Overview

Comprehensive Description

Cells are medium sized, usually longer than wide. The Po is bullet shaped. The first apical plate is directly connected to the Po and has a small ventral pore approximately half way between the anterior and posterior end of the plate. A. affine has a descending, excavated cingulum. The sulcus is also excavated and does not penetrate the epitheca.
  • Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
  • Balech (1985) The genus Alexandrium. Halim (Dinoflagellata). Cork, Sherkn Island Press
  • C.J Band Schmidt, C.H Lechuga Devéze, D.M Kulis and D.M Anderson (2003). Culture Studies of Alexandrium affine (Dinophyceae), a Non-Toxic, Cyst Forming Dinoflagellate from Bahía Concepción, Gulf of California. Botanica Marina 46. 44-54.
  • NL Nguyen & J Larsen (2004). Potentially toxic microalgae of Vietnamese waters : Gonyaulacales. Opera Botanica, Larsen J., Nguyen N.L. (eds), 140:73-117
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© University of Liverpool

Source: Harmful Phytoplankton Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A. affine is a coastal species occurring mainly in Japan, the Gulf of Thailand and the Philippines
  • Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
  • Balech (1985) The genus Alexandrium. Halim (Dinoflagellata). Cork, Sherkn Island Press
  • C.J Band Schmidt, C.H Lechuga Devéze, D.M Kulis and D.M Anderson (2003). Culture Studies of Alexandrium affine (Dinophyceae), a Non-Toxic, Cyst Forming Dinoflagellate from Bahía Concepción, Gulf of California. Botanica Marina 46. 44-54.
  • NL Nguyen & J Larsen (2004). Potentially toxic microalgae of Vietnamese waters : Gonyaulacales. Opera Botanica, Larsen J., Nguyen N.L. (eds), 140:73-117
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© University of Liverpool

Source: Harmful Phytoplankton Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 15 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 5

Graphical representation

Depth range (m): 1 - 5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alexandrium affine

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACCATTAAGCACTTCTTTCATGAGTTTATCACCTTCAAGTACAGGAAATCTTATCTTTGGATTATTAATCTCAGGTATATCCTCATGTCTCACATCTCTTAACTTTTGGACAACAATTCTAAATCTGAGATCTTATTATCTGACATTAAAGACTATGCCATTATTCCCTTGGGCTCTCTTGATTACAGGAGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTTTTCTAATGGTCTTGGCTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTTTGGTTTTTTGGACATCCAGAAGTTTACATCTTAATAATTCCAGCATTTGGGATCATTAGCATAATAATTTCTGGAATTTTACAAAAAATAATCTTTGGGAACCAATCAATGATCTTTGCCATGAGCTGTATTTCTCTTCTTGGAACTGTTGTTTGGGGACATCATATGTATAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alexandrium affine

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Management

Toxicity

Alexandrium affine is a producer of PSP toxins
  • Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
  • Balech (1985) The genus Alexandrium. Halim (Dinoflagellata). Cork, Sherkn Island Press
  • C.J Band Schmidt, C.H Lechuga Devéze, D.M Kulis and D.M Anderson (2003). Culture Studies of Alexandrium affine (Dinophyceae), a Non-Toxic, Cyst Forming Dinoflagellate from Bahía Concepción, Gulf of California. Botanica Marina 46. 44-54.
  • NL Nguyen & J Larsen (2004). Potentially toxic microalgae of Vietnamese waters : Gonyaulacales. Opera Botanica, Larsen J., Nguyen N.L. (eds), 140:73-117
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© University of Liverpool

Source: Harmful Phytoplankton Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!