wide. The Po is bullet shaped. The first apical plate is directly connected to the Po and has a small ventral pore approximately half way between the anterior and posterior end of the plate. A. affine has a descending, excavated cingulum. The sulcus is also excavated and does not penetrate the epitheca.
- Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
- Balech (1985) The genus Alexandrium. Halim (Dinoflagellata). Cork, Sherkn Island Press
- C.J Band Schmidt, C.H Lechuga Devéze, D.M Kulis and D.M Anderson (2003). Culture Studies of Alexandrium affine (Dinophyceae), a Non-Toxic, Cyst Forming Dinoflagellate from Bahía Concepción, Gulf of California. Botanica Marina 46. 44-54.
- NL Nguyen & J Larsen (2004). Potentially toxic microalgae of Vietnamese waters : Gonyaulacales. Opera Botanica, Larsen J., Nguyen N.L. (eds), 140:73-117
© University of Liverpool
Source:
Harmful Phytoplankton Project
Trusted
Distribution
European waters (ERMS scope), United Kingdom Exclusive Economic Zone
-
Brandt, S. (2001). Dinoflagellates, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 47-53
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1338
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
A. affine is a coastal species occurring mainly in Japan, the Gulf of Thailand and the Philippines
- Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
- Balech (1985) The genus Alexandrium. Halim (Dinoflagellata). Cork, Sherkn Island Press
- C.J Band Schmidt, C.H Lechuga Devéze, D.M Kulis and D.M Anderson (2003). Culture Studies of Alexandrium affine (Dinophyceae), a Non-Toxic, Cyst Forming Dinoflagellate from Bahía Concepción, Gulf of California. Botanica Marina 46. 44-54.
- NL Nguyen & J Larsen (2004). Potentially toxic microalgae of Vietnamese waters : Gonyaulacales. Opera Botanica, Larsen J., Nguyen N.L. (eds), 140:73-117
© University of Liverpool
Source:
Harmful Phytoplankton Project
Trusted
Ecology
Habitat
Depth range based on 15 specimens in 1 taxon.
Environmental ranges
Depth range (m): 1 - 5
Graphical representation
Depth range (m): 1 - 5
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 1 - 5
Graphical representation
Depth range (m): 1 - 5
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Alexandrium affine
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 6 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 6 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCACCATTAAGCACTTCTTTCATGAGTTTATCACCTTCAAGTACAGGAAATCTTATCTTTGGATTATTAATCTCAGGTATATCCTCATGTCTCACATCTCTTAACTTTTGGACAACAATTCTAAATCTGAGATCTTATTATCTGACATTAAAGACTATGCCATTATTCCCTTGGGCTCTCTTGATTACAGGAGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTTTTCTAATGGTCTTGGCTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTTTGGTTTTTTGGACATCCAGAAGTTTACATCTTAATAATTCCAGCATTTGGGATCATTAGCATAATAATTTCTGGAATTTTACAAAAAATAATCTTTGGGAACCAATCAATGATCTTTGCCATGAGCTGTATTTCTCTTCTTGGAACTGTTGTTTGGGGACATCATATGTATAC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Alexandrium affine
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Management
Toxicity
Alexandrium affine is a producer of PSP toxins
- Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
- Balech (1985) The genus Alexandrium. Halim (Dinoflagellata). Cork, Sherkn Island Press
- C.J Band Schmidt, C.H Lechuga Devéze, D.M Kulis and D.M Anderson (2003). Culture Studies of Alexandrium affine (Dinophyceae), a Non-Toxic, Cyst Forming Dinoflagellate from Bahía Concepción, Gulf of California. Botanica Marina 46. 44-54.
- NL Nguyen & J Larsen (2004). Potentially toxic microalgae of Vietnamese waters : Gonyaulacales. Opera Botanica, Larsen J., Nguyen N.L. (eds), 140:73-117
© University of Liverpool
Source:
Harmful Phytoplankton Project
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
