Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Brief Summary

Seiurus aurocapilla

A medium-sized (6 inches) wood warbler, the Ovenbird is most easily identified by its light brown upperparts, streaked breast, and orange crown patch. In many respects, this species resembles the related waterthrushes or a small true thrush, but none of those birds possesses this species’ distinctive orange crown. Male and female Ovenbirds are similar in all seasons. The Ovenbird breeds across eastern and central portions of the United States and Canada. In winter, this species may be found in central and southern Florida, the West Indies, Mexico, and Central America. The Ovenbird is absent as a breeding bird from the southeastern U.S., upper Midwest, and northern Great Plains, but may occur in those areas while on migration. Ovenbirds breed in a number of woodland habitats, primarily dense forests partially or entirely composed of deciduous trees. In winter, this species may be found in a number of subtropical or tropical forest types. Ovenbirds primarily eat small invertebrates, notably ants. In appropriate habitat, Ovenbirds may be seen walking on the forest floor while searching for insects in and among dead leaves. Birdwatchers may also listen for this species’ song, a loud “teacher teacher teacher” commonly heard in northern forests in spring. Ovenbirds are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northeastern British Columbia and southern Mackenzie to central Saskatchewan and Newfoundland, south to southern Alberta, western Montana, northern Nebraska, eastern Kansas, northern Alabama, and Carolinas; disjunct population in central Colorado (Van Horn and Donovan 1994, AOU 1998). NON-BREEDING: occasionally in U.S. in southern Texas, Gulf Coast, and North Carolina; most commonly in Mexico, along Pacific coast from Sinaloa south and along Atlantic coast from southern Tamaulipas south; also on Yucatan peninsula; less common throughout Central America, rarely to Colombia and Venezuela; also common in West Indies from central Bahamas to northern Lesser Antilles (fairly common in Puerto Rico and St. John); perhaps annual in Netherlands Antilles (Ridgely and Tudor 1989, Van Horn and Donovan 1994, AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Seiurus_aurocapillus breeds throughout much of the eastern United States and Canada. Along the east coast, Seiurus aurocapillus ranges from southeastern Newfoundland in Canada to northern North Carolina. In Canada, it can be found as far west as central and northern Alberta and as far north as James Bay in the east and southern Northwest Territories in the west. In the United States, Seiurus aurocapillus ranges west to central Minnesota down to western Arkansas, extending in some places west to central Montana and Colorado. Seiurus_aurocapillus winters in Mexico, Central America, and the Caribbean, although on some occasions will overwinter in the southeastern United States west to Texas. (Dunn & Garrett, 1997; National Geographic, 1999)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Seiurus aurocapilla breeds throughout much of the eastern United States and Canada. Along the east coast, S. aurocapilla ranges from southeastern Newfoundland in Canada to northern North Carolina. In Canada, it can be found as far west as central and northern Alberta and as far north as James Bay in the east and southern Northwest Territories in the west. In the United States, S. aurocapilla ranges west to central Minnesota down to western Arkansas, extending in some places west to central Montana and Colorado. Seiurus aurocapilla winters in Mexico, Central America, and the Caribbean, although on some occasions will overwinter in the southeastern United States west to Texas. (Dunn & Garrett, 1997; National Geographic, 1999)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Seiurus_aurocapillus is a large, thrushlike warbler, that is approximately 5.75 - 6 inches (14 -- 15 cm) long and has a mass of approximately 21 grams. It is olive to olive-gray above and white below, with bold black spotting on the underparts aligned into rows. Adult Seiurus aurocapillus has a bold white eye-ring, thin blackish malar stripe, and blackish lateral crown stripes bordering a dull orange central crown stripe. The eye of Seiurus aurocapillus is large and thrushlike, and the legs are pinkish, stout, and long. Males and females have similar plumage. Immature Seiurus aurocapillus are less brightly colored, often with broader olive crown stripes. (Dunn & Garrett, 1997; Van Horn & Donovan, 1994)

Average mass: 21 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Seiurus aurocapilla is a large, thrushlike warbler, that is approximately 5.75 - 6 inches (14 -- 15 cm) long and has a mass of approximately 21 grams. It is olive to olive-gray above and white below, with bold black spotting on the underparts aligned into rows. Adult S. aurocapilla has a bold white eye-ring, thin blackish malar stripe, and blackish lateral crown stripes bordering a dull orange central crown stripe. The eye of S. aurocapilla is large and thrushlike, and the legs are pinkish, stout, and long. Males and females have similar plumage. Immature S. aurocapilla are less brightly colored, often with broader olive crown stripes. (Dunn & Garrett, 1997; Van Horn & Donovan, 1994)

Average mass: 21 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 15 cm

Weight: 19 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: BREEDING: Typically nests in mid-late successional, closed-canopied deciduous or deciduous-coniferous forests that have deep leaf litter and limited understory (Van Horn and Donovan 1994). Also nests in coniferous forest if deciduous forest is unavailable (Noon et al. 1980). Inhabited forest types include oak (QUERCUS)-hickory (CARYA), oak-pine (PINUS), maple (ACER)-basswood (TILIA), maple-birch (BETULA), maple-birch-beech (FAGUS GRANDIFOLIA), hemlock (TSUGA CANADENSIS)-oak, Trembling Aspen (POPULUS TREMULOIDES), and spruce (PICEA)-fir (ABIES) (Askins and Philbrick 1987, Freedman et al. 1981, Titterington et al. 1979, Van Horn and Donovan 1994, Westworth and Telfer 1993). Nests on the ground (Hahn 1937). In studies of regenerating forests following clearcutting, found to be absent from, or in low densities in, young, shrubby, open-canopied stands; whereas they occurred in relative abundance in older, closed-canopied stands (Freedman et al. 1981, Thompson et al. 1992, Titterington et al 1979, Webb et al. 1977, Westworth and Telfer 1993).

NON-BREEDING: In the Caribbean region, utilizes a variety of habitats including coastal dry forest, elfin woodland, forest edge, pine forests, riparian forests, wet forests, wetlands, and urban areas (Arendt 1992). In Costa Rica, inhabits primary and secondary forest (Blake and Loiselle 1992); prefers shady understory of forest with well-developed shrub layer (Stiles and Skutch 1989). In Puerto Rico and surrounding islands, occurs in interior forests as well as mangroves and dry thickets (Raffaele 1989). Considered a forest generalist on the Yucatan Peninsula (Lynch 1989), and captured with equal frequency in primary and secondary forest in Veracruz (Rappole et al. 1992). In the Virgin Islands, inhabits both moist and dry evergreen forest, as well as transition zones between these forest types (Askins et al. 1992). Low numbers inhabit coffee, citrus, cacao, and pine plantations in Puerto Rico, Jamaica, Belize and Costa Rica (Robbins et al. 1992). Captured most frequently in pine savanna in Belize (Petit et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seiurus_aurocapillus is found in mature deciduous or mixed broadleaf-conifer forest with little undergrowth, and occasionally pine forests. Breeding habitats are relatively dry uplands or slopes, although they have been noted to breed in bottomland forests and swampy areas. An abundance of leaf litter on the forest floor is essential for foraging and nest building. Seiurus_aurocapillus requires relatively large contiguous forest tracts for breeding. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seiurus aurocapilla is found in mature deciduous or mixed broadleaf-conifer forest with little undergrowth, and occasionally pine forests. Breeding habitats are relatively dry uplands or slopes, although they have been noted to breed in bottomland forests and swampy areas. An abundance of leaf litter on the forest floor is essential for foraging and nest building. Seiurus aurocapilla requires relatively large contiguous forest tracts for breeding. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Principally follows the Atlantic and Mississippi flyways during migration, although some individuals use the Pacific flyway. Migration is apparently nocturnal (Van Horn and Donovan 1994). Spring migrants leave Costa Rica beginning in March and Puerto Rico in April (Raffaele 1989, Stiles and Skutch 1989), and arrive in Florida from late March through mid-May, with a peak in mid-April (Bent 1953, Taylor and Kershner 1986). In Kentucky, males typically return during the third week of April (Palmer-Ball 1996). Arrives in Michigan from late April through mid-May (Hahn 1937) and in Canada in late May and early June (Bent 1953). Based on kills at towers, fall migration peaks during the latter half of September in Ohio, Illinois, and Iowa, mid-September in New Jersey and late September through early October in Florida (Van Horn and Donovan 1994). Fall migrants arrive in the Neotropics from early September through late October (Raffaele 1989, Stiles and Skutch 1989). Sexes may migrate separately; males in Michigan arrive 9-14 days ahead of females (Hahn 1937).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: BREEDING: Forages for invertebrate prey, principally that inhabiting the leaf litter, while walking or hopping along the ground. Prey is picked from leaf litter, off low vegetation, and the sides of logs (Stenger 1958). Foraging is concentrated in areas of greatest food abundance (Zach and Falls 1979). May forage in trees during outbreaks of larval insects such as the spruce budworm (CHORISTONEURA FUMIFERANA) and striped maple worm (Stenger 1958, Zach and Falls 1975). In New Hampshire, >50% of foraging attacks were directed towards prey in or on the leaf litter (Holmes and Robinson 1988). The stomach contents of 30 adults, obtained using an emetic, was dominated by Coleopterans, Dipterans, Hymenopterans, and Lepidopteran larvae (Holmes and Robinson 1988). In Ontario, the stomach contents of 98 dissected adults contained mostly leaf-litter-inhabiting insects, principally Coleopterans, Hymenopterans, Lepidopteran larvae, and unidentified insect larvae. Invertebrate prey are generally consumed in proportion to their availability (Stenger 1958).

NON-BREEDING: The winter diet includes plant as well as animal material. In Florida, Ovenbirds have been observed feeding on red mulberries (MORUS RUBRA). In Puerto Rico, the stomachs of 13 dissected individuals contained 62.5% animal and 37.5% plant material (Bent 1953).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Seiurus_aurocapillus eats insects, spiders, snails, and worms, primarily while walking on the floor of deciduous of mixed broadleaf-conifer forest among the leaf litter and fallen logs. In spruce budworm outbreaks, Seiurus aurocapillus will feed in trees. Seeds and other vegetation sometimes make up part of its fall and winter diet. Seiurus_aurocapillus will search for food based on prey distribution. It will learn where there are areas of high prey density and repeatedly revisit those sites. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997; Van Horn & Donovan, 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Seiurus aurocapilla eats insects, spiders, snails, and worms, primarily while walking on the floor of deciduous of mixed broadleaf-conifer forest among the leaf litter and fallen logs. In spruce budworm outbreaks, S. aurocapilla will feed in trees. Seeds and other vegetation sometimes make up part of its fall and winter diet. Seiurus aurocapilla will search for food based on prey distribution. It will learn where there are areas of high prey density and repeatedly revisit those sites. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997; Van Horn & Donovan, 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Seiurus aurocapillus is prey of:
Accipiter striatus
Diptera
Secernentia nematodes

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

TERRITORY SIZE/DENSITY: Territory size and male density varies with prey abundance and size of inhabited forest. Territory size of 13 males studied in Ontario ranged from 0.6-1.6 hectares (mean = 0.8) and inversely correlated with the biomass of invertebrate prey, with territory size decreasing as prey biomass increased (Stenger 1958). A negative correlation between territory size and prey abundance was also observed in Tennessee (Smith and Shugart 1987). In Ontario, territory size was significantly smaller during a spruce budworm (CHORISTONEURA FUMIFERANA) outbreak than during non-budworm years (Zach and Falls 1975). Also territorial on the wintering grounds (Rappole and Warner 1980).

In Ontario, densities of males ranged from 0.33-8.3/10 hectares, and increased significantly with increasing woodlot core area (core area is forest 3100 meters from the forest edge; Burke and Nol 1998). In central Missouri, male population density ranged from 0.66-1.73/10 hectares, and increased with increasing forest size (Wenny et al. 1993). Density of males was positively related to size of forest tract and core area in eastern Pennsylvania, ranging from 1.3-7.2 males/10 hectares (Porneluzi et al. 1993). In a managed-forest landscape in New Brunswick, density of males in forest fragments (1.1/10 ha) did not differ statistically from a large contiguous forested tract (1.9/10 ha; Sabine et al. 1996). In northern hardwood forest in New Hampshire, average population density was 13.5 birds/10 hectares (Sabo and Holmes 1983).

SITE FIDELITY: Exhibits breeding site fidelity. In Illinois, 3 of 8 (37.5%) of those banded one year were recaptured the subsequent year (Robinson 1992). Of 22 adults and 40 young banded one year in Michigan, 10 adults (45%) and one yearling (2.5%) returned to the study area the following year. The three returning males occupied their former territory, whereas females either returned to their former territory or occupied an adjacent territory. The following year, the three males again returned and occupied their former territories (Hahn (1937). In New Jersey, 36% of adults and 10% of young banded in one year returned the following year (Leck et al. 1988). In Missouri, an average of 41% of males banded one year returned the next; 64% had second-year territories with >50% overlap with first-year territories, and 26% were adjacent to or overlapped <50% with the territory of the previous year (Porneluzi and Faaborg 1999). Also exhibits site fidelity to wintering grounds (Faaborg and Arendt 1984, Kricher and Davis 1986, Martin and Carr 1986).

POPULATION PARAMETERS: Annual survivorship of birds in Pennsylvania and Michigan was estimated to be 54% (Hahn 1937, Savidge and Davis 1974 cited in Van Horn and Donovan 1994). Overwinter survival rates did not differ between mature and early-successional forests in Belize (Conway et al. 1995). Oldest known individual was 9 years old (Dowell and Robbins 1998).

PARASITES: Adults are host to six species of external parasites, including two lice (MENACANTHUS CHRYSOPHAEUM, MYRSIDEA INCERTA), three ticks (HAEMAPHYSALIS LEPORISPALUSTRIS, IXODES BRUNNEUS, IXODES DAMMINI), and one mite (LIPONYSSUS SYLVIARIUM; Peters 1936 cited in Van Horn and Donovan 1994). Mites have also been found on nestlings (Hahn 1937).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
132 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
132 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

PHENOLOGY: Nests from May-July (Terres 1991). First breeds in the spring after hatching (Van Horn and Donovan 1994).

OVIPOSITION/INCUBATION: Typically produces one clutch per year, although sometimes two or three (Hahn, 1937, Zach and Falls 1975). Average clutch size for 27 nests in Michigan was 4.7 eggs (range = 3-6). First clutches typically had five eggs, subsequent clutches 3-5 (Hahn 1937; statistically significant difference between first and later clutches; Zach and Falls 1975). Mean clutch size of 78 clutches was 4.4 eggs (Van Horn and Donovan 1994). A female that nested three times in one season in Michigan laid a total of 10 eggs (Hahn 1937), another in Ontario laid 13 eggs (Zach and Falls 1975). Eggs are laid every other day and incubation begins after the penultimate egg is laid (Hahn 1937). Females alone incubate the eggs and brood the young. Incubation period ranges from 11.5-14 days (mean = 12.25).

FLEDGING: Young leave the nest when 6.5-8.5 days old (mean = 8), and are capable of flight at 11 days old (Hahn 1937). Both parents feed the young. The brood is typically divided between the parents after the young leave the nest.

NEST SUCCESS: In Michigan, 63.4% of eggs hatched and 43.5% of young fledged (Hahn 1937); in Minnesota, nest success (fledged at least one young) ranged from 75-100% (Hanski, et al. 1996) and in Arkansas, it was 71.4% (Martin 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seiurus_aurocapillus generally breeds in mature deciduous or mixed broadleaf-conifer forest tracts with little undergrowth, but will occasionally breed in pine forests. Seiurus_aurocapillus requires relatively large contiguous forest areas for breeding. The male Seiurus aurocapillus displays above and near the female; often the male pursues the female in a wild courting flight, singing throughout the flight. The male ascends 10--60 feet (3--21 meters) above the treetop level and hovers and flutters with spread wings and tail while singing. The nest of Seiurus aurocapillus is built in the open, on leaf-covered floor of deciduous woods or just above the ground in a clump of low plants or shrubs. Often the nest is placed next to an opening in the forest. The nest is shaped like a Dutch oven, and is the source of the common name "ovenbird." It is built of dried grass, leaves, moss, other vegetative matter, and hair. The nest is well camouflaged with leaves, branches, and other litter placed on the roof. The entrance is a small slit on the side of the nest. Eggs are white with brown and gray markings, and about 0.8 inches (2 cm) long. Seiurus_aurocapillus occasionally has two broods, and even three when spruce budworms are abundant. Females incubate the eggs and flushes only when approached closely and then will perform a distraction display. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997; Zach & Falls, 1975)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seiurus aurocapilla generally breeds in mature deciduous or mixed broadleaf-conifer forest tracts with little undergrowth, but will occasionally breed in pine forests. Seiurus aurocapilla requires relatively large contiguous forest areas for breeding. The male S. aurocapilla displays above and near the female; often the male pursues the female in a wild courting flight, singing throughout the flight. The male ascends 10--60 feet (3--21 meters) above the treetop level and hovers and flutters with spread wings and tail while singing. The nest of S. aurocapilla is built in the open, on leaf-covered floor of deciduous woods or just above the ground in a clump of low plants or shrubs. Often the nest is placed next to an opening in the forest. The nest is shaped like a Dutch oven, and is the source of the common name "ovenbird." It is built of dried grass, leaves, moss, other vegetative matter, and hair. The nest is well camouflaged with leaves, branches, and other litter placed on the roof. The entrance is a small slit on the side of the nest. Eggs are white with brown and gray markings, and about 0.8 inches (2 cm) long. Seiurus aurocapilla occasionally has two broods, and even three when spruce budworms are abundant. Females incubate the eggs and flushes only when approached closely and then will perform a distraction display. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997; Zach & Falls, 1975)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Seiurus aurocapilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAATGTAGTTGTCACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATTATAATCGGAGGATTCGGAAACTGACTAGTACCTCTAATAATTGGAGCCCCAGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGATTACTACCACCATCATTTCTCCTACTCCTAGCATCCTCCACAGTTGAAGCAGGTGTGGGTACAGGCTGAACAGTTTACCCCCCACTAGCTGGCAACCTAGCCCACGCTGGAGCCTCAGTCGACCTAGCAATCTTCTCTCTACACCTGGCCGGTATCTCCTCAATCCTCGGAGCAATCAACTTCATTACAACAGCAATCAACATGAAACCTCCTGCCCTTTCACAGTACCAAACCCCCCTATTTGTTTGATCAGTACTGATTACCGCAGTTCTCCTACTCCTCTCCCTCCCAGTCCTAGCTGCAGGCATCACAATGCTCCTTACAGACCGCAACCTCAACACTACATTCTTCGATCCCGCTGGAGGAGGAGACCCTGTCCTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTTATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Seiurus aurocapilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range; still common in many areas, though significant declines have occurred in some regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Due to its need for large continuous forest tracts, Seiurus aurocapillus is sensitive to forest fragmentation of its breeding habitat and wintering grounds. In breeding grounds, fragmentation of forest decreased suitable breeding sites and increases cowbird parasitism, to which Seiurus aurocapillus is very susceptible. Towers, windows, and other human structures take a large toll on migrating Seiurus aurocapillus. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997; Link & Hahn, 1996)

IUCN Red List of Threatened Species: no special status

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Due to its need for large continuous forest tracts, S. aurocapilla is sensitive to forest fragmentation of its breeding habitat and wintering grounds. In breeding grounds, fragmentation of forest decreased suitable breeding sites and increases cowbird parasitism, to which S. aurocapilla is very susceptible. Towers, windows, and other human structures take a large toll on migrating S. aurocapilla. (Ehrlich, Dobkin, & Wheye, 1988; Dunn & Garrett, 1997; Link & Hahn, 1996)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Declining in some regions of the breeding range, although overall trend seems relatively stable or slowly increasing. North American Breeding Bird Survey (BBS) data indicate a small, but statistically significant population increase (0.6%/year) from 1966-2000 (Sauer et al. 2001). Population trends differ in various portions of North America. A small but statistically significant increase was observed in eastern North America (0.6%/year, n = 1249), whereas non-significant declines were estimated in central and western North America. For the more recent period, 1980-2000, both western North America and Canada showed statistically significant declines of -4.9 and 1.0%/year respectively (Sauer et al. 2001).

Populations declined in some portions of eastern North America as determined by other monitoring methods. Counts of migrants at Long Point, Ontario declined significantly (-6.4%/year) during the 27-year period, 1961-1988 (Hussell et al. 1992). The breeding population at Sapsucker Woods, New York, declined 62% between censuses in 1949-1950 and 1979-1980 (Litwin and Smith 1992). Spring migration count data collected in Massachusetts during a 53-year period (1937-1989) indicated a significant population decline (Hill and Hagan 1991). In the Smoky Mountains, however, the population did not decline between surveys conducted in 1949 and 1983 (Wilcove 1988). Few data are available to examine trends on the winter range. Christmas Bird Count data for Florida and Texas indicate a significant decline (-0.7%/year) from 1959-1988 (Sauer et al. 1996). However, because the majority overwinter in Central America these data are of limited value. The population of wintering birds studied in Puerto Rico generally declined during a 16-year period, although an increase in the last two years suggested the population was recovering (Faaborg and Arendt 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: SUMMARY: On the breeding grounds, forest fragmentation has resulted in increased Brown-headed Cowbird (MOLOTHRUS ATER) nest parasitism, increased nest predation by a variety of predators, and reduced pairing and reproductive success. Habitat is also lost or degraded, in the short-term, by clearcutting or other forms of timber harvest that open the canopy.

TIMBER HARVEST: Reduction of the forest canopy is also a threat. Forest thinning associated with recreational cottage construction in Ontario, fuelwood cutting in Massachusetts, and timber harvest in New York reduced habitat suitability (Chadwick et al. 1986, Clark et al. 1983, Webb et al. 1977). In Arkansas, restoration of Red-cockaded Woodpecker (PICOIDES BOREALIS) habitat (midstory hardwood removal followed by burning) eliminated Ovenbirds (Wilson et al. 1995). Habitat changes associated with waste-water irrigation can influence distribution.

This species apparently reaches higher densities than elsewhere in its range within the western boreal forest of Canada, and is threatened there by forest conversion to agriculture along the southern edges of the boreal zone. In Saskatchewan alone, 4368 square kilometers of forest was lost to agriculture in the period 1966-1994, a rate of -0.87%/year (Hobson et al. 2002). Much of the remaining southern boreal forest in western Canada has been leased to forestry companies (Cummings et al. 1994, Stelfox 1995). Deforestation is the primary threat to wintering birds.

NEST PARASITISM: Nests are parasitized by Brown-headed Cowbirds throughout the range (Van Horn and Donovan 1994). Percentage of parasitized nests range from 10% in Quebec (Terrill 1961) to 80% in Wisconsin (Brittingham and Temple 1983). Nest parasitism by Brown-headed Cowbirds decreases with increasing distance from the forest edge. Whereas nest parasitism was 100% within 99 meters of forest edge, it declined to zero 3300 meters from the edge (Brittingham and Temple 1983).

FOREST FRAGMENTATION: Frequency of Brown-headed Cowbird nest parasitism is also influenced by forest fragmentation. Frequency of nest parasitism by Brown-headed Cowbirds was lower in contiguous forested tracts in Missouri (2.5%) and Wisconsin and Minnesota (4%) than in forest fragments in Missouri (66.5%) and Wisconsin and Minnesota (19%; Donovan et al. 1995). In fragmented landscapes, Ovenbirds raise more Brown-headed Cowbirds than in unfragmented landscapes (Porneluzi and Faaborg 1999). Forest fragmentation also decreases male pairing success and nesting success (Burke and Nol 1998, Gibbs and Faaborg 1990, Porneluzi and Faaborg 1999, Porneluzi et al. 1993, Van Horn et al 1995, Villard et al. 1993). Male pairing success varies from zero in small forest fragments within an agricultural landscape to 100% in large tracts (Burke and Nol 1998). However, in managed-forest landscapes, forest fragmentation may not impair male pairing success (Sabine et al. 1996). Forest-dividing roads and powerline corridors can produce edge effects and reduce population density and/or male pairing success (Ortega and Capen 1999, Rich et al. 1994).

PREDATION: The predation rate of 14 nests in oak-hickory forest in Arkansas was 28.6% (Martin 1993). Nest predation may be affected by proximity to forest edge. In a forest fragment within an agricultural landscape, predation of artificial dome nests was significantly greater near the forest edge (<20 meters) than in the forest interior (200 and 400 meters from the edge; Linder and Bollinger 1995). Natural nests in similar forest fragments are also heavily predated (Donovan et al. 1995, Porneluzi et al. 1993). In managed-forest landscapes, however, proximity to edge may or may not influence nest predation. Whereas nesting success was negatively impacted by proximity to edge in a managed-forest landscape in New Hampshire (King et al. 1996), proximity to edge had no influence on nest success in similar habitat in Minnesota (Hanski et al. 1996). Nest predators include various snakes, the Blue Jay (CYANOCITTA CRISTATA), Brown-headed Cowbird, Red Squirrel (TAMIASCIURUS HUDSONICUS), Eastern Gray Squirrel (SCIURUS CAROLINENSIS), Raccoon (PROCYON LOTOR), Striped Skunk (MEPHITIS MEPHITIS), and weasel (MUSTELA sp.). Broad-winged Wawks (BUTEO PLATYPTERUS) prey on young and adults. Suspected predators include the Barred Oowl (STRIX VARIA), American Crow (CORVA BRACHYRHYNCHOS), Common Grackle (QUISCALUS QUISCULA), Deer Mouse (PEROMYSCUS MANICULATUS), Eastern Chipmunk (TAMIAS STRIATUS), Northern Flying Squirrel (GLAUCOMYS VOLANS), Virginia Opossum (DIDELPHIS VIRGINIANA), Red Fox (VULPES VULPES), Domestic Cat (FELIS DOMESTICUS) and Black Bear (URSUS AMERICANUS; Hahn 1937, Reitsma et al. 1990, Van Horn and Donovan 1994).

OTHER: Numerous individuals are killed by striking television towers and other similar tall structures during migration (Taylor and Kershner 1986). In Pennsylvania, less likely to inhabit tracts of forest irrigated with waste-water than non-irrigated forest (Yahner 1995).

WINTERING: On the wintering grounds threatened by deforestation, replacement of diverse native plant communities with agricultural and silvicultural monocultures, and subsistence hunting (Arendt 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Does not appear to need urgent recovery/restoration efforts. As second-growth forests mature, breeding habitat should become more suitable. However, these second-growth forests are also becoming more suitable for harvest. If logging is not conducted sustainably, large areas of habitat will be lost (P. Porneluzi, pers. comm.). The trend towards protecting larger tracts of land and restoring pre-Columbian plant communities, such as deciduous forest, should result in additional suitable breeding habitat. Recolonization of reforested areas following timber harvest indicates adaptability to changes in habitat availability/suitability. For example, a Connecticut population that declined following cutting of a nearby forest rebounded with reforestation (Askins and Philbrick 1987).

Preserve Selection and Design Considerations: Although classified as a forest-interior, area sensitive species (Freemark and Collins 1992), will nest in woodlots as small as 4 hectares in size (Forman et al. 1976, Galli et al. 1976). Minimum area requirements vary across the range. The minimum forested area required to maintain a viable breeding population in Maryland was estimated to be 100 hectares, though maximum densities occur in forested tracts >2650 hectares (Robbins 1979 cited in Bushman and Therres 1988). In Missouri, did not occur in tracts <341 hectares in extent (Hayden et al. 1985). Burke and Nol (1998) suggest that the minimum forest fragment size necessary for successful reproduction in Ontario is 380 hectares, with a 20 hectare core area (amount of habitat at least 100 meters from edge). Due to edge effects, Van Horn et al. (1995) recommended that calculations of the minimum-area requirement focus on core areas (which they defined as habitat 300 meters from the forest edge) rather than the area of the entire forest. Fragmentation effects are influenced not only by fragment size, but by the habitat surrounding the fragment. A forest fragment embedded within an agricultural landscape and isolated from other forest fragments is less suitable than a fragment embedded within a managed-forest landscape or close to other forest fragments. In South Carolina, for example, Ovenbirds inhabited hardwood stands surrounded by pine plantations, but were absent from hardwood stands of similar size surrounded by agricultural habitat (Kilgo et al. 1997). In Minnesota, edge effects (reduced nesting success due to nest predation/parasitism) were not detected in a managed forest landscape (Hanski et al. 1996). In Maryland, numbers were positively correlated with forest patch size, but negatively correlated with distance to forest tract 350 hectares in size (Lynch and Whigham 1984). As a result of reduced pairing/reproductive success, small, isolated forest fragments can act as reproductive sinks (Porneluzi et al. 1993, Porneluzi and Faaborg 1999). Forest fragmentation effects can be produced by forest-dividing corridors. For example, abundance was reduced significantly by forest-dividing powerline corridors averaging 22.5 meters wide (Rich et al. 1994). Observed only in riparian corridors 3175 meters wide in a study of bird use of riparian corridors traversing agricultural land in Iowa (Stauffer and Best 1980).

Management Requirements: Large, contiguous forested tracts are needed for successful breeding in order to maintain long-term population viability (Burke and Nol 1998, Porneluzi and Faaborg 1999). Larger tracts are required in the Midwest, smaller in the north and east where densities are higher (P. Porneluzi, pers. comm.). If setting aside large tracts is not possible, land managers should strive to minimize edge-to-interior ratios on small tracts, and prioritize for protection those small tracts in close proximity to forests that meet or exceed the minimum area requirement (Van Horn et al. 1995). In managed-forest landscapes, edge effects can be minimized by making clearcuts as circular as possible and creating fewer, but larger clearcuts because this results in less edge than many small clearcuts of the same area. In addition, the gradual transition from clearcut to shelterwood cut to forest interior may reduce predation rates (King et al. 1996). Uneven-age forest management may be the most compatible form of timber harvest. Single-tree selection and thinning of understory trees can maintain and create favorable habitat conditions (Crawford et al. 1981). However, caution should be exercised because populations can be reduced by selective logging that opens the canopy (Chadwick et al. 1986, Freedman et al. 1981, Robinson and Robinson 1999, and Yahner 1993).

Management Research Needs: Little known regarding stopover ecology and other migration requirements, or the ecology on the wintering grounds. Need more information on reproductive success in various habitats and landscapes (P. Porneluzi, pers. comm.). Also need data on densities in various habitats, and of use of small fragments, second-growth forests, and shrubby habitats bordering agricultural lands (Van Horn and Donovan 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Seiurus_aurocapillus is well studied by scientists in North America, partly due to its need for large mature forest tracts. Birdwatchers will travel to rural areas with large forest tracts to observe Seiurus aurocapillus. (Dunn & Garrett, 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Seiurus aurocapilla is well studied by scientists in North America, partly due to its need for large mature forest tracts. Birdwatchers will travel to rural areas with large forest tracts to observe S. aurocapilla. (Dunn & Garrett, 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: On the breeding grounds, forest fragmentation has resulted in increased Brown-headed Cowbird (MOLOTHRUS ATER) nest parasitism, increased nest predation by a variety of predators, and reduced pairing and reproductive success. Habitat is also lost or degraded, in the short-term, by clearcutting or other forms of timber harvest that open the canopy. Deforestation is the primary threat to wintering birds. Large forested tracts are required to maintain viable (self-sustaining) breeding populations. Minimum forest fragment size necessary to maintain a viable breeding population varies with geography and surrounding land use. Due to the prevalence of Brown-headed Cowbirds, forest fragments in the western portion of the Ovenbird's range need to be larger than those in the eastern portion. Forest fragments in an agricultural landscape need to be larger than those in a managed-forest landscape. In addition, forest fragments isolated from other forested tracts are less suitable than fragments close to other forests. Mature, closed-canopied forests are preferred for breeding. Where management objectives include timber harvest, single-tree selection is the most appropriate means of extracting the timber resource while simultaneously maintaining habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ovenbird

For other uses, see Ovenbird (disambiguation).

The ovenbird (Seiurus aurocapilla) is a small songbird of the New World warbler family (Parulidae). This migratory bird breeds in eastern North America and winters in Central America, many Caribbean Islands, Florida, and northern Venezuela.[2][3]

Taxonomy[edit]

The genus Seiurus is currently treated as monotypic, containing only the ovenbird; it is genetically distinct from all other species in the family Parulidae, probably the first genus to evolve separately from the rest of the family.[4]

Before the recent genetic studies were carried out, the waterthrushes were also included in Seiurus;[3][5] these are now treated separately in the genus Parkesia as they are not very closely related to the ovenbird.[4]

The species name aurocapilla is a noun phrase, so the original spelling is retained, not changed according to the gender of the genus name; Linnaeus originally named it Motacilla aurocapilla, and the ending is not to be changed to -us as commonly cited in the past.[6] Etymologically the scientific name aurocapilla comes from Latin meaning "golden haired" and Seiurus from Greek seio, the verb to shake, and urus, from tail.[7]

Description[edit]

Adult with raised "crest"; Léon-Provancher marsh, Québec (Canada)

Ovenbirds are large wood warblers and is sometimes confused by the untrained for a thrush. Adults measure 11–16 cm (4.3–6.3 in) long and span 19–26 cm (7.5–10.2 in) across the wings.[8][9][10] They weigh 19 g (0.67 oz) on average,[11] with a range of 14–28.8 g (0.49–1.02 oz).[8] Among standard measurements, the wing chord is 6.8 to 8.3 cm (2.7 to 3.3 in), the tail is 5 to 5.8 cm (2.0 to 2.3 in), the bill is 1.1 to 1.3 cm (0.43 to 0.51 in) and the tarsus is 2 to 2.3 cm (0.79 to 0.91 in).[3] They tend to be heavier in winter and particularly at the start of their migration.[12] They have olive-brown upperparts and white underparts heavily streaked with black; the flanks have an olive hue. A white ring surrounds the eyes, and a black stripe runs below the cheek. They have a line of orange feathers with olive-green tips running along the top of their head, bordered on each side with blackish-brown. The orange feathers can be erected to form a small crest. The eyes and the upper part of the thin pointed beak are dark, while the lower beak is horn-colored and the legs and feet are pinkish.[2]

Males and females look alike. Immature birds have tawny fringes to the tertiary remiges and sometimes buff-tipped outer primary wing coverts. Most conspicuously, the olive-green tips of the crown feathers, which are hardly visible in adult birds, are far larger in extent in immatures and cover the orange crown-stripe almost or completely.[2]

The main song of the ovenbird is a series of strident, relatively low-pitched, bisyallabic motives repeated without pause about eight times and increasing in volume. Usually, the second syllable in each motive is sharply accented: "chur-tee’ chur-tee’ chur-tee’ chur-tee’ chur-TEE chur-TEE chur-TEE!" Male ovenbirds utter a sweet chattering song in the air at twilight, after the manner of the skylark,[13] incorporating portions of the main song into a jumble of sputtering notes and mimicry as they dive back to earth. The call is a variably pitched, sharp "chik!" Some variations recall the common call note of a downy woodpecker. If the bird is excited, it may repeat this call several times.[2] The fight call is a high, rising siiii.

Ovenbird song recorded in Minnesota

Range and ecology[edit]

Their breeding habitats are mature deciduous and mixed forests, especially sites with little undergrowth, across Canada and the eastern United States. For foraging, it prefers woodland with abundant undergrowth of shrubs; essentially, it thrives best in a mix of primary and secondary forest. Ovenbirds migrate to the southeastern United States, the Caribbean, and from Mexico to northern South America. The birds are territorial all year round, occurring either singly or (in the breeding season) as mated pairs, for a short time accompanied by their young. During migration, they tend to travel in larger groups however, dispersing again once they reach their destination.[2]

In winter, they dwell mainly in lowlands, but may ascend up to 1,500 m (4,900 ft) ASL e.g. in Costa Rica. The first migrants leave in late August and appear on the wintering grounds as early as September, with successive waves arriving until late October or so. They depart again to breed between late March and early May, arriving on the breeding grounds throughout April and May. Migration times do not seem to have changed much over the course of the 20th century.[2][14][15]

This bird seems just capable of crossing the Atlantic, as there have been a handful of records in Norway, Ireland and Great Britain. However, half of the six finds were of dead birds. A live ovenbird on St Mary's, Isles of Scilly in October 2004 was in bad condition, and died despite being taken into care.[16]

Ovenbirds forage on the ground in dead leaves, sometimes hovering or catching insects in flight. This bird frequently tilts its tail up and bobs its head while walking; at rest, the tail may be flicked up and slowly lowered again, and alarmed birds flick the tail frequently from a half-raised position. These birds mainly eat terrestrial arthropods and snails, and also include fruit[17] in their diet during winter.[2]

The nest, referred to as the "oven" (which gives the bird its name), is a domed structure placed on the ground, woven from vegetation, and containing a side entrance. Both parents feed the young birds. The placement of the nest on the ground makes predation by chipmunks (Tamias) a greater concern than for tree-nesting birds. Chipmunks have been known to burrow directly into the nest to eat the young birds.[3]

The ovenbird is vulnerable to nest parasitism by the brown-headed cowbird (Molothrus ater), which is becoming more plentiful in some areas. However, the ovenbirds' numbers appear to be remaining stable. Altogether, it is not considered a threatened species by the IUCN.[1][3]

In literature[edit]

It is the subject of a poem by Robert Frost, "The Oven Bird", published in his poetry collection Mountain Interval in 1916. Robert Bly also makes reference to "the nimble oven bird" in his short poem "The Slim Fir Seeds."

References[edit]

  1. ^ a b BirdLife International (2012). "Seiurus aurocapilla". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
  3. ^ a b c d e Curson, Jon; Quinn, David; Beadle, David (1994). New World Warblers. London: Christopher Helm. ISBN 0-7136-3932-6. 
  4. ^ a b Lovette, IJ; Pérez-Emán, JL; Sullivan, JP; Banks, RC; Fiorentino, I; Córdoba-Córdoba, S; Echeverry-Galvis, M; Barker, FK; Burns, KJ (2010). "A comprehensive multilocus phylogeny for the wood-warblers and a revised classification of the Parulidae (Aves)". Molecular Phylogenetics & Evolution 57 (2): 753–70. doi:10.1016/j.ympev.2010.07.018. PMID 20696258. 
  5. ^ Sibley, D. (2000). The Sibley Field Guide to Birds. New York: Alfred A. Knopf. ISBN 0-679-45122-6. 
  6. ^ David, N.; Gosselin, M. (2002). "Gender agreement of avian species names". Bull. Brit. Orn. Club 122 (1): 14–49.  [Seiurus aurocapilla, item #169, p. 38].
  7. ^ Jobling, James A. (2010). The Helm dictionary of Scientific Bird Names. London: Helm. ISBN 978-1-4081-2501-4. 
  8. ^ a b Ovenbird, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2012-08-24.
  9. ^ Smithsonian Tropical Research Institute-Seiurus aurocapilla. Biogeodb.stri.si.edu. Retrieved on 2012-08-24.
  10. ^ Ovenbird (Seiurus aurocapilla). Planet of Birds (2011-06-08). Retrieved on 2012-08-24.
  11. ^ Seiurus aurocapilla (Ovenbird). Global Species. Retrieved on 2012-08-24.
  12. ^ e.g. a male wintering on Grand Cayman weighed 20.5 g (0.72 oz): Olson, Storrs L.; James, Helen F.; Meister, Charles A. (1981). "PDF fulltext Winter field notes and specimen weights of Cayman Island Birds" (PDF). Bull. B.O.C. 101 (3): 339–346. 
  13. ^ Wikisource-logo.svg "Oven-bird". New International Encyclopedia. 1905. 
  14. ^ Henninger, W. F. (1906). "A preliminary list of the birds of Seneca County, Ohio" (PDF). Wilson Bulletin 18 (2): 47–60. 
  15. ^ Ohio Ornithological Society (April 2004). "Annotated Ohio state checklist". 
  16. ^ Rogers, M. J. et al. (2005). Report on rare birds in Great Britain in 2004. British Birds 98: 628–694 [Ovenbird, p. 688].
  17. ^ E.g. of Cymbopetalum mayanum (Annonaceae): Foster, Mercedes S (2007). "The potential of fruit trees to enhance converted habitats for migrating birds in southern Mexico". Bird Conservation International 17: 45. doi:10.1017/S0959270906000554. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly known as Seiurus aurocapillus, but changed for grammatical reasons (AOU 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!