Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Datana integerrima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGGTCTTTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCATTCCCTCGTATAAATAATATAAGTTTTTGACTATTACCCCCTTCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATGGAGGAAGATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGACTTAATAATATATCTTTTGATCAAATACCTCTATTTGTTTGAGCTGTTGGAATTACAGCTTTCTTATTACTTTTATCTTTACCAGTTTTAGCTGGAGCAATTACTATATTATTAACTGATCGAAATCTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Datana integerrima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 71
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Datana integerrima

The Walnut Caterpillar Moth (Datana integerrima) is a moth of the Notodontidae family. It is found in eastern North America, from Ontario, through most of the Eastern States west to Minnesota and south to northern Mexico.

The wingspan is 35–50 mm. Adults are on wing from May to August.

The larvae feed on hickory, pecan, Carya and Juglans species.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!